FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022775504> ?p ?o ?g. }

• W2022775504 endingPage "1076" @default.
• W2022775504 startingPage "1066" @default.
• W2022775504 abstract "Background & Aims: FHL2 (4-1/2 LIM protein 2) is an adapter and modifier in protein interactions that is expressed mainly in the heart and ovary. It functions in a cell type- or promoter-specific manner. The aims of this study were to examine its expression in gastrointestinal cancers and to determine its role in cell differentiation and tumorigenesis. Methods: FHL2 expression in cancerous and normal gastrointestinal cells was detected by reverse-transcription polymerase chain reaction, immunoblotting, and immunohistochemistry. The effect of FHL2 suppression by both antisense and siRNA methods on cell differentiation and growth were evaluated in vitro and in vivo. Results: FHL2 expression was up-regulated in gastrointestinal cancer, compared with matched normal tissues. Stable transfection of gastric cancer cell line, AGS, and colon cancer cell line, Lovo, with antisense FHL2 induced lengthened or shuttle-shape morphologic changes with long or dendritic-like cytoplasmic processes and decreased the nuclear:cytoplasmic ratio. FHL2 antisense induced expressions of carinoembryonic antigen and E-cadherin and the maturation of F-actin. Furthermore, FHL2 antisense inhibited the transcriptions of some oncogenes including cox-2, survivin, c-jun, and hTERT, and suppressed the promoter activity of activator protein-1 and hTERT. Suppression of FHL2 inhibited serum-dependent, anchorage-dependent and -independent cell growth, and suppressed de novo tumor formation in nude mice xenograft. Conclusions: Suppression of FHL2 induces cell differentiation and inhibits tumorigenesis. Antisense or siRNA methods targeting FHL2 is a promising strategy for treatment of gastrointestinal cancers. Background & Aims: FHL2 (4-1/2 LIM protein 2) is an adapter and modifier in protein interactions that is expressed mainly in the heart and ovary. It functions in a cell type- or promoter-specific manner. The aims of this study were to examine its expression in gastrointestinal cancers and to determine its role in cell differentiation and tumorigenesis. Methods: FHL2 expression in cancerous and normal gastrointestinal cells was detected by reverse-transcription polymerase chain reaction, immunoblotting, and immunohistochemistry. The effect of FHL2 suppression by both antisense and siRNA methods on cell differentiation and growth were evaluated in vitro and in vivo. Results: FHL2 expression was up-regulated in gastrointestinal cancer, compared with matched normal tissues. Stable transfection of gastric cancer cell line, AGS, and colon cancer cell line, Lovo, with antisense FHL2 induced lengthened or shuttle-shape morphologic changes with long or dendritic-like cytoplasmic processes and decreased the nuclear:cytoplasmic ratio. FHL2 antisense induced expressions of carinoembryonic antigen and E-cadherin and the maturation of F-actin. Furthermore, FHL2 antisense inhibited the transcriptions of some oncogenes including cox-2, survivin, c-jun, and hTERT, and suppressed the promoter activity of activator protein-1 and hTERT. Suppression of FHL2 inhibited serum-dependent, anchorage-dependent and -independent cell growth, and suppressed de novo tumor formation in nude mice xenograft. Conclusions: Suppression of FHL2 induces cell differentiation and inhibits tumorigenesis. Antisense or siRNA methods targeting FHL2 is a promising strategy for treatment of gastrointestinal cancers. FHL2 (4-1/2 LIM protein 2), also known as DRAL (down-regulated in rhabdomyosarcoma LIM protein),1Genini M. Schwalbe P. Scholl F.A. Remppis A. Mattei M.G. Schafer B.W. Subtractive cloning and characterization of DRAL, a novel LIM-domain protein down-regulated in rhabdomyosarcoma.DNA Cell Biol. 1997; 16: 433-442Crossref PubMed Scopus (114) Google Scholar was initially cloned by its abundant expression in the human heart. It is the second member of a small family of 5 proteins with 4-1/2 LIM domains. The acronym LIM is derived from the names of 3 transcription factors, Lin-11, Isl-1, and Mec-3, in which such a domain was first identified. LIM domains are characterized by the cysteine-rich consensus CX2CX16-23HX2CX2CX2CX16-21CX2-3(C/H/D), and function as adapters and modifiers in protein interactions and those alterations of transcription networks lead to leukemia.2Sanchez-Garcia I. Rabbitts T.H. LIM domain proteins in leukaemia and development.Semin Cancer Biol. 1993; 4: 349-358PubMed Google Scholar, 3Kadrmas J.L. Beckerle M.C. The LIM domain: from the cytoskeleton to the nucleus.Nat Rev Mol Cell Biol. 2004; 5: 920-931Crossref PubMed Scopus (583) Google Scholar LIM domains are present in many proteins that have diverse cellular roles as regulators of gene expression, cyto-architecture, cell adhesion, cell motility, and signal transduction.3Kadrmas J.L. Beckerle M.C. The LIM domain: from the cytoskeleton to the nucleus.Nat Rev Mol Cell Biol. 2004; 5: 920-931Crossref PubMed Scopus (583) Google Scholar, 4Retaux S. Bachy I. A short history of LIM domains (1993–2002): from protein interaction to degradation.Mol Neurobiol. 2002; 26: 269-281Crossref PubMed Scopus (55) Google Scholar FHL2 is particularly intriguing because it can function as either a repressor or activator of target proteins in a cell type-dependent fashion, and interacts with other proteins. FHL2 serves as a transcriptional co-activator of androgen receptor,5Labalette C. Renard C.A. Neuveut C. Buendia M.A. Wei Y. Interaction and functional cooperation between the LIM protein FHL2, CBP/p300, and beta-catenin.Mol Cell Biol. 2004; 24: 10689-10702Crossref PubMed Scopus (101) Google Scholar activator protein-1 (AP-1), CREB, CREM, ERK2, BRCA1, WT-1, NF-κB, IGFBP-5, hNP220, presenilin 2, and hCDC47 in transformed cell types.5Labalette C. Renard C.A. Neuveut C. Buendia M.A. Wei Y. Interaction and functional cooperation between the LIM protein FHL2, CBP/p300, and beta-catenin.Mol Cell Biol. 2004; 24: 10689-10702Crossref PubMed Scopus (101) Google Scholar, 6Morlon A. Sassone-Corsi P. The LIM-only protein FHL2 is a serum-inducible transcriptional coactivator of AP-1.Proc Natl Acad Sci U S A. 2003; 100: 3977-3982Crossref PubMed Scopus (115) Google Scholar, 7Martin B. Schneider R. Janetzky S. Waibler Z. Pandur P. Kuhl M. Behrens J. von der Mark K. Starzinski-Powitz A. Wixler V. The LIM-only protein FHL2 interacts with beta-catenin and promotes differentiation of mouse myoblasts.J Cell Biol. 2002; 159: 113-122Crossref PubMed Scopus (126) Google Scholar, 8Wei Y. Renard C.A. Labalette C. Wu Y. Levy L. Neuveut C. Prieur X. Flajolet M. Prigent S. Buendia M.A. Identification of the LIM protein FHL2 as a coactivator of beta-catenin.J Biol Chem. 2003; 278: 5188-5194Crossref PubMed Scopus (124) Google Scholar, 9Ng E.K. Chan K.K. Wong C.H. Tsui S.K. Ngai S.M. Lee S.M. Kotaka M. Lee C.Y. Waye M.M. Fung K.P. Interaction of the heart-specific LIM domain protein, FHL2, with DNA-binding nuclear protein, hNP220.J Cell Biochem. 2002; 84: 556-566Crossref PubMed Scopus (31) Google Scholar, 10Canault M. Tellier E. Bonardo B. Mas E. Aumailley M. Juhan-Vague I. Nalbone G. Peiretti F. FHL2 interacts with both ADAM-17 and the cytoskeleton and regulates ADAM-17 localization and activity.J Cell Physiol. 2006; 208: 363-372Crossref PubMed Scopus (35) Google Scholar It also acts as a transcriptional co-repressor of the promyelocytic leukemia zinc-finger protein in muscle cells.11McLoughlin P. Ehler E. Carlile G. Licht J.D. Schafer B.W. The LIM-only protein DRAL/FHL2 interacts with and is a corepressor for the promyelocytic leukemia zinc finger protein.J Biol Chem. 2002; 277: 37045-37053Crossref PubMed Scopus (70) Google Scholar Thus, FHL2 represents a network-forming protein common to several signaling pathways. In adults, FHL2 is expressed mainly by healthy or diseased heart tissue and, to a lesser extent, by ovarian tissue.12Chan K.K. Tsui S.K. Lee S.M. Luk S.C. Liew C.C. Fung K.P. Waye M.M. Lee C.Y. Molecular cloning and characterization of FHL2, a novel LIM domain protein preferentially expressed in human heart.Gene. 1998; 210: 345-350Crossref PubMed Scopus (124) Google Scholar It exerts different functions in different types of cells. FHL2 protein can shuttle between cytoplasm and nucleus, and may be involved in heart muscle differentiation and the maintenance of the heart phenotype. C2C12 mouse myoblasts stably expressing FHL2 show increased myogenic differentiation reflected by accelerated myotubule formation and expression of muscle-specific proteins.7Martin B. Schneider R. Janetzky S. Waibler Z. Pandur P. Kuhl M. Behrens J. von der Mark K. Starzinski-Powitz A. Wixler V. The LIM-only protein FHL2 interacts with beta-catenin and promotes differentiation of mouse myoblasts.J Cell Biol. 2002; 159: 113-122Crossref PubMed Scopus (126) Google Scholar, 9Ng E.K. Chan K.K. Wong C.H. Tsui S.K. Ngai S.M. Lee S.M. Kotaka M. Lee C.Y. Waye M.M. Fung K.P. Interaction of the heart-specific LIM domain protein, FHL2, with DNA-binding nuclear protein, hNP220.J Cell Biochem. 2002; 84: 556-566Crossref PubMed Scopus (31) Google Scholar However, the role of FHL2 in the differentiation of other tissues and transformed cells remain elusive. It has been reported that FHL2 is expressed in myoblasts but down-regulated in malignant rhabdomyosarcoma cells.1Genini M. Schwalbe P. Scholl F.A. Remppis A. Mattei M.G. Schafer B.W. Subtractive cloning and characterization of DRAL, a novel LIM-domain protein down-regulated in rhabdomyosarcoma.DNA Cell Biol. 1997; 16: 433-442Crossref PubMed Scopus (114) Google Scholar However, other studies reported that FHL2 was highly expressed by various types of cancer cells, and acts as an oncogene. For example, expression of FHL2 protein in epithelial ovarian cancer and hepatoblastoma tissues was markedly up-regulated,8Wei Y. Renard C.A. Labalette C. Wu Y. Levy L. Neuveut C. Prieur X. Flajolet M. Prigent S. Buendia M.A. Identification of the LIM protein FHL2 as a coactivator of beta-catenin.J Biol Chem. 2003; 278: 5188-5194Crossref PubMed Scopus (124) Google Scholar, 13Gabriel B. Mildenberger S. Weisser C.W. Metzger E. Gitsch G. Schule R. Muller J.M. Focal adhesion kinase interacts with the transcriptional coactivator FHL2 and both are overexpressed in epithelial ovarian cancer.Anticancer Res. 2004; 24: 921-927PubMed Google Scholar compared with the matched normal tissues. Colon cancer cell line SW480, cervical cancer cell line HeLa, and some breast cancer cell lines also expressed high levels of FHL2.12Chan K.K. Tsui S.K. Lee S.M. Luk S.C. Liew C.C. Fung K.P. Waye M.M. Lee C.Y. Molecular cloning and characterization of FHL2, a novel LIM domain protein preferentially expressed in human heart.Gene. 1998; 210: 345-350Crossref PubMed Scopus (124) Google Scholar, 14Yan J. Zhu J. Zhong H. Lu Q. Huang C. Ye Q. BRCA1 interacts with FHL2 and enhances FHL2 transactivation function.FEBS Lett. 2003; 553: 183-189Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar In addition, FHL2 interacted with and activated oncogenic proteins, AP-1, and β-catenin6Morlon A. Sassone-Corsi P. The LIM-only protein FHL2 is a serum-inducible transcriptional coactivator of AP-1.Proc Natl Acad Sci U S A. 2003; 100: 3977-3982Crossref PubMed Scopus (115) Google Scholar, 8Wei Y. Renard C.A. Labalette C. Wu Y. Levy L. Neuveut C. Prieur X. Flajolet M. Prigent S. Buendia M.A. Identification of the LIM protein FHL2 as a coactivator of beta-catenin.J Biol Chem. 2003; 278: 5188-5194Crossref PubMed Scopus (124) Google Scholar transient transfection of FHL2 into melanocyte stimulated cell proliferation.15Chen D. Xu W. Bales E. Colmenares C. Conacci-Sorrell M. Ishii S. Stavnezer E. Campisi J. Fisher D.E. Ben-Ze’ev A. Medrano E.E. SKI activates Wnt/beta-catenin signaling in human melanoma.Cancer Res. 2003; 63: 6626-6634PubMed Google Scholar These findings suggest that FHL2 may play an important role in carcinogenesis. However, direct evidence is still lacking. In this study, we first showed that FHL2 expression is elevated in gastrointestinal cancer cell lines and cancer tissues. Because FHL2 is highly expressed by cancer cells, we suppressed its expression by antisense and RNA interfering strategies, and determined the effect on cell differentiation and tumorigenicity. Results from this study demonstrated, for the first time, that suppression of FHL2 promoted cell differentiation and inhibited carcinogenesis of gastrointestinal (GI) cancer cells. Sodium butyrate and all-trans retinoic acid (ATRA) were purchased from Sigma (St. Louis, MO). Rhodamine-phallotoxin was purchased from Molecular Probes (Eugene, OR). Three pair of gastric and 11 pair of colon cancer and their adjacent normal tissues were obtained from patients by surgical resection in the Nanfang Hospital (Guangzhou, China). Tissue specimens were snap-frozen in liquid N2 and stored at −70°C until use. Tissue slices were subjected to histopathologic review, and tumor specimens composed of at least 80% carcinoma cells were chosen for molecular analysis. To exclude the possibility that the adjacent “normal” tissues contain cancer cells or cells with dysplasia, we also collected colon tissues from 15 cancerous and 15 noncancerous patients under colonoscopy. All tissue specimens and slides were examined by an experienced pathologist. Serial sections were prepared for hematoxylin-eosin staining and immunohistochemical analysis of FHL2 expression. An immortalized esophageal squamous epithelial cell NE6–E6E7 was obtained from Professor S. W. Tsao, Department of Anatomy, University of Hong Kong, and grown in a defined keratinocyte serum-free medium (Gibco, Rockville, MD, and Invitrogen, Carlsbad, CA).16Deng W. Tsao S.W. Guan X.Y. Lucas J.N. Si H.X. Leung C.S. Mak P. Wang L.D. Cheung A.L. Distinct profiles of critically short telomeres are a key determinant of different chromosome aberrations in immortalized human cells: whole-genome evidence from multiple cell lines.Oncogene. 2004; 23: 9090-9101Crossref PubMed Scopus (56) Google Scholar An immortalized normal gastric epithelial cell line GES-1 was obtained from Cancer Research Institute of Beijing, China.17Guo C. Ding J. Yao L. Sun L. Lin T. Song Y. Sun L. Fan D. Tumor suppressor gene Runx3 sensitizes gastric cancer cells to chemotherapeutic drugs by downregulating Bcl-2, MDR-1 and MRP-1.Int J Cancer. 2005; 116: 155-160Crossref PubMed Scopus (64) Google Scholar Esophageal squamous cancer cell line, ECA 109, gastric cancer cell lines AGS, Kato-III, and colon cancer cell lines DLD1, SW480, HCT15, SW1116, HT-29, Lovo, and Colo205 were obtained from American Type Culture Collection (ATCC, Rockville, MD). Gastric cancer cell line MKN45 and BCG 823 were maintained by our laboratory as previously described.18Tu S.P. Jiang X.H. Lin M.C. Cui J.T. Yang Y. Lum C.T. Zou B. Zhu Y.B. Jiang S.H. Wong W.M. Chan A.O. Yuen M.F. Lam S.K. Kung H.F. Wong B.C. Suppression of survivin expression inhibits in vivo tumorigenicity and angiogenesis in gastric cancer.Cancer Res. 2003; 63: 7724-7732PubMed Google Scholar Cells were maintained in RPMI1640 (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% fetal bovine serum (FBS), 100 μg/mL streptomycin, and 100 μ/mL penicillin in a humidified incubator at 37°C with an atmosphere of 5% CO2. For visualization of FHL2 expression, antigen retrieval and an indirect immunoperoxidase technique were applied as described. The anti-FHL2 monoclonal antibody (11–134, MBL International Incorporation, Woburn, Japan; dilution 1:50) and the biotin-linked antimouse IgG (Dako, Copenhagen, Denmark) in combination with the ABC complex (Vectastain, Vector) were used. Normal mouse IgG (Sigma) was used as an isotype control for anti-FHL2 antibody to verify specificity of the staining. FHL2 full-length cDNA was isolated from an ovary cDNA library (Clontech, Palo Alto, CA). The cDNA fragment encoding the full-length human FHL2 was cloned in frame in the pCMV-tag epitope tagging mammalian expression vector pCMV-tag 3b (Stratagene, Tokyo, Japan). The primer sequences were as follows: forward, 5′-ATGACTGAGCGCTTTGACTG-3′, reverse, 5′-TCAGATGTCTTTCCCACAGT-3′. An EcoRI site was added into the 5′ terminus of the forward primers, and a SalI site was added into the reverse primer. Full-length FHL2 cDNA was isolated by EcoRI and SalI digestion from pCMV-tag3b-FHL2, and subcloned into the corresponding sites of pcDNA3.1(+) and pcDNA3.1(−), respectively, to generate pcDNA3.1(+)–FHL2-sense (pcDNA3.1–FHL2) and pcDNA3.1(−)–FHL2-antisense (pcDNA3.1–FHL2-AS). Transient transfection was carried out with LipofectAMINE2000 as reported previously.18Tu S.P. Jiang X.H. Lin M.C. Cui J.T. Yang Y. Lum C.T. Zou B. Zhu Y.B. Jiang S.H. Wong W.M. Chan A.O. Yuen M.F. Lam S.K. Kung H.F. Wong B.C. Suppression of survivin expression inhibits in vivo tumorigenicity and angiogenesis in gastric cancer.Cancer Res. 2003; 63: 7724-7732PubMed Google Scholar Whole-cell lysates were prepared 48 hours later for evaluation of the protein expression. To establish stable transfectants, Lovo cells transfected with empty pcDNA3.1 vector and pcDNA3.1–FHL2-AS were passaged at 1:15 (vol/vol) and cultured in RPMI 1640 medium supplemented with Geneticin (G418) at 1000 μg/mL for 4 weeks. Stably transfected clones were selected by immunoblotting for FHL2 expression, and maintained in the medium containing 600 μg/mL G418 for additional studies. AGS cells transfected with pcDNA3.1 vector and pcDNA3.1-FHL2-AS, cultured in the medium with Geneticin but without clone selection, were also generated and defined as pooled AGS/vector and AGS/FHL2-AS. Similarly, stable transfectants of pooled DLD/vector and DLD/FHL2 were also generated by transfecting DLD1 cells with pcDNA3.1 vector and pcDNA3.1–FHL2 followed by G418 selection. The whole-cell lysates were prepared with lysis buffer (20 mmol/L Tris-HCl, 1 mmol/L EDTA, 1 mmol/L ethyle glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetracetic acid, 1 mmol/L sodium vanadate, 0.2 mmol/L phenylmethylsulfonyl fluoride, 0.5% NP-40, 1 μg/mL leupeptin, 1 μg/mL aprotinin, and 1 μg/mL pepstatin A). The protein concentration was determined by the bicinchoninic acid assay (BCA protein assay kit, Pierce, Rockford, IL). Equal aliquots of total cell lysates (20 μg) were solubilized in sample buffer and electrophoresed on denaturing sodium dodecyl sulfate-PAGE gel (5% stacking gel and 12% separating gel). The proteins were then transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). The blots were probed with primary mouse antihuman FHL2 antibody (11–134, MBL International Incorporation) followed by the HRP-conjugated antigoat secondary antibody. Goat antihuman actin antibody (I-19, Santa-Cruz, CA) was used as internal control. Antigen–antibody complexes were visualized by the enhanced chemiluminescence system (Amersham Biosciences, Little Chalfont Buckinghamshire, England). Cells were harvested, and total RNA was extracted using TRIzol Reagent (Gibco BRL and Life Technologies). RNA was reversely transcribed to cDNA by Thermoscript RT system reagent (Gibco BRL) in accordance with the manufacturer’s instructions. Polymerase chain reaction (PCR) was performed using 2 μL of resulting cDNA, 0.3 unit Hotstart DNA polymerase. The sequence of the primers was as follows: CEA forward: 5′-AACCCTTCATCACCAGCAAC-3′; carcinoembryonic antigen (CEA) reverse: 5′-CAGGAGAGGCTGAGGTTCAC-3′; E-cadherin forward: 5′-CGACCCAACCCAAGAATCTA-3′, E-cadherin reverse: 5′- GCTGGCTCAAGTCAAAGTCC-3′, survivin forward: 5′- GGACCACCGCATCTCTACAT-3′, survivin reverse: 5′- GACAGAAAGGAAAGCGCAAC-3′, cyclooxygenase 2 (COX-2) forward: 5′- TTCAAATGAGATTGTGGGAAAATTGCT-3′, COX-2 reverse: 5′-AGATCATCTCTCCTGAGTATCTT-3′, c-jun forward: 5′- GGAGTGTCCAGAGAGCCTTG-3′, c-jun reverse: 5′- GAAAGGCTTGCAAAAGTTCG-3′, telomerase reverse transcriptase subunit (hTERT) forward, 5′-CGGAAGAGTGTCTGGAGCAA-3′, hTERT reverse: 5′-GGATGAAGCGGAGTCTGGA-3′ GAPDH forward: 5′-GACCACAGTCCATGCCATCAC-3′, GAPDH reverse: 5′-CCACCACCCTGTTGCTGTA-3′. Hotstart PCR was performed for 32 cycles with 95°C denaturation for 30 minutes (first cycle), 94°C denaturation for 45 seconds, 55°C annealing for 45 seconds, and 72°C elongation for 45 seconds and 10 minutes (final cycle). The expected size of PCR products were 340, 386, 223, 305, 204, 145, and 449 bp, respectively for CEA, E-cadherin, survivin, COX-2, c-jun, hTERT, and GAPDH. AP-1 promoter–luciferase reporter pGL3 construct was purchased from Promega (Madison, WI),19Wong B.C. Jiang X.H. Lin M.C. Tu S.P. Cui J.T. Jiang S.H. Wong W.M. Yuen M.F. Lam S.K. Kung H.F. Cyclooxygenase-2 inhibitor (SC-236) suppresses activator protein-1 through c-Jun NH2-terminal kinase.Gastroenterology. 2004; 126: 136-147Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar which contains −73 to +67 collagenase promoter region with 1 AP-1 binding site; 330 bp and 1365 bp 5′-flanking regions containing the core promoter of human telomerase reverse transcriptase (hTERT) were inserted into the pGL3 luciferase reporter vector. The shared proximal (reverse) primer (217 to 236 nt, TCCTTCAGGCAGGACACCTG) was used. The distal primer sequences were CCCGGGTCCGCCCGGAGCAGCTGC (−306 nt to −330 nt) and TACAAGACGAGGCTAACCTC (−1346 nt to −1365 nt). The upstream nucleotide adjacent to the translation starting ATG codon was here defined as −1. Promoter segments were obtained by PCR amplification. After digestion of both the pGL3basic vector (Promega) and the PCR products with KpnI and BglII, the purified products were inserted in the forward orientation upstream of a luciferase reporter gene of pGL3 basic vector to generate pLuc-330 and pLuc-1365 constructs. For the luciferase assay, the cells were transiently transfected with various luciferase reporter constructs by Lipofectamine 2000 as previously described.19Wong B.C. Jiang X.H. Lin M.C. Tu S.P. Cui J.T. Jiang S.H. Wong W.M. Yuen M.F. Lam S.K. Kung H.F. Cyclooxygenase-2 inhibitor (SC-236) suppresses activator protein-1 through c-Jun NH2-terminal kinase.Gastroenterology. 2004; 126: 136-147Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar PRL-CMV (Promega) was used to normalize the reporter gene activity. Forty-eight hours after transfection, cells were solubilized in 1× passive lysis buffer (Promega) and scraped with a rubber policeman. Soluble protein lysates were assayed for firefly and renilla luciferase activities using the Dual-Luciferase reporter assay system (Promega) with a model TD-20/20 Luminometer (EG&G Berthold, Australia). Firefly luciferase activity value was normalized to renilla activity value. Promoter activity was presented as the fold induction of relative luciferase unit (RLU) compared with the basic vector control (RLU is the value of firefly luciferase unit/value of renilla luciferase unit). Cell growth was measured by 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay as previously described.18Tu S.P. Jiang X.H. Lin M.C. Cui J.T. Yang Y. Lum C.T. Zou B. Zhu Y.B. Jiang S.H. Wong W.M. Chan A.O. Yuen M.F. Lam S.K. Kung H.F. Wong B.C. Suppression of survivin expression inhibits in vivo tumorigenicity and angiogenesis in gastric cancer.Cancer Res. 2003; 63: 7724-7732PubMed Google Scholar The ratio of the absorbance of cells relative to that of the control cells was calculated and expressed as the index (%) of cell proliferation. Assay of anchorage-dependent cell growth was performed as previously described.20Jiang X.H. Tu S.P. Cui J.T. Lin M.C. Xia H.H. Wong W.M. Chan A.O. Yuen M.F. Jiang S.H. Lam S.K. Kung H.F. Soh J.W. Weinstein I.B. Wong B.C. Antisense targeting protein kinase C alpha and beta1 inhibits gastric carcinogenesis.Cancer Res. 2004; 64: 5787-5794Crossref PubMed Scopus (57) Google Scholar The number of cells per well was expressed as mean ± SD at the indicated number of days after plating. Assay for anchorage-independent cell growth was performed as previously described.18Tu S.P. Jiang X.H. Lin M.C. Cui J.T. Yang Y. Lum C.T. Zou B. Zhu Y.B. Jiang S.H. Wong W.M. Chan A.O. Yuen M.F. Lam S.K. Kung H.F. Wong B.C. Suppression of survivin expression inhibits in vivo tumorigenicity and angiogenesis in gastric cancer.Cancer Res. 2003; 63: 7724-7732PubMed Google Scholar Each treatment was triplicated, and the result was expressed as mean ± SD. The siRNA duplexes consisted of 21 base pairs with a 2-base deoxynucleotide overhang (Proligo, Singapore). The sequences of the FHL2 siRNA were as follows (sense strand): siRNA 1, CGAAUCUCUCUUUGGCAAGdTdT, siRNA 2, UCUCUCUUUGGCAAGAAGUdTdT, siRNA 3, GGACUUGUCUUACAAGGACdTdT. The control siRNA, GL2 (CGUACGCGGAAUACUUCGA) was directed against the luciferase gene. The cells were transfected with siRNA duplexes using Oligofectamine (Invitrogen) according to the manufacturer’s instructions. For staining of F-actin, cells were fixed with 3.7% formaldehyde, incubated with rhodamine-conjugated phallotoxin (5 U/mL, Molecular Probes) in PBS at room temperature. Coverslips were washed, mounted, and visualized using Zeiss Axioscop fluorescence microscope. For staining of α-tubulin, cells were fixed and permeabilized in ice-cold methanol for 20 min. Antibodies to α-tubulin (clone DM1A, 1:100 dilution) and fluorescein isothiocyanate-conjugated goat antimouse antibodies were purchased from Sigma. Nuclei were stained with 1 μg/mL Hoechst 22358, and cells were analyzed using fluorescence microscope. Single cell suspensions of stable Lovo/vector transfectant and pooled stable Lovo/FHL2-AS transfectant were trypsinized and collected. Cell viability was >95% as determined by trypan blue exclusive staining. Cells (5 × 106) in a 0.1-mL volume of RPMI were inoculated subcutaneously into the right flank of 5–6-week-old female BALB/c-nu/nu mice (Laboratory Animal Unit, The University of Hong Kong). Institution guidelines were followed in handing the animals. The mice were maintained under sterile conditions. Tumor formation was observed 6 weeks later. The volumes of tumor were calculated as follows: V = (4/3) R12Sanchez-Garcia I. Rabbitts T.H. LIM domain proteins in leukaemia and development.Semin Cancer Biol. 1993; 4: 349-358PubMed Google ScholarR2, where R1 is radius 1 and R2 is radius 2 and R1 < R2. All tumors formed were removed and dissociated. The Committee on the Use of Live Animals in Teaching and Research, University of Hong Kong, Hong Kong, approved the protocol. Results obtained from triplicate luciferase and cell growth experiments were expressed as mean ± SD. The results with different treatments were compared using a 2-tailed Student’s t test and considered significant if P value was <.05. We showed that most gastric and colon cancer cell lines expressed high levels of FHL2 (Figure 1A and B).FHL2 expression was nearly undetectable at both mRNA and protein levels in the immortalized normal gastric epithelial cell line GES-1. We also measured FHL2 expression in an immortalized but normal esophageal squamous cell line, NE6–E6E7, and showed that this cell line expressed a lower level of FHL2 than esophageal squamous cancer cell line, ECA109. We then measured FHL2 expression in 14 pairs of matched gastric (G) and colon (C) normal (N) and cancerous (T) tissues by immunoblotting. Of the 14 cancerous tissues, 13 expressed higher levels of FHL2 than normal tissues (Figure 1C). Although Chan et al12Chan K.K. Tsui S.K. Lee S.M. Luk S.C. Liew C.C. Fung K.P. Waye M.M. Lee C.Y. Molecular cloning and characterization of FHL2, a novel LIM domain protein preferentially expressed in human heart.Gene. 1998; 210: 345-350Crossref PubMed Scopus (124) Google Scholar reported that FHL2 mRNA is undetectable in both normal gastric and intestinal tissues, we found that some “adjacent normal tissues” expressed detectable level of FHL2 protein. Some of them even expressed higher level of FHL2 than other cancer tissues. Because our matched “normal” tissues were obtained from the surgical resection tissues, they were only macroscopically tumor free. To exclude the possibility that these tissues contain some micrometastatic cancer cells or cells with dysplasia, we detected FHL2 expression in situ by immunohistochestry in tissue specimens collected from colon with noncancerous or cancerous diseases under colonoscopy. We showed that specific nuclear FHL2 protein was only expressed in the carcinoma cells of all colon cancer samples as exemplified in Figure 2B and D. On the contrary, normal colon tissues did not express FHL2 protein. Figure 2C shows a representative picture of normal colon tissues. These findings demonstrated that FHL2 was overexpressed in gastrointestinal cancer cells. We established cell transfectant that stably expressed antisense FHL2. Colon cancer cell Lovo was transfected with pcDNA3.1 and pcDNA3.1–FHL2-AS. After G418 selection, 3 clones transfected with empty vector (Lovo/vector) and 10 clones transfected with pcDNA3.1–FHL2 AS (Lovo/FHL2-AS) were picked up, spread, and collected. FHL2 expression was examined by immunoblotting. Because we found no difference with regard to FHL2 expression between untransfected Lovo cells and Lovo/vector transfectants (data not shown), we used 1 Lovo/vector transfectant as the control for additional experiments. Pooled AGS/FHL2-AS was also generated. Six clones of Lovo/FHL2-AS expressed lower levels of FHL2 protein compared with Lovo/vector. However, only 2 of them survived after identification. As shown in Figure 3A, stable transfection of FHL2-AS suppressed FHL2 expression in both Lovo and AGS cells. To characterize FHL2-AS transfectants, we first examined the morphologic features of these cells. The parent cells or stable transfectants of vector displayed a round or flat morphology with a short cytoplasmic process (Figure 3B1 and B3). However, FHL2-AS transfectant exhibited lengthened or shuttle-shape morphology. Long or dendritic-like cytoplasmic processes were visible under phase-contrast microscope (Figure 3B2 and B4). These morphologic changes were also found in transient transfected Lovo and" @default.
• W2022775504 created "2016-06-24" @default.
• W2022775504 creator A5002034641 @default.
• W2022775504 creator A5002345698 @default.
• W2022775504 creator A5030367664 @default.
• W2022775504 creator A5031741004 @default.
• W2022775504 creator A5039054300 @default.
• W2022775504 creator A5039838468 @default.
• W2022775504 creator A5052819986 @default.
• W2022775504 creator A5053574481 @default.
• W2022775504 creator A5060582079 @default.
• W2022775504 creator A5060998330 @default.
• W2022775504 creator A5070450933 @default.
• W2022775504 creator A5073000247 @default.
• W2022775504 creator A5087213990 @default.
• W2022775504 creator A5090532858 @default.
• W2022775504 date "2007-03-01" @default.
• W2022775504 modified "2023-10-18" @default.
• W2022775504 title "Suppression of FHL2 Expression Induces Cell Differentiation and Inhibits Gastric and Colon Carcinogenesis" @default.
• W2022775504 cites W1966516812 @default.
• W2022775504 cites W1966611889 @default.
• W2022775504 cites W1972175557 @default.
• W2022775504 cites W1976316774 @default.
• W2022775504 cites W1976390050 @default.
• W2022775504 cites W1989479006 @default.
• W2022775504 cites W1990988819 @default.
• W2022775504 cites W1993597624 @default.
• W2022775504 cites W1995650456 @default.
• W2022775504 cites W1996312262 @default.
• W2022775504 cites W1998313660 @default.
• W2022775504 cites W2000794789 @default.
• W2022775504 cites W2006740248 @default.
• W2022775504 cites W2013981220 @default.
• W2022775504 cites W2016533251 @default.
• W2022775504 cites W2021317939 @default.
• W2022775504 cites W2024227785 @default.
• W2022775504 cites W2029009269 @default.
• W2022775504 cites W2040980668 @default.
• W2022775504 cites W2043579526 @default.
• W2022775504 cites W2044770199 @default.
• W2022775504 cites W2048878637 @default.
• W2022775504 cites W2051153598 @default.
• W2022775504 cites W2053338574 @default.
• W2022775504 cites W2053475427 @default.
• W2022775504 cites W2053957347 @default.
• W2022775504 cites W2059260058 @default.
• W2022775504 cites W2061860615 @default.
• W2022775504 cites W2087938232 @default.
• W2022775504 cites W2103045139 @default.
• W2022775504 cites W2105031386 @default.
• W2022775504 cites W2117241378 @default.
• W2022775504 cites W2125553911 @default.
• W2022775504 cites W2140374331 @default.
• W2022775504 cites W2143331586 @default.
• W2022775504 cites W2145398150 @default.
• W2022775504 cites W2149442384 @default.
• W2022775504 cites W2155486297 @default.
• W2022775504 cites W2160738204 @default.
• W2022775504 cites W2160991496 @default.
• W2022775504 doi "https://doi.org/10.1053/j.gastro.2006.12.004" @default.
• W2022775504 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17383428" @default.
• W2022775504 hasPublicationYear "2007" @default.
• W2022775504 type Work @default.
• W2022775504 sameAs 2022775504 @default.
• W2022775504 citedByCount "72" @default.
• W2022775504 countsByYear W20227755042012 @default.
• W2022775504 countsByYear W20227755042013 @default.
• W2022775504 countsByYear W20227755042014 @default.
• W2022775504 countsByYear W20227755042015 @default.
• W2022775504 countsByYear W20227755042016 @default.
• W2022775504 countsByYear W20227755042017 @default.
• W2022775504 countsByYear W20227755042018 @default.
• W2022775504 countsByYear W20227755042019 @default.
• W2022775504 countsByYear W20227755042020 @default.
• W2022775504 countsByYear W20227755042021 @default.
• W2022775504 countsByYear W20227755042022 @default.
• W2022775504 countsByYear W20227755042023 @default.
• W2022775504 crossrefType "journal-article" @default.
• W2022775504 hasAuthorship W2022775504A5002034641 @default.
• W2022775504 hasAuthorship W2022775504A5002345698 @default.
• W2022775504 hasAuthorship W2022775504A5030367664 @default.
• W2022775504 hasAuthorship W2022775504A5031741004 @default.
• W2022775504 hasAuthorship W2022775504A5039054300 @default.
• W2022775504 hasAuthorship W2022775504A5039838468 @default.
• W2022775504 hasAuthorship W2022775504A5052819986 @default.
• W2022775504 hasAuthorship W2022775504A5053574481 @default.
• W2022775504 hasAuthorship W2022775504A5060582079 @default.
• W2022775504 hasAuthorship W2022775504A5060998330 @default.
• W2022775504 hasAuthorship W2022775504A5070450933 @default.
• W2022775504 hasAuthorship W2022775504A5073000247 @default.
• W2022775504 hasAuthorship W2022775504A5087213990 @default.
• W2022775504 hasAuthorship W2022775504A5090532858 @default.
• W2022775504 hasBestOaLocation W20227755041 @default.
• W2022775504 hasConcept C104317684 @default.
• W2022775504 hasConcept C121608353 @default.
• W2022775504 hasConcept C126322002 @default.
• W2022775504 hasConcept C185592680 @default.
• W2022775504 hasConcept C3018663739 @default.

• next