FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022751822> ?p ?o ?g. }

• W2022751822 endingPage "27547" @default.
• W2022751822 startingPage "27537" @default.
• W2022751822 abstract "Leucine zippers are oligomerization domains used in a wide range of proteins. Their structure is based on a highly conserved heptad repeat sequence in which two key positions are occupied by leucines. The leucine zipper of the cell cycle-regulated Nek2 kinase is important for its dimerization and activation. However, the sequence of this leucine zipper is most unusual in that leucines occupy only one of the two hydrophobic positions. The other position, depending on the register of the heptad repeat, is occupied by either acidic or basic residues. Using NMR spectroscopy, we show that this leucine zipper exists in two conformations of almost equal population that exchange with a rate of 17 s−1. We propose that the two conformations correspond to the two possible registers of the heptad repeat. This hypothesis is supported by a cysteine mutant that locks the protein in one of the two conformations. NMR spectra of this mutant showed the predicted 2-fold reduction of peaks in the 15N HSQC spectrum and the complete removal of cross peaks in exchange spectra. It is possible that interconversion of these two conformations may be triggered by external signals in a manner similar to that proposed recently for the microtubule binding domain of dynein and the HAMP domain. As a result, the leucine zipper of Nek2 kinase is the first example where the frameshift of coiled-coil heptad repeats has been directly observed experimentally. Leucine zippers are oligomerization domains used in a wide range of proteins. Their structure is based on a highly conserved heptad repeat sequence in which two key positions are occupied by leucines. The leucine zipper of the cell cycle-regulated Nek2 kinase is important for its dimerization and activation. However, the sequence of this leucine zipper is most unusual in that leucines occupy only one of the two hydrophobic positions. The other position, depending on the register of the heptad repeat, is occupied by either acidic or basic residues. Using NMR spectroscopy, we show that this leucine zipper exists in two conformations of almost equal population that exchange with a rate of 17 s−1. We propose that the two conformations correspond to the two possible registers of the heptad repeat. This hypothesis is supported by a cysteine mutant that locks the protein in one of the two conformations. NMR spectra of this mutant showed the predicted 2-fold reduction of peaks in the 15N HSQC spectrum and the complete removal of cross peaks in exchange spectra. It is possible that interconversion of these two conformations may be triggered by external signals in a manner similar to that proposed recently for the microtubule binding domain of dynein and the HAMP domain. As a result, the leucine zipper of Nek2 kinase is the first example where the frameshift of coiled-coil heptad repeats has been directly observed experimentally. Intracellular signaling pathways that regulate processes such as cell cycle control rely on formation of specific protein complexes at the right time and place. As a result, a wide range of conserved interaction motifs have evolved among which the leucine zipper is one of the most common and versatile. Leucine zippers were first identified as dimerization domains in bZIP transcription factors with a sequence motif consisting of leucines repeated every 7 amino acids (1Landschulz W.H. Johnson P.F. McKnight S.L. Science. 1988; 240: 1759-1764Crossref PubMed Scopus (2513) Google Scholar). The relevance of the repeating heptad sequence was clarified when it was shown that leucine zippers assume a coiled-coil fold (2Oas T.G. McIntosh L.P. O'Shea E.K. Dahlquist F.W. Kim P.S. Biochemistry. 1990; 29: 2891-2894Crossref PubMed Scopus (129) Google Scholar, 3Saudek V. Pastore A. Castiglione M.A. Frank R. Gausepohl H. Gibson T. Weih F. Roesch P. Protein Eng. 1990; 4: 3-10Crossref PubMed Scopus (58) Google Scholar, 4O'Shea E.K. Klemm J.D. Kim P.S. Alber T. Science. 1991; 254: 539-544Crossref PubMed Scopus (1268) Google Scholar). In this structure, the first and fourth residues (i.e. positions A and D in the heptad sequence, ABCDEFG) of each helix point toward each other and thus form a hydrophobic core. Residues in positions E and G flank the hydrophobic core residues and are often occupied by charged residues that can form salt bridges. The latter are of particular significance in heterodimeric leucine zippers as they help to determine specificity. Residues in positions B, C, and F are usually not of importance as their side-chains point away from the coiled-coil interface. Leucine zippers show great versatility as they can exist as dimers, trimers, or tetramers, can be homo- or hetero-oligomers and can form parallel or anti-parallel complexes (5Alber T. Curr. Opin. Genet. Dev. 1992; 2: 205-210Crossref PubMed Scopus (249) Google Scholar, 6Adamson J.G. Zhou N.E. Hodges R.S. Curr. Opin. Biotechnol. 1993; 4: 428-437Crossref PubMed Scopus (95) Google Scholar, 7Mason J.M. Arndt K.M. ChemBioChem. 2005; 5: 170-176Crossref Scopus (532) Google Scholar). Although leucine zippers have been best characterized in transcription factors, they also exist in many other signaling proteins including protein kinases (8Mukai H. Ono Y. Biochem. Biophys. Res. Commun. 1994; 199: 897-904Crossref PubMed Scopus (140) Google Scholar). Protein kinase activation often involves a trans-autophosphorylation step that is facilitated by the physical proximity of two kinase molecules. In the case of receptor tyrosine kinases, this may be brought about by crosslinking of two receptors as a result of extracellular ligand binding. Some cytoplasmic kinases on the other hand contain their own oligomerization domain. One example is the cell cycle-regulated kinase, Nek2, which consists of an N-terminal catalytic domain and a C-terminal region that contains multiple regulatory motifs, including a leucine zipper (9Fry A.M. Oncogene. 2002; 21: 6184-6194Crossref PubMed Scopus (170) Google Scholar) (Fig. 1A). For this kinase, oligomerization via the leucine zipper is essential for full activation both in vitro and in vivo, most likely as a result of it promoting trans-autophosphorylation (10Fry A.M. Arnaud L. Nigg E.A. J. Biol. Chem. 1999; 274: 16304-16310Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 11Rellos P. Ivins F.J. Baxter J.E. Pike A. Nott T.J. Parkinson D.M. Das S. Howell S. Fedorov O. Shen Q.Y. Fry A.M. Knapp S. Smerdon S.J. J. Biol. Chem. 2007; 282: 6833-6842Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). In a previous study on the role of the Nek2 leucine zipper, we noted that the sequence, in terms of the distribution of hydrophobic and charged residues, is somewhat unusual (10Fry A.M. Arnaud L. Nigg E.A. J. Biol. Chem. 1999; 274: 16304-16310Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar) (Fig. 2). However, no structural studies were undertaken at the time. Here, we now show that the Nek2 leucine zipper does indeed display highly atypical biophysical properties with NMR spectroscopy clearly showing that the leucine zipper exists in two conformations, which exchange on a relatively slow timescale. This raises the intriguing possibility that the dimerization and, as a result, activation of the Nek2 kinase may be subject to specific regulation. It is also the first time that the exchange of a coiled-coil domain, indirectly inferred for several completely unrelated proteins, has been directly observed experimentally. Domain definitions for Nek2 kinase were taken from annotations of entry P51955 from the Uniprot database with small modifications for Fig. 1A. Leucine zipper prediction was performed with the 2ZIP server (12Bornberg-Bauer E. Rivals E. Vingron M. Nucleic Acids Res. 1998; 26: 2740-2746Crossref PubMed Scopus (102) Google Scholar). The coiled-coil prediction was performed with the COILS server (13Lupas A. Van Dyke M. Stock J. Science. 1991; 252: 1162-1164Crossref PubMed Scopus (3441) Google Scholar). Single helix preference as well as N- and C-caps were calculated with the web-based version of AGADIR (14Muñoz V. Serrano L. Nat. Struct. Biol. 1994; 1: 399-409Crossref PubMed Scopus (600) Google Scholar). Pattern searches were performed with the program pattinprot (15Bucher P. Karplus K. Moeri N. Hofmann K. Comput. Chem. 1996; 20: 3-23Crossref PubMed Scopus (256) Google Scholar). Phosphorylation sites around the Nek2 leucine zipper were taken from the literature (11Rellos P. Ivins F.J. Baxter J.E. Pike A. Nott T.J. Parkinson D.M. Das S. Howell S. Fedorov O. Shen Q.Y. Fry A.M. Knapp S. Smerdon S.J. J. Biol. Chem. 2007; 282: 6833-6842Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar, 16Daub H. Olsen J.V. Bairlein M. Gnad F. Oppermann F.S. Körner R. Greff Z. Kéri G. Stemmann O. Mann M. Mol. Cell. 2008; 31: 438-448Abstract Full Text Full Text PDF PubMed Scopus (482) Google Scholar). The helical wheel in Fig. 2B was initially generated using the EMBOSS (17Rice P. Longden I. Bleasby A. Trends Genet. 2000; 16: 276-277Abstract Full Text Full Text PDF PubMed Scopus (6252) Google Scholar) application pepwheel and then adapted to incorporate the two heptad repeats. SDS-PAGE analysis was performed following a 1:500 trypsin:target (w/w) incubation at 25 °C. Aliquots were withdrawn at 2, 5, 10, 20, 30, and 60 min. The reaction for each time point was immediately halted by the addition of Pefabloc SC (2 mm final) and PSC protector solution (5% v/v final) from Roche. Sequencing grade modified trypsin was obtained from Promega. To identify the protected fragments, a 60-min limited digest was performed, as above, and the products separated by reverse-phase chromatography using a JASCO HPLC and a 4.5 ml Zorbex stable bond 300 C3 column at 1 ml/min heated to 55 °C. The column was developed with 5–50% acetonitrile, 0.05% TFA (trifluoroacetic acid) pH 1.8 at 1% acetonitrile/min. Peaks were collected in 0.5-ml fractions and monitored at 280, 220, and 210 nm wavelengths. The fractions were analyzed by standard electrospray MS procedures. Protein molecular weight was determined using a stand-alone syringe pump (Perkin Elmer, Foster City, CA) coupled to a Platform electrospray mass spectrometer (Micromass, Manchester, UK). Samples were desalted on-line using a 2 × 10 mm guard column (Upchurch Scientific, Oak Harbor, WA) packed with 50 micron Poros RII resin (Perseptive Biosystems, Framingham) inserted in place of the sample loop on a rheodyne 7125 valve. Proteins were injected onto the column in 10% acetonitrile, 0.10% formic acid, washed with the same solvent and then step-eluted into the mass spectrometer in 70% acetonitrile, 0.1% formic acid at a flow rate of 10 μl/min. The mass spectrometer was calibrated using myoglobin. Standard samples comprised of 100 pmol of protein at a minimum concentration of 1 μm. All protein expression constructs were cloned into pETM-11 vectors obtained from the Protein Expression Laboratory at EMBL Heidelberg. Inserts were generated by polymerase chain reaction using 2.5 units of Platinum® Pfx DNA Polymerase (Roche) with 200 ng of template, 500 nm of each primer, 1.2 mm dNTP mix, and 1 mm MgSO4 on a Techne TC-312 thermocycler. Amplification was done by initial denaturation for 2′ at 94 °C followed by 30 cycles of 15″ melting at 94 °C, 60″ at 60 °C and 30″ extension at 68 °C. Primers for constructs LZ0 and LZ5 were LZ05′: GGAGCGCCCATGGCGCGACAATTAGGAGAG; LZ03′: GGATCCTTATAGCAAGCTGTAGTTCTTCACAGATTTTCTGC; LZ55′: GCGCCCATGGCGGTATTGAGTGAGCTGAAACTG; LZ53′: GGATCCTTAGTCCTCTGCTAGTCTCTCACG, respectively. PCR products were purified with QIAquick PCR purification kit according to the manufacturer's protocol. Purified PCR products and pETM-11 target vector DNA were double digested with NcoI and BamHI. The product of the vector digestion was purified by electrophoresis on a 1% agarose gel (analytical quality, Melford Labs). DNA was extracted from excised bands using the QIAquick gel extraction kit. 50 ng of gel purified digestion product from the vector and 150 ng of digested PCR product were mixed and ligated using the rapid DNA ligation kit (Roche). 1/10 of the ligation reaction was transformed into 100 μl DH5a-T1R chemical competent cells (Invitrogen). Transformed cells were checked for inserts by colony PCR. Point mutations were generated using the QuikChange kit (Stratagene) using the manufacturer's protocol. Mutagenesis primers were C335A: CAGAAAGAACAGGAGCTTGCAGTTCGTGAGAGACTAG and GTCTCTCACGAACTGCAAGCTCCTGTTCTTTCTG; K309C: CTGTATTGAGTGAGCTGAAACTGTGTGAAATTCAGTTACAGGAGCGAGA and TCTCGCTCCTGTAACTGAATTTCACACAGTTTCAGCTCACTCAATACAG; E310C: ATTGAGTGAGCTGAAACTGAAGTGTATTCAGTTACAGGAGCGAGAGC and GCTCTCGCTCCTGTAACTGAATACACTTCAGTTTCAGCTCACTCAAT (mutated codon indicated in bold). For all constructs and mutants, small scale cultures were grown for several positive clones, and DNA was prepared with the Qiagen miniprep kit. Accuracy of vector and insert was checked by DNA sequencing. For protein expression, miniprep DNA was transformed into BL21* cells (Invitrogen). Transformed cells were grown up in LB medium to OD ∼0.8 when they were induced with 0.75 mm IPTG for 4 h. For 15N isotope labeling the protocol was modified as suggested (18Marley J. Lu M. Bracken C. J. Biomol. NMR. 2001; 20: 71-75Crossref PubMed Scopus (601) Google Scholar). Cells were opened using a French Press cell at 1000 psi. The proteins were purified on fast flow 6 (GE Healthcare) columns of 2 ml resin, equilibrated as per the manufacturer's instructions. After loading the samples, the columns were washed with 30 ml of wash buffer (20 mm phosphate pH 7.5, 500 mm NaCl, 10 mm imidazole, 1 mm β-ME, 0.02% NaN3) before elution with 10 ml of elution buffer (as wash buffer, but with 500 mm imidazole). The eluted protein was incubated with AcTEV protease (Invitrogen) for 2 h at room temperature followed by dialysis 3× against 1 liter of fast flow 6 wash buffer. The protein solution was applied a second time to the affinity column to remove nonspecific binding proteins. Where required, a final polishing step using a Sephadex 16/70 gel filtration column (GE Healthcare) was performed using an AKTA purification system. Fractions containing the pure protein were pooled and concentrated in Vivaspin concentrators (Sartorius) with 3 kDa molecular mass cut-off. Protein concentrations were determined using the Qbit fluorescence assay (Invitrogen). Protein samples were exchanged into NMR buffer (20 mm sodium phosphate, 50 mm NaCl, pH 7.0, 2 mm DTT, 0.02% NaN3) using PD10 or Nap5 columns (GE Healthcare), which were also used for all other experiments. The only exceptions were samples of disulfide locked LZ5 K309C/C335A, LZ5 E310C/C335A, and LZ0 K309C/C335A for which DTT was omitted from the buffer. CD spectroscopy. All CD experiments were recorded on a JASCO700 instrument fitted with a Peltier temperature control system. Square cuvettes with 0.1 or 1 mm path length were used with protein concentrations ranging from 20–200 μm. Spectra were calibrated using software provided by the manufacturer. Secondary structure content was estimated using home written Mathematica (Wolfram Research) macros by comparison to standard curves for α-helix, β-sheet, and random coil. To measure thermal unfolding curves, samples were heated at 1 °C/min while the CD signal at a constant wavelength of 222 nm was measured. Unfolding curves were fitted to the equation for a two-state unfolding reaction using a home written Mathematica macro to extract the melting temperature. Analytical ultracentrifugation (AUC) 3The abbreviations used are: AUCanalytical ultracentrifugationNOESYnuclear Overhauser enhancement spectroscopyHSQCheteronuclear single quantum coherenceTOCSYtotal correlation spectroscopyRDCresidual dipolar couplingsMTBDmicrotubule binding domainHAMPdomain in histidine kinases, adenylyl cyclases, methyl accepting chemotaxis receptors, and phosphatases. sedimentation velocity experiments were carried out on a Beckman XL-I centrifuge using an An50-Ti rotor at 4 °C and a speed of 42,000 rpm (LZ0) and an An-60 Ti rotor at 20 °C and a speed of 60,000 rpm (LZ5 and LZ5 mutants). Scans were recorded using the interference optical system until no further sedimentation occurred. Sample concentrations were about 10–200 μm in standard NMR buffers. Protein partial specific volume and buffer density and viscosity were calculated using SEDNTERP (19Laue T.M. Shah B.D. Ridgeway T.M. Pelletier S.L. Harding S.E. Rowe A.J. Horton J.C. Ultracentrifugation in Biochemistry and Polymer Science. Royal Society of Chemistry, Cambridge, U.K1992: 90-125Google Scholar). The experimental data were analyzed using Sedfit (20Schuck P. Biophys. J. 2000; 78: 1606-1619Abstract Full Text Full Text PDF PubMed Scopus (2978) Google Scholar) by fitting to the c(s) and c(s,f/f0) models with one discrete component (LZ0) and results for some samples confirmed by two-dimensional spectrum analysis, enhanced van-Holde-Weischet analysis and Genetic Algorithm analysis using UltraScan (21Demeler B. Scott J. Harding S.E. Rowe A. UltraScan A Comprehensive Data Analysis Software Package for Analytical Ultracentrifugation Experiments, In Modern Analytical Ultracentrifugation: Techniques and Methods. Royal Society of Chemistry (UK), 2005: 210-229Google Scholar) confirmed by Monte-Carlo analysis. analytical ultracentrifugation nuclear Overhauser enhancement spectroscopy heteronuclear single quantum coherence total correlation spectroscopy residual dipolar couplings microtubule binding domain domain in histidine kinases, adenylyl cyclases, methyl accepting chemotaxis receptors, and phosphatases. Spectra were recorded at a temperature of 298 K on Bruker Avance 600 and 800 MHz spectrometers fitted with 5 mm cryoprobes. The HSQC spectrum was used as provided by the manufacturer with small modifications to increase safety of the probe. Exchange experiments were as previously described (22Farrow N.A. Zhang O. Forman-Kay J.D. Kay L.E. J. Biomol. NMR. 1994; 4: 727-734Crossref PubMed Scopus (382) Google Scholar), except modified to increase the dispersion of the peaks by changing from a 15N-1H view to a 1H-1H NOESY-like view and also by combining both views into a three-dimensional experiment. 4F. W. Muskett, R. A. Croasdale, A. M. Fry, and M. Pfuhl, unpublished results. For qualitative analysis exchange experiments with a mixing time of 64 ms were used, for the quantitative analysis of the exchange rate the following mixing times were used: 8, 16, 24, 32, 64, 96, and 160 ms. Diagonal and cross peak intensities for sufficiently well resolved systems of exchanging amide resonances were extracted using CCPN analysis (23Vranken W.F. Boucher W. Stevens T.J. Fogh R.H. Pajon A. Llinas M. Ulrich E.L. Markley J.L. Ionides J. Laue E.D. Proteins. 2005; 59: 687-696Crossref PubMed Scopus (2215) Google Scholar) and fitted to standard equations for slow exchange (22Farrow N.A. Zhang O. Forman-Kay J.D. Kay L.E. J. Biomol. NMR. 1994; 4: 727-734Crossref PubMed Scopus (382) Google Scholar) using a home written Mathematica macro to yield exchange rates and 15N longitudinal relaxation rates. 15N longitudinal (R1) and transversal (R2) were also measured directly using delays of 16, 48, 96, 192, 288, 384, 512, 704, 880, 1120, and 1440 ms for R1 and 5, 10, 15, 20, 31, 41, 61, 82, 102, 133, 154 ms for R2. Sequence-specific assignment of mutant LZ5 K309C/C335A in non-reducing NMR buffer was based on standard triple resonance three-dimensional experiments (HNCACB, HN(CO)CACB, HBHA(CBCACO)NH) recorded on a 0.6 mm 15N/13C labeled sample on a Bruker Avance 500 MHz spectrometer equipped with a cryoprobe combined with a 3D 15N resolved NOESY spectrum recorded on a 0.8 mm 15N labeled sample on a 700 MHz Bruker Avance spectrometer equipped with a cryoprobe. The assignment was performed with CCPN analysis (23Vranken W.F. Boucher W. Stevens T.J. Fogh R.H. Pajon A. Llinas M. Ulrich E.L. Markley J.L. Ionides J. Laue E.D. Proteins. 2005; 59: 687-696Crossref PubMed Scopus (2215) Google Scholar). RDCs were measured in the presence of 10 mg/ml of pf1 phage (Hyglos GmbH, Germany) in NMR buffer using a standard IPAP 1H-15N correlation experiment (24Ottiger M. Delaglio F. Bax A. J. Magn. Reson. 1998; 131: 373-378Crossref PubMed Scopus (836) Google Scholar). The error associated with the measured RDC values is ± 1.5 Hz. A coiled-coil model was generated for the Nek2 leucine zipper residues 299–341 using a program provided by G. Offer (25Offer G. Sessions R. J. Mol. Biol. 1995; 249: 967-987Crossref PubMed Scopus (51) Google Scholar). This program generates standard coiled-coils based on the definition of the geometry provided as input. No further energy minimization was performed. Parameters used were pitch = 144 Å, helix radius = 4.7 Å, relative rotation of strands = 210°, residue translation for one residue in the helix = 1.495 Å. The same sequence was used as input for models for both heptad repeats. The only difference was the definition of the first A- residue: Leu-306 in HepI and Leu-303 in HepII. RDCs were calculated for the models using PALES (26Zweckstetter M. Nat. Protoc. 2008; 3: 679-690Crossref PubMed Scopus (260) Google Scholar) selecting pf1 phage as alignment medium at a concentration of 10 mg/ml, electrostatic mode, a sodium chloride concentration of 50 mm and default settings for all other parameters. The Nek2A kinase consists of an N-terminal catalytic domain (residues 8–271) followed by a C-terminal regulatory region (residues 272–445) that encompasses a leucine zipper (residues 305–335) followed immediately by an additional short coiled-coil (residues 340–355) (Fig. 1A). To determine whether the C-terminal region is subdivided into a particular domain organization, limited proteolysis experiments were performed on full-length protein (Fig. 1B) and the complete C-terminal regulatory region (Fig. 1C and supplemental Fig. S1) to identify stable fragments. A ∼8 kDa fragment appeared consistently in both experiments. It was shown by mass spectrometry to cover not only the leucine zipper but all of the following coiled-coil and a short section of the linker connecting it at the N-terminal end to the catalytic domain (residues 290–360). This 8 kDa fragment was subcloned into the pETM-11 expression vector and termed LZ0. For comparison, a series of constructs was generated covering only the predicted core leucine zipper. The best behaved of these, based on a number of criteria including expression yield in bacteria, solubility and stability, was termed LZ5 (residues 299–343). For all biophysical experiments, LZ0 and LZ5 proteins were expressed in bacteria, purified using nickel affinity chromatography followed by removal of the His tag and polished via gel filtration (data not shown). Meaningful leucine zipper scores provided by the program 2zip (12Bornberg-Bauer E. Rivals E. Vingron M. Nucleic Acids Res. 1998; 26: 2740-2746Crossref PubMed Scopus (102) Google Scholar) start around residue 305 and continue to approximately residue 335 (Fig. 2A). Coiled-coil scores provided by the COILS software (13Lupas A. Van Dyke M. Stock J. Science. 1991; 252: 1162-1164Crossref PubMed Scopus (3441) Google Scholar) cover the leucine zipper, drop to insignificant levels around residue 335, and then return to a significant level from residue 340–355. The leucine zipper is defined by the presence of leucine residues every 7 amino acids. However, in the conventional heptad repeat of a leucine zipper, a second position is also occupied by another leucine or equally compatible hydrophobic residue such that, in the repeating heptad ABCDEFG, positions A and D would normally both be occupied by hydrophobic residues. In Nek2, though, one of these hydrophobic positions is missing, such that the heptad pattern can be positioned in two ways: the leucines can be in the A-position (heptad I) or in the d-position (heptad II). It is traditionally thought that leucine prefers the d-position, but the energetic contribution to coiled-coil stability and the frequency by which leucine is found in either position in leucine zipper sequences are very similar (27Tripet B. Wagschal K. Lavigne P. Mant C.T. Hodges R.S. J. Mol. Biol. 2000; 300: 377-402Crossref PubMed Scopus (208) Google Scholar). Regardless of the positions of the heptad repeats in Nek2, charged residues would occupy the second conserved position. In heptad I, it would be lysine or arginine in the D position, while in heptad II, it would be glutamate in the A position. Curiously, lysine and arginine in general prefer the A position while glutamate prefers the D position (27Tripet B. Wagschal K. Lavigne P. Mant C.T. Hodges R.S. J. Mol. Biol. 2000; 300: 377-402Crossref PubMed Scopus (208) Google Scholar, 28Straussman R. Ben-Ya'acov A. Woolfson D.N. Ravid S. J. Mol. Biol. 2007; 366: 1232-1242Crossref PubMed Scopus (31) Google Scholar). Even though charged residues have been found in the hydrophobic core of other coiled-coils, e.g. myosin, they compromise the stability and make the Nek2 leucine zipper a non-ideal coiled-coil. It is interesting to note the consistent occupation of the normally hydrophobic A and D positions by charged residues in the leucine zipper of Nek2. Of the 6 A positions in heptad II, 5 are occupied by glutamate (the first is occupied by a leucine), while in the case of heptad I, lysine and arginine each take 3 of the 6 D positions (Fig. 2). The high degree of conservation of these destabilizing residues suggests an important function. To determine whether other proteins contain related leucine zippers which might allow hetero-oligomerization, similarity searches were performed with a pattern search program (15Bucher P. Karplus K. Moeri N. Hofmann K. Comput. Chem. 1996; 20: 3-23Crossref PubMed Scopus (256) Google Scholar) using the pattern LXXR/KEXX repeated five times. No coiled-coil sequences other than that of Nek2 were found in this search, even allowing for up to two mismatches. Hence, the primary function of this motif in Nek2 would appear to be to promote homodimerization rather than heterodimerization with a different partner molecule. As a first biophysical approach to understand their conformation, CD spectroscopy was performed on the LZ0 and LZ5 polypeptides. The spectra were virtually identical and typical of coiled-coils with minima at 208 and 222 nm and the intensity of the 208 nm peak slightly stronger than the 222 nm peak (Fig. 3A). The molar ellipticities at 222 nm of approximately −22,000 deg mol−1 cm−2 suggested the presence of ∼70% α-helix, in good agreement with expectation. Melting curves showed reasonably cooperative thermal unfolding with relatively high melting temperatures of 57 °C for LZ5 and a slightly higher value of 66 °C for LZ0 (Fig. 3B). These data show that the core leucine zipper sequence alone is sufficient to assume a proper fold and that the additional coiled-coil only adds extra stability. To determine whether the bacterially expressed LZ0 and LZ5 proteins were dimeric as opposed to higher order oligomers, they were subjected to sedimentation velocity analytical ultracentrifugation (AUC). Results strongly supported the conclusion that LZ0 and the LZ5 proteins predominantly formed dimeric molecules that were stable over the relevant concentration range (tested over 10–250 μm). As an example, the sedimentation velocity analysis is shown for LZ0 (Fig. 4A) with the main peak indicating a molecular weight within 500 Da of the calculated molecular mass of the dimer at 17,468 Da. All parameters are listed in Table 1. Although the peaks are not perfectly symmetrical, it can be concluded that the leucine zipper of the Nek2 kinase, with or without the extra coiled-coil portion, forms a dimer as the predominant species. Under the conditions of these experiments there was no sign of higher order oligomers.TABLE 1Sedimentation velocity results for the leucine zipper constructs employed in this studyConstructSappS20,wF/F0Monomer MWApparent MWSSkDakDaLZ0, 228 μm0.861.401.78.717.0LZ0, 29 μm0.891.401.78.717.7LZ51.101.111.55.410.7LZ5 C335A/K309C reduced1.071.081.55.410.0LZ5 C335A/K309C oxidized1.051.061.65.410.1 Open table in a new tab Early NMR studies of constructs of the Nek2 leucine zipper showed unusual “twins” of resonances in homonuclear NOESY and TOCSY spectra suggesting the presence of multiple forms of the protein (data not shown). A more detailed analysis of potential isoforms was therefore performed using a 15N-labeled sample of LZ5. In an HSQC experiment, automatic peak picking with CCPN analysis (23Vranken W.F. Boucher W. Stevens T.J. Fogh R.H. Pajon A. Llinas M. Ulrich E.L. Markley J.L. Ionides J. Laue E.D. Proteins. 2005; 59: 687-696Crossref PubMed Scopus (2215) Google Scholar) gave >75 peaks, significantly more than the expected ∼40 peaks, confirming the presence of at least two forms of the protein (Fig. 5A). Very similar spectra were obtained for LZ0, although as the quality of the spectra was much inferior (Fig. 3) all subsequent NMR work was done on LZ5. To establish if the isoforms were in dynamic equilibrium, two NMR exchange experiments were recorded (22Farrow N.A. Zhang O. Forman-Kay J.D. Kay L.E. J. Biomol. NMR. 1994; 4: 727-734Crossref PubMed Scopus (382) Google Scholar) via transfer to 15N. The resulting two-dimensional spectrum can then take the shape of an HSQC experiment by frequency labeling the nitrogen in t1 (Fig. 5B), or the appearance of a NOESY experiment with frequency labeling of the amide proton in t1 (Fig. 5C). Both experiments clearly demonstrated that a substantial number of resonances in the Nek2 leucine zipper undergo slow exchange on the chemical shift time scale (Fig. 5, B and C). To further improve the identification of exchange cross peaks, both versions of the exchange experiment were combined into a three-dimensional version that" @default.
• W2022751822 created "2016-06-24" @default.
• W2022751822 creator A5010027320 @default.
• W2022751822 creator A5010506386 @default.
• W2022751822 creator A5019525044 @default.
• W2022751822 creator A5021948242 @default.
• W2022751822 creator A5025469280 @default.
• W2022751822 creator A5028979365 @default.
• W2022751822 creator A5045151192 @default.
• W2022751822 creator A5053395495 @default.
• W2022751822 creator A5077153564 @default.
• W2022751822 date "2011-08-01" @default.
• W2022751822 modified "2023-09-30" @default.
• W2022751822 title "An Undecided Coiled Coil" @default.
• W2022751822 cites W1518494845 @default.
• W2022751822 cites W1971151709 @default.
• W2022751822 cites W1974326515 @default.
• W2022751822 cites W1975317507 @default.
• W2022751822 cites W1982555128 @default.
• W2022751822 cites W1991612575 @default.
• W2022751822 cites W1994631727 @default.
• W2022751822 cites W1996423252 @default.
• W2022751822 cites W1997199912 @default.
• W2022751822 cites W1999637228 @default.
• W2022751822 cites W2002695465 @default.
• W2022751822 cites W2005393972 @default.
• W2022751822 cites W2019935314 @default.
• W2022751822 cites W2024645073 @default.
• W2022751822 cites W2051181331 @default.
• W2022751822 cites W2053621664 @default.
• W2022751822 cites W2055290772 @default.
• W2022751822 cites W2059229862 @default.
• W2022751822 cites W2060547523 @default.
• W2022751822 cites W2063074006 @default.
• W2022751822 cites W2064047527 @default.
• W2022751822 cites W2068254342 @default.
• W2022751822 cites W2079984069 @default.
• W2022751822 cites W2083939457 @default.
• W2022751822 cites W2100884728 @default.
• W2022751822 cites W2109939279 @default.
• W2022751822 cites W2112103709 @default.
• W2022751822 cites W2114394718 @default.
• W2022751822 cites W2116963688 @default.
• W2022751822 cites W2119931639 @default.
• W2022751822 cites W2135554123 @default.
• W2022751822 cites W2141513355 @default.
• W2022751822 cites W2157961198 @default.
• W2022751822 cites W2162952718 @default.
• W2022751822 cites W2169707043 @default.
• W2022751822 cites W2172219847 @default.
• W2022751822 cites W2322865149 @default.
• W2022751822 doi "https://doi.org/10.1074/jbc.m110.196972" @default.
• W2022751822 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3149346" @default.
• W2022751822 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21669869" @default.
• W2022751822 hasPublicationYear "2011" @default.
• W2022751822 type Work @default.
• W2022751822 sameAs 2022751822 @default.
• W2022751822 citedByCount "33" @default.
• W2022751822 countsByYear W20227518222012 @default.
• W2022751822 countsByYear W20227518222013 @default.
• W2022751822 countsByYear W20227518222014 @default.
• W2022751822 countsByYear W20227518222015 @default.
• W2022751822 countsByYear W20227518222016 @default.
• W2022751822 countsByYear W20227518222017 @default.
• W2022751822 countsByYear W20227518222018 @default.
• W2022751822 countsByYear W20227518222019 @default.
• W2022751822 countsByYear W20227518222020 @default.
• W2022751822 countsByYear W20227518222021 @default.
• W2022751822 countsByYear W20227518222022 @default.
• W2022751822 countsByYear W20227518222023 @default.
• W2022751822 crossrefType "journal-article" @default.
• W2022751822 hasAuthorship W2022751822A5010027320 @default.
• W2022751822 hasAuthorship W2022751822A5010506386 @default.
• W2022751822 hasAuthorship W2022751822A5019525044 @default.
• W2022751822 hasAuthorship W2022751822A5021948242 @default.
• W2022751822 hasAuthorship W2022751822A5025469280 @default.
• W2022751822 hasAuthorship W2022751822A5028979365 @default.
• W2022751822 hasAuthorship W2022751822A5045151192 @default.
• W2022751822 hasAuthorship W2022751822A5053395495 @default.
• W2022751822 hasAuthorship W2022751822A5077153564 @default.
• W2022751822 hasBestOaLocation W20227518222 @default.
• W2022751822 hasConcept C185592680 @default.
• W2022751822 hasConcept C55493867 @default.
• W2022751822 hasConcept C55988834 @default.
• W2022751822 hasConcept C70721500 @default.
• W2022751822 hasConcept C86803240 @default.
• W2022751822 hasConceptScore W2022751822C185592680 @default.
• W2022751822 hasConceptScore W2022751822C55493867 @default.
• W2022751822 hasConceptScore W2022751822C55988834 @default.
• W2022751822 hasConceptScore W2022751822C70721500 @default.
• W2022751822 hasConceptScore W2022751822C86803240 @default.
• W2022751822 hasIssue "31" @default.
• W2022751822 hasLocation W20227518221 @default.
• W2022751822 hasLocation W20227518222 @default.
• W2022751822 hasLocation W20227518223 @default.
• W2022751822 hasLocation W20227518224 @default.
• W2022751822 hasOpenAccess W2022751822 @default.
• W2022751822 hasPrimaryLocation W20227518221 @default.

• next