FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022795217> ?p ?o ?g. }

• W2022795217 endingPage "35711" @default.
• W2022795217 startingPage "35703" @default.
• W2022795217 abstract "The crystal structure of Cel44A, which is one of the enzymatic components of the cellulosome of Clostridium thermocellum, was solved at a resolution of 0.96Å. This enzyme belongs to glycoside hydrolase family (GH family) 44. The structure reveals that Cel44A consists of a TIM-like barrel domain and a β-sandwich domain. The wild-type and the E186Q mutant structures complexed with substrates suggest that two glutamic acid residues, Glu186 and Glu359, are the active residues of the enzyme. Biochemical experiments were performed to confirm this idea. The structural features indicate that GH family 44 belongs to clan GH-A and that the reaction catalyzed by Cel44A is retaining type hydrolysis. The stereochemical course of hydrolysis was confirmed by a 1H NMR experiment using the reduced cellooligosaccharide as a substrate. The crystal structure of Cel44A, which is one of the enzymatic components of the cellulosome of Clostridium thermocellum, was solved at a resolution of 0.96Å. This enzyme belongs to glycoside hydrolase family (GH family) 44. The structure reveals that Cel44A consists of a TIM-like barrel domain and a β-sandwich domain. The wild-type and the E186Q mutant structures complexed with substrates suggest that two glutamic acid residues, Glu186 and Glu359, are the active residues of the enzyme. Biochemical experiments were performed to confirm this idea. The structural features indicate that GH family 44 belongs to clan GH-A and that the reaction catalyzed by Cel44A is retaining type hydrolysis. The stereochemical course of hydrolysis was confirmed by a 1H NMR experiment using the reduced cellooligosaccharide as a substrate. Cellulose is the major component of the earth's biomass. Some microorganisms, that can use cellulose as a carbon source produce various cellulases and can efficiently degrade cellulose. Most herbivorous animals and many insects have these types of microorganisms in their digestive systems. Some organisms that have cellulolytic ability were confirmed to produce a huge protein complex called cellulosome, which can efficiently degrade crystalline cellulose (1Béguin P. Aubert J.P. FEMS Microbiol. Rev. 1994; 13: 25-58Crossref PubMed Google Scholar). In the cellulosome, a noncatalytic protein termed the scaffolding protein is associated with several enzymatic proteins by cohesin-dockerin interaction. The scaffolding protein contains modules called cohesin, and each enzymatic protein has a module named dockerin. In the scaffolding protein and the enzymatic proteins, modules are connected to each other by a flexible linker as observed by electron microscopy (2Bayer E.A. Lamed R. J. Bacteriol. 1986; 167: 828-836Crossref PubMed Google Scholar, 3Madkour M. Mayer F. Cell Biol. Int. 2003; 27: 831-836Crossref PubMed Scopus (21) Google Scholar) and small angle x-ray scattering (4Hammel M. Fierobe H.P. Czjzek M. Finet S. Receveur-Brechot V. J. Biol. Chem. 2004; 279: 55985-55994Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, 5Hammel M. Fierobe H.P. Czjzek M. Kurkal V. Smith J.C. Bayer E.A. Finet S. Receveur-Brechot V. J. Biol. Chem. 2005; 280: 38562-38568Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar). The enzymatic proteins include cellulose binding modules (CBMs) 2The abbreviations used are: CBM, cellulose binding module; CMC, carboxymethylcellulose; GH, growth hormone; MES, 4-morpholineethanesulfonic acid; PEG, polyethylene glycol. 2The abbreviations used are: CBM, cellulose binding module; CMC, carboxymethylcellulose; GH, growth hormone; MES, 4-morpholineethanesulfonic acid; PEG, polyethylene glycol. and various cellulases, such as endoglucanases, xylanases, mannanases, cellobiohydrolases, glucosidases, etc. This variety makes it possible to degrade crystalline cellulose into oligo-, di-, and monosaccharides. CelJ is one of the major enzymatic components of the cellulosome of Clostridium thermocellum strain F1, and its gene was cloned previously (6Ahsan M.M. Kimura T. Karita S. Sakka K. Ohmiya K. J. Bacteriol. 1996; 178: 5732-5740Crossref PubMed Google Scholar). It is a multidomain endoglucanase and consists of five modules and a signal peptide. The five components are a cellulose binding module that belongs to CBM family 30, a GH family 9 cellulase described as Cel9D, a GH family 44 cellulase described as Cel44A, a dockerin domain, and a CBM domain (CBM44) (7Arai T. Araki R. Tanaka A. Karita S. Kimura T. Sakka K. Ohmiya K. J. Bacteriol. 2003; 185: 504-512Crossref PubMed Scopus (61) Google Scholar, 8Najmudin S. Guerreiro C.I. Carvalho A.L. Prates J.A. Correia M.A. Alves V.D. Ferreira L.M. Romao M.J. Gilbert H.J. Bolam D.N. Fontes C.M. J. Biol. Chem. 2006; 281: 8815-8828Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). The Cel44A domain was cloned, and its cellulase activities were measured (9Ahsan M. Matsumoto M. Karita S. Kimura T. Sakka K. Ohmiya K. Biosci. Biotechnol. Biochem. 1997; 61: 427-431Crossref PubMed Scopus (23) Google Scholar). The recombinant Cel44A consists of 519 amino acid residues with a molecular mass of 58 kDa, and it can degrade cellooligosaccharide, xylan, lichenan, and various celluloses, such as acid-swollen cellulose, ball-milled cellulose, and carboxymethylcellulose (CMC). In addition, Najmudin et al. reported that Cel44A has xyloglucanase activity (8Najmudin S. Guerreiro C.I. Carvalho A.L. Prates J.A. Correia M.A. Alves V.D. Ferreira L.M. Romao M.J. Gilbert H.J. Bolam D.N. Fontes C.M. J. Biol. Chem. 2006; 281: 8815-8828Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). This broader substrate recognition indicates that Cel44A plays a central role in the early stages of cellulose degradation. The structural information of Cel44A was expected to explain this broad substrate recognition as well as the detailed reaction mechanisms of GH family 44 enzymes. Here we report the crystal structure of recombinant Cel44A and two mutant structures in complex with two kinds of substrates. Combined with biochemical experiments, these structures revealed the detailed reaction mechanisms of this enzyme. Protein Expression and Purification—The Cel44A gene was amplified by PCR using the primers listed in Table 1 and inserted into the vector pQE-30 (Qiagen). The cloned Cel44A vector was transformed into Escherichia coli JM109 by electroporation. E. coli cells were grown in LB medium at 37 °C with 100 μg/ml ampicillin to midexponential phase (A600 = 0.6) and for an additional 3 h after adding 1 mm isopropyl 1-thio-β-d-galactopyranoside to induce expression. Expressed protein was purified with HiTrap Chelating HP 5 ml (Amersham Biosciences), treated with thrombin (Sigma) to remove the His tag, and passed again through HiTrap Chelating HP 5 ml, and the flow-through fractions were collected. Finally, it was purified with HiLoad 26/60 Superdex 200 pg (Amersham Biosciences) and concentrated to A280 = 16.6 in 20 mm Tris-HCl buffer (pH 8.0). Vectors carrying the E186Q and E359Q mutants were cloned and amplified by PCR using the primers listed in Table 1 designed against wild-type Cel44A vector. The PCR products were treated with DpnI (New England BioLabs) to degrade template plasmids. The expression and purification procedures of these mutants were the same as described for the wild type.TABLE 1Primers used for cloning and mutagenesis of Cel44AConstructsPrimersSequencesWild typeForwardGTTAGATCTGAACCTGCAAAAGTGGTTGACReverseGTTGTCGACTAGGGCTCCGCAGCTTCAAGCACE186QForwardGTTATTCAATAGATAACCAGCCGGCReverseCCACAATGCCCGGCTGGTTATCTATTGE359QForwardCTTGCTATAACTCAATATGACTATGReverseGCCATAGTCATATTGAGTTATAGC Open table in a new tab Enzyme Assay—Cellulase activity of Cel44A mutants was measured by incubation of 5.7, 5.8, and 5.7 μg of protein at 60 °C in 50 mm sodium phosphate buffer (pH 6.5) in the presence of CMC (10 mg/ml; Sigma) with 300 μl of the reaction mixture. Released reducing sugars were determined with 3,5-dinitrosalicylic acid reagent (10Miller G.L. Anal. Chem. 1959; 31: 426-428Crossref Scopus (21978) Google Scholar), using glucose as the standard. After incubation, 900 μl of 3,5-dinitrosalicylic acid reagent was added and heated in a boiling bath for 5 min. The absorbance was measured at 570 nm. One unit of enzyme activity was defined as the amount of enzyme required to release 1 μmol of reducing sugar from CMC in 1 min. The enzymatic kinetics of Cel44A against cellohexaitol was determined by measuring the rate of release of reducing sugars also using 3,5-dinitrosalicylic acid reagent (10Miller G.L. Anal. Chem. 1959; 31: 426-428Crossref Scopus (21978) Google Scholar) with glucose as the standard. Cellohexaitol was prepared following the previous report (11Schou C. Rasmussen G. Kaltoft M.B. Henrissat B. Schulein M. Eur. J. Biochem. 1993; 217: 947-953Crossref PubMed Scopus (101) Google Scholar). 25 mg of cellohexaose was reduced with 5 mg of sodium borohydride in 1 ml of water at room temperature. After 2 h, the solution was neutralized with Amberlite IR-120H cation exchange resin H+ form (Sigma), and its supernatant was collected. Then the solution was freeze-dried. Assays were carried out at 60 °C in 10 mm potassium sodium phosphate buffer (pH 7.0). The reaction system included 1–6 mm cellohexaitol and 3.26 μg of protein in a 30-μl solution. The reaction velocities were calculated by estimating the release of reducing sugars against six substrate concentrations. Chronological Examinations of 1H NMR Measurements of the Reaction Product—Cel44A protein was purified without the thrombin treatment and was finally dissolved in 10 mm phosphate buffer (pH 7.4). Then the enzyme and substrate cellohexaitol were freeze-dried and were dissolved in D2O twice. Final concentration of the substrate cellohexaitol was 5 mg/ml in D2O with 10 mm phosphate buffer, pH 7.4. After adding ∼1.0 mg of Cel44A enzyme, the 1H NMR spectra were recorded using a Bruker DRX500 spectrometer at 22.5 °C at 5, 15, 25, 35, 45, 55, 65, 75, 85, 95, 125, 185, 365, and 665 min after the reaction started. The reference data were measured without enzyme. Crystallization and Data Collection—As a result of the screening using the Hampton Crystal screen, crystal screen 2, PEG/ion screen, grid screen PEG 6000, and grid screen PEG/LiCl, the initial Cel44A crystals were obtained under the conditions of the Hampton Crystal screen 2 kit 27: 0.1 m MES-NaOH, pH 6.5, 10 mm ZnSO4, 25% (w/v) PEG monomethyl ether 550. The screening experiments were performed by the sitting drop vapor diffusion method with a 100-μl reservoir and 1:1 μl protein/reservoir ratio at 293 K. The initial crystallization conditions were optimized to 0.1 m MES-NaOH, pH 5.8, 6 mm ZnSO4, 20% (w/v) PEG monomethyl ether 550 or 14% (w/v) PEG 3350 for wild-type Cel44A. In addition, the conditions for the E186Q mutant included 0.1 m MES-NaOH, pH 5.8, 10 mm ZnSO4, 16–20% (w/v) PEG monomethyl ether 550. In both cases, the hanging drop vapor diffusion method was used with a 1-ml reservoir and 2:2 μl protein/reservoir ratio at 293 K. Crystals grew to about 0.05 × 0.2 × 0.5 mm and were soaked in cryoprotectant containing 20% glycerol when the diffraction data were collected at 100 K. Some wild-type crystals grown in the presence of 14% (w/v) PEG 3350 grew to 0.1 × 0.4 × 0.7 mm. All crystals belonged to space group P212121, and unit-cell parameters are listed in Table 2. The asymmetric unit contained one Cel44A molecule with a Matthews' coefficient VM of 2.09 Å3 Da–1, which suggests that the estimated solvent content is ∼41.0%.TABLE 2Data collection and refinement statisticsWild typeMAD dataWild type with cellohexaoseWild type with cellopentaoseE186Q with cellohexaoseE186Q with cellohexaoseaWith higher concentration.E186Q with cellopentaosePeakRemoteData sets Wavelength (Å)1.00001.28240.98001.00001.00001.00001.00001.0000 Space groupP212121P212121P212121P212121P212121P212121P212121P212121 Unit cell parametersa (Å)48.148.048.047.947.947.950.147.9b (Å)59.259.159.159.159.159.159.359.1c (Å)170.7170.4170.5170.4170.5171.4168.7171.1 Resolution range (Å)50.0-0.96 (0.99-0.96)50.0-1.80 (1.86-1.80)50.0-1.80 (1.86-1.80)50.0-1.75 (1.81-1.75)50.0-1.60 (1.66-1.60)50.0-1.78 (1.84-1.78)50.0-2.80 (2.90-2.80)50.0-2.00 (2.07-2.00) No. of observed reflections1,549,330307,972287,608246,449210,928235,13184,986157,535 No. of unique reflections292,56245,46145,50049,77263,06347,67113,03932,781 Multiplicity5.3 (2.8)6.8 (6.3)6.3 (6.0)5.0 (3.6)3.4 (2.3)4.9 (4.5)6.5 (4.6)4.8 (3.5) Completeness (%)98.9 (91.7)98.8 (96.9)98.7 (97.2)99.7 (97.7)97.1 (85.9)99.8 (98.9)99.3 (94.9)96.9 (81.7) Rsym (%)12.7 (39.8)8.0 (28.0)5.6 (13.9)6.8 (21.6)9.7 (29.0)5.7 (18.5)11.2 (36.9)7.5 (15.9) I/σI22.1 (2.3)21.2 (6.0)23.1 (9.8)21.4 (5.4)13.4 (2.5)21.9 (7.6)16.1 (3.9)12.2 (4.2)Refinement statistics No. of nonhydrogen atoms412441974224421641284084 No. of water molecules57445447653153459 Rwork/Rfree (%)13.3/14.616.1/18.717.0/18.616.2/18.520.4/25.916.5/20.1 Root mean square deviation bond length (Å)0.0170.0080.0070.0050.0070.006 Root mean square deviation bond angle (degrees)1.81.51.51.31.41.3 Ramachandran plotIn most favored regions (%)89.290.289.589.584.289.0In disallowed regions (%)0.00.00.00.00.00.0a With higher concentration. Open table in a new tab The diffraction data sets were collected at Photon Factory (Tsukuba, Japan) BL-5A for wild-type Cel44A and E186Q mutants complexed with cellohexaose, SPring-8 (Hyogo, Japan) BL38B2 for wild-type complexed with cellopentaose, and SPring-8 BL41XU for E186Q mutant complexed with cellohexaose. The crystals were soaked in cryoprotectant containing 1 mm cellohexaose and cellopentaose (Seikagaku Kogyo, Tokyo) for 2 h to introduce substrates. In the case of a high concentration of cellohexaose, the crystals were soaked in cryoprotectant containing cellohexaose at 20% saturation. All data sets were processed using the HKL2000 software package (12Otwinowski Z. Minor W. Methods Enzymol. 1997; 276: 307-326Crossref PubMed Scopus (38445) Google Scholar), and the diffraction data statistics are shown in Table 2. Phasing, Model Building, and Refinement—The structure of Cel44A was solved by the multiwavelength anomalous dispersion method using the zinc ion as an anomalous scatterer for phase calculation. Zinc ions were included in the crystallization conditions and seemed to bind accidentally to the Cel44A molecule as described. The zinc ion was located using SHELXD (13Sheldrick, G. M., Hauptman, H. A., Weeks, C. M., Miller, R., and Usón, I. (2001) International Tables for Crystallography, Vol. F (Arnold, E., and Rossmann, M. G., eds) pp. 333–351, Kluwer Academic Publishers, DordrechtGoogle Scholar) after analyzing the substructure structure factors using SHELXC (14Sheldrick G.M. SHELXC. Göttingen University, Germany2003Google Scholar), and the initial phase calculation and phase improvement by density modification were performed by SHELXE (15Sheldrick G.M. Z. Kristallogr. 2002; 217: 644-650Crossref Scopus (360) Google Scholar). Initial model building was performed with ARP/wARP (16Perrakis A. Morris R. Lamzin V.S. Nat. Struct. Biol. 1999; 6: 458-463Crossref PubMed Scopus (2563) Google Scholar) using the phase calculated by SHELXE. As a result, 499 of the 519 cloned residues were traced automatically with their side chains. The initial model was extended manually with O (17Jones T.A. Zou J.Y. Cowan S.W. Kjeldgaard M. Acta Crystallogr. A. 1991; 47: 110-119Crossref PubMed Scopus (13006) Google Scholar), and restrained refinement was performed using REF-MAC5 (18Murshudov G.N. Vagin A.A. Dodson E.J. Acta Crystallogr. D Biol. Crystallogr. 1997; 53: 240-255Crossref PubMed Scopus (13815) Google Scholar, 19Murshudov G.N. Vagin A.A. Lebedev A. Wilson K.S. Dodson E.J. Acta Crystallogr. D Biol. Crystallogr. 1999; 55: 247-255Crossref PubMed Scopus (1007) Google Scholar) for highest resolution wild type and CNS (20Brünger A.T. Adams P.D. Clore G.M. DeLano W.L. Gros P. Grosse-Kunstleve R.W. Jiang J.S. Kuszewski J. Nilges M. Pannu N.S. Read R.J. Rice L.M. Simonson T. Warren G.L. Acta Crystallogr. D Biol. Crystallogr. 1998; 54: 905-921Crossref PubMed Scopus (16947) Google Scholar) for the others. The water picking procedures were performed by the combined use of CNS and LAFIRE (21Zhou Y. Yao M. Tanaka I. J. Appl. Crystallogr. 2006; 39: 57-63Crossref Scopus (12) Google Scholar, 22Yao M. Zhou Y. Tanaka I. Acta Crystallogr. D Biol. Crystallogr. 2006; 62: 189-196Crossref PubMed Scopus (74) Google Scholar). The refinement statistics are given in Table 2. Overall Structure—The structure of the wild-type Cel44A was refined to a resolution of 0.96 Å, and the final model is composed of 510 amino acid residues. Three residues at the N terminus and six residues at the C terminus were disordered and no clear electron densities were observed. Three glycerol molecules and two ions, described later, were also identified. The structure shows that Cel44A is composed of two large domains, a β-sandwich domain and a TIM-like barrel domain. The β-sandwich domain consists of residues 7–23 in N-terminal and 418–516 in C-terminal segments. The TIM-like barrel domain is formed by residues 24–417 in the middle part of the enzyme (Fig. 1). The β-sandwich domain consists of 10 strands (β1–β2 and β19–β26) in two twisted β-sheets. The topology of this domain could be easily classified into “the composite domain of GH family 5, 30, 39, 51” in the Structural Classification of Proteins data base (23Murzin A.G. Brenner S.E. Hubbard T. Chothia C. J. Mol. Biol. 1995; 247: 536-540Crossref PubMed Scopus (5575) Google Scholar). The TIM-like barrel domain has 19 α-helices and 16 β-strands (α1–α19 and β3–β18). The core part of the TIM-like barrel domain is the TIM barrel fold (α/β)8, except that the first α-helix of a typical (α/β)8 becomes a short loop in the Cel44A structure. There are two additional inserted regions in the TIM-like barrel domain. The two regions are present between the second β-strand (β4) and second α-helix (α5) of (α/β)8 (Ala45–Pro86) and between the third β-strand (β7) and third α-helix (α7) of (α/β)8 (Gln110–Tyr157), respectively (Fig. 1b). The inserted regions make a small domain that includes an imperfect antiparallel β-sheet of six strands and four small α-helices. In the small domain, there is one ion located in the loop on the edge of the imperfect β-sheet and tightly ligated by the side chains of Glu54 and Glu153, the main chain carbonyl oxygen of Asp50 and Tyr155, and two water molecules. From its ligand coordination, this ion seems to be a calcium ion. The zinc ion, which was used as the anomalous scatterer at the phasing step, is bound on the surface of the protein as a regular tetragonal coordination with the side chains of Asp35, Glu401, the main chain carbonyl oxygen atom of Ala395, and the side chain of Glu126 of the adjacent molecule. Three glycerol molecules used as a cryoprotectant were also found at the surface of the protein molecule, one of which was located at a pocket-like hollow as described below. There is a planar and relatively strong unassigned electron density at the center of the TIM-like barrel domain. The shape of the electron density looks like a pyranose ring, but it is not clear. Crystal Structures Complexed with Substrates Cellopentaose and Cellohexaose—Cellohexaose and cellopentaose, which were identified as substrates of Cel44A, were introduced into the wild-type crystals using the crystal soaking technique, and these complex structures were solved at 1.75 and 1.6 Å resolution, respectively. In both cases, the electron density maps showed cellotetraose binding (Fig. 2a). Cellotetraose seems to be one of the reaction products. The locations of four pyranose rings of the molecule clearly show the presence of the four subsites –1 to –4 for recognition of pyranose rings at the nonreducing end. These subsites exist at one of the clefts on the surface of the Cel44A molecule, and some hydrogen bonds between Cel44A protein and substrate are expected, as shown in Fig. 2b. The pyranoses located at –1, –3, and –4 subsites interact with Trp392, Tyr71, and Trp64, respectively. Trp64 and Tyr71 face each other diagonally over the substrate at subsite –3, and Asn46 at subsite –1 is located at the opposite side of the substrate with Trp392. Two residues, Glu186 and Glu359, are located at the reducing end of cellotetraose, and these positions strongly suggest that these two are the catalytic residues. The orientation of 1′-OH of the pyranose at subsite –1 is unusual. It is almost perpendicular to the sugar plane, and this pyranose ring seems to be distorted from the relaxed chair form to the boat form (Fig. 2c). Enzyme Assay of E186Q and E359Q Mutants—In order to confirm the catalytic residues suggested by the structures, E186Q and E359Q mutants were cloned and purified, and enzyme assays for these mutants were performed with the wild type as a reference. The specific activity of purified wild-type Cel44A enzyme was 40 units/mg, and no cellulase activity was detected with both mutants (Fig. 3); these two residues were therefore confirmed to be catalytic residues. E186Q Mutant Structure Complexed with Cellopentaose and Cellohexaose—The crystal structures of E186Q mutant complexed with cellopentaose and cellohexaose were solved at 2.0 and 1.8 Å resolution, respectively. In the case of cellopentaose complex, four pyranose rings of the substrate were clearly observed at subsites –1 to –4 in the electron density map (Fig. 4a). Although the electron density of the nonreducing end pyranose ring is poorer than those of the other four, its existence could be clearly recognized. This nonreducing end pyranose ring sticks out into the solvent region from the surface of the Cel44A molecule, and there were no specific residues for substrate recognition. In this structure, the pyranose ring located at the –1 subsite is in the relaxed chair form, and one water molecule sits at the β-side of the ring. Unlike the wild type, the 1′-OH of the reducing terminal was clearly observed as a normal β-side conformation. In the case of cellohexaose, cellohexaose itself was also observed in the electron density map as with cellopentaose. Four pyranose rings from the reducing end were located at subsites –1 to –4, and other two pyranose rings from the nonreducing end are also observed in the solvent region (Fig. 4b). Interestingly, soaking with a higher concentration of cellohexaose gave different results. In this case, the structure was solved at 2.8 Å resolution, and eight pyranose rings were identified in the obtained electron density map (Fig. 5). The sugar chain stretches over the putative catalytic point, and there were five pyranose rings at the plus side and three at the minus subsites. The appearance of cellooctaose seems to be caused by the superposition of the several cellohexaose binding states. Previously, Sakon et al. (24Sakon J. Adney W.S. Himmel M.E. Thomas S.R. Karplus P.A. Biochemistry. 1996; 35: 10648-10660Crossref PubMed Scopus (225) Google Scholar) identified cellotetraose in the crystal structure despite using cellobiose, and they concluded that it was the result of reverse reaction. In our case, however, the reverse reaction is impossible, because one of the catalytic residues was mutated, and the inactivity of the mutant was confirmed by biochemical assay as described above. The pyranose rings located at the +3, +4, and +5 subsites interact with Trp327 and Trp331. These two residues are located at one side of the substrate, and Trp327 is located between subsites +3 and +4. The direction of the pyranose ring located at the +1 subsite is almost perpendicular to the pyranose ring plane located at the –1 subsite. In order to connect the pyranose rings at –1 and +1 subsites, the pyranose ring located at the –1 subsite cannot be in the relaxed chair form. The cellooctaose model, in which the pyranose ring of the –1 subsite is the boat form, is fit well into the observed electron density map, as shown in Fig. 5. Determination of the Stereochemical Course of Hydrolysis—To confirm the retention mechanism of hydrolysis, the chronological examinations of 1H NMR measurements of the reaction product was performed for Cel44A. To avoid the overlap of peaks for the reactant and the products, the reduced cellohexaose, cellohexaitol, was used as a substrate. The enzymatic kinetics against cellohexaitol was calculated as km = 4.43 s–1, Kcat = 2362.9 μm from the reaction velocity measurements. Changes of the spectra for the anomeric region during the reaction at 22.5 °C are shown in Fig. 6. The spectra show that the superiority of the amount of β-anomer clearly exists at the early stage of the reaction before the two anomers come to equilibrium. Structure Comparison—Glycoside hydrolase simply hydrolyzes the glycosidic bond, and the GH family includes many enzymes because of the diversity of carbohydrates. Sequence-based classification can be correlated with the structural information, and such analysis has provided useful information for the substrate recognition and the enzymatic reaction mechanisms (25Henrissat B. Davies G. Curr. Opin. Struct. Biol. 1997; 7: 637-644Crossref PubMed Scopus (1400) Google Scholar). The combination of structural and amino acid sequence-based information regarding the glycoside hydrolases and other carbohydrate-related proteins, such as glycosyl transferases, polysaccharide lyases, carbohydrate esterases, and CBMs is summarized in the carbohydrate-active enzymes (CAZy) data base (26Coutinho, P. M., and Henrissat, B. (1999) in Recent Advances in Carbohydrate Bioengineering (Gilbert, H. H., Davies, G., Henrissat, B., and Svensson, B., eds) pp. 3–12, The Royal Society of Chemistry, Cambridge, UKGoogle Scholar), in which glycoside hydrolases fall into 110 families (GH family) based on their amino acid sequences. Half of the GH families fall into 14 superfamilies termed clans based on their structural similarities, and several features such as reaction mechanisms can be estimated by the classifications. The clan GH-A is the biggest clan superfamily and includes 17 kinds of GH families. GH-A is defined by three features: (i) (α/β)8 TIM barrel fold; (ii) the positions of two catalytic residues, which are located at the ends of the fourth and seventh β strands of the TIM barrel (27Jenkins J. Lo Leggio L. Harris G. Pickersgill R. FEBS Lett. 1995; 362: 281-285Crossref PubMed Scopus (237) Google Scholar), and (iii) the hydrolysis catalytic mechanism of retention. The clan GH-A is also termed as the 4/7 superfamily because of the positions of catalytic residues. The distance between these two residues is ∼5Å. Cel44A can be classified into clan GH-A because it has all three features described above. The distance between two catalytic residues (Glu186 and Glu359) is ∼5.3 Å, and as described below, the retention reaction mechanism of Cel44A was confirmed by 1H NMR. Furthermore, the seven counterparts of eight key residues, which include the catalytic residues and have been identified to be functionally conserved in clan GH-A (24Sakon J. Adney W.S. Himmel M.E. Thomas S.R. Karplus P.A. Biochemistry. 1996; 35: 10648-10660Crossref PubMed Scopus (225) Google Scholar, 28Ryttersgaard C. Lo Leggio L. Coutinho P.M. Henrissat B. Larsen S. Biochemistry. 2002; 41: 15135-15143Crossref PubMed Scopus (34) Google Scholar, 29Durand P. Lehn P. Callebaut I. Fabrega S. Henrissat B. Mornon J.P. Glycobiology. 1997; 7: 277-284Crossref PubMed Scopus (58) Google Scholar), are also observed in Cel44A: Arg42, Asn185, Glu186, His283, Tyr285, Glu359, and Trp392. A catalytic triad composed of serine-histidine-glutamate seems also to be common to clan GH-A. The catalytic triad plays a role in lowering the pKa of the acid/base residue and is critical for enzymatic activity (30Shaw A. Bott R. Vonrhein C. Bricogne G. Power S. Day A.G. J. Mol. Biol. 2002; 320: 303-309Crossref PubMed Scopus (29) Google Scholar). Cel44A has the counterpart triad, Thr358-His283-Glu186. Cel44A has a β-sandwich domain termed “the composite domain of GH family 5, 30, 39, 51.” All of these four GH families belong to clan GH-A. In these four families, there are 62 crystal structures in CAZy, and six structures shown in Table 3 have both the TIM barrel and the composite domain of GH family 5, 30, 39, 51 (31Czjzek M. Ben David A. Bravman T. Shoham G. Henrissat B. Shoham Y. J. Mol. Biol. 2005; 353: 838-846Crossref PubMed Scopus (59) Google Scholar, 32Dvir H. Harel M. McCarthy A.A. Toker L. Silman I. Futerman A.H. Sussman J.L. EMBO Rep. 2003; 4: 704-709Crossref PubMed Scopus (218) Google Scholar, 33Hovel K. Shallom D. Niefind K. Belakhov V. Shoham G. Baasov T. Shoham Y. Schomburg D. EMBO J. 2003; 22: 4922-4932Crossref PubMed Scopus (119) Google Scholar, 34Larson S.B. Day J. Barba de la Rosa A.P. Keen N.T. McPherson A. Biochemistry. 2003; 42: 8411-8422Crossref PubMed Scopus (63) Google Scholar, 35Yang J.K. Yoon H.J. Ahn H.J. Lee B.I. Pedelacq J.D. Liong E.C. Berendzen J. Laivenieks M. Vieille C. Zeikus G.J. Vocadlo D.J. Withers S.G. Suh S.W. J. Mol. Biol. 2004; 335: 155-165Crossref PubMed Scopus (63) Google Scholar). Despite the low level of amino acid identity of 11–16%, Cel44A has several features in common with these six structures. (i) The core topologies of both the TIM barrel and the β-sandwich correspond well, although there are some differences in the small insertion domains and the detailed structures. (ii) The β-sandwich domain is composed of nine strands from the C terminus and one strand from the N-terminal region. The only exception is GH 30 human acid-β-glucosidase, in which an additional two strands are from the N-terminal region. (iii) The spatial relationships between the TIM barrel domain and β-sandwich domain are quite similar. (iv) The spatial positions of the catalytic residues correspond" @default.
• W2022795217 created "2016-06-24" @default.
• W2022795217 creator A5011170655 @default.
• W2022795217 creator A5012188323 @default.
• W2022795217 creator A5019216535 @default.
• W2022795217 creator A5020556619 @default.
• W2022795217 creator A5031106340 @default.
• W2022795217 creator A5084464179 @default.
• W2022795217 creator A5088528790 @default.
• W2022795217 date "2007-12-01" @default.
• W2022795217 modified "2023-10-17" @default.
• W2022795217 title "Crystal Structure of Cel44A, a Glycoside Hydrolase Family 44 Endoglucanase from Clostridium thermocellum" @default.
• W2022795217 cites W1520730837 @default.
• W2022795217 cites W1539796472 @default.
• W2022795217 cites W1794120381 @default.
• W2022795217 cites W1978230195 @default.
• W2022795217 cites W1995017064 @default.
• W2022795217 cites W1999590520 @default.
• W2022795217 cites W2000476654 @default.
• W2022795217 cites W2007116590 @default.
• W2022795217 cites W2009674410 @default.
• W2022795217 cites W2013083986 @default.
• W2022795217 cites W2021894332 @default.
• W2022795217 cites W2032076607 @default.
• W2022795217 cites W2033506791 @default.
• W2022795217 cites W2038840577 @default.
• W2022795217 cites W2056474830 @default.
• W2022795217 cites W2061159795 @default.
• W2022795217 cites W2062368258 @default.
• W2022795217 cites W2070389683 @default.
• W2022795217 cites W2071196347 @default.
• W2022795217 cites W2071238919 @default.
• W2022795217 cites W2082454780 @default.
• W2022795217 cites W2092471412 @default.
• W2022795217 cites W2106116822 @default.
• W2022795217 cites W2119318011 @default.
• W2022795217 cites W2120693220 @default.
• W2022795217 cites W2123276411 @default.
• W2022795217 cites W2134465386 @default.
• W2022795217 cites W2142115754 @default.
• W2022795217 cites W2147665045 @default.
• W2022795217 cites W2150053831 @default.
• W2022795217 cites W2158945235 @default.
• W2022795217 doi "https://doi.org/10.1074/jbc.m706835200" @default.
• W2022795217 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17905739" @default.
• W2022795217 hasPublicationYear "2007" @default.
• W2022795217 type Work @default.
• W2022795217 sameAs 2022795217 @default.
• W2022795217 citedByCount "43" @default.
• W2022795217 countsByYear W20227952172012 @default.
• W2022795217 countsByYear W20227952172013 @default.
• W2022795217 countsByYear W20227952172014 @default.
• W2022795217 countsByYear W20227952172015 @default.
• W2022795217 countsByYear W20227952172016 @default.
• W2022795217 countsByYear W20227952172017 @default.
• W2022795217 countsByYear W20227952172018 @default.
• W2022795217 countsByYear W20227952172020 @default.
• W2022795217 countsByYear W20227952172021 @default.
• W2022795217 countsByYear W20227952172023 @default.
• W2022795217 crossrefType "journal-article" @default.
• W2022795217 hasAuthorship W2022795217A5011170655 @default.
• W2022795217 hasAuthorship W2022795217A5012188323 @default.
• W2022795217 hasAuthorship W2022795217A5019216535 @default.
• W2022795217 hasAuthorship W2022795217A5020556619 @default.
• W2022795217 hasAuthorship W2022795217A5031106340 @default.
• W2022795217 hasAuthorship W2022795217A5084464179 @default.
• W2022795217 hasAuthorship W2022795217A5088528790 @default.
• W2022795217 hasBestOaLocation W20227952171 @default.
• W2022795217 hasConcept C115624301 @default.
• W2022795217 hasConcept C141603559 @default.
• W2022795217 hasConcept C181199279 @default.
• W2022795217 hasConcept C185592680 @default.
• W2022795217 hasConcept C196032511 @default.
• W2022795217 hasConcept C2776061948 @default.
• W2022795217 hasConcept C2780120296 @default.
• W2022795217 hasConcept C55493867 @default.
• W2022795217 hasConcept C8010536 @default.
• W2022795217 hasConceptScore W2022795217C115624301 @default.
• W2022795217 hasConceptScore W2022795217C141603559 @default.
• W2022795217 hasConceptScore W2022795217C181199279 @default.
• W2022795217 hasConceptScore W2022795217C185592680 @default.
• W2022795217 hasConceptScore W2022795217C196032511 @default.
• W2022795217 hasConceptScore W2022795217C2776061948 @default.
• W2022795217 hasConceptScore W2022795217C2780120296 @default.
• W2022795217 hasConceptScore W2022795217C55493867 @default.
• W2022795217 hasConceptScore W2022795217C8010536 @default.
• W2022795217 hasIssue "49" @default.
• W2022795217 hasLocation W20227952171 @default.
• W2022795217 hasOpenAccess W2022795217 @default.
• W2022795217 hasPrimaryLocation W20227952171 @default.
• W2022795217 hasRelatedWork W2001873321 @default.
• W2022795217 hasRelatedWork W2020490429 @default.
• W2022795217 hasRelatedWork W2022795217 @default.
• W2022795217 hasRelatedWork W2032951706 @default.
• W2022795217 hasRelatedWork W2056426940 @default.
• W2022795217 hasRelatedWork W2058697332 @default.
• W2022795217 hasRelatedWork W2077288004 @default.
• W2022795217 hasRelatedWork W2149536955 @default.

• next