FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022877314> ?p ?o ?g. }

• W2022877314 endingPage "19896" @default.
• W2022877314 startingPage "19889" @default.
• W2022877314 abstract "We have studied the function of protein kinase A (PKA) during embryonic development using a PKA-deficient mouse that retains only one functional catalytic subunit allele, either Cα or Cβ, of PKA. The reduced PKA activity results in neural tube defects that are specifically localized posterior to the forelimb buds and lead to spina bifida. The affected neural tube has closed appropriately but exhibits an enlarged lumen and abnormal neuroepithelium. Decreased PKA activity causes dorsal expansion of Sonic hedgehog signal response in the thoracic to sacral regions correlating with the regions of morphological abnormalities. Other regions of the neural tube appear normal. The regional sensitivity to changes in PKA activity indicates that downstream signaling pathways differ along the anterior-posterior axis and suggests a functional role for PKA activation in neural tube development. We have studied the function of protein kinase A (PKA) during embryonic development using a PKA-deficient mouse that retains only one functional catalytic subunit allele, either Cα or Cβ, of PKA. The reduced PKA activity results in neural tube defects that are specifically localized posterior to the forelimb buds and lead to spina bifida. The affected neural tube has closed appropriately but exhibits an enlarged lumen and abnormal neuroepithelium. Decreased PKA activity causes dorsal expansion of Sonic hedgehog signal response in the thoracic to sacral regions correlating with the regions of morphological abnormalities. Other regions of the neural tube appear normal. The regional sensitivity to changes in PKA activity indicates that downstream signaling pathways differ along the anterior-posterior axis and suggests a functional role for PKA activation in neural tube development. Many studies have demonstrated roles for protein kinase A (PKA) 1The abbreviations used are: PKAprotein kinase ACcatalyticRregulatoryNTDneural tube defectEembryonic dayPBSphosphate-buffered salineDRGdorsal root ganglia1The abbreviations used are: PKAprotein kinase ACcatalyticRregulatoryNTDneural tube defectEembryonic dayPBSphosphate-buffered salineDRGdorsal root ganglia in the regulation of postnatal physiology, but limited knowledge has been gained on the function of PKA in mammalian development. Earlier studies have suggested potential requirements for PKA activity in regulating oocyte maturation in vertebrates (1Bornslaeger E.A. Mattei P. Schultz R.M. Dev. Biol. 1986; 114: 453-462Crossref PubMed Scopus (203) Google Scholar, 2Matten W. Daar I. Vande Woude G.F. Mol. Cell. Biol. 1994; 14: 4419-4426Crossref PubMed Scopus (109) Google Scholar) and in activating the zygotic genome in preimplantation mouse embryos (3Poueymirou W.T. Schultz R.M. Dev. Biol. 1989; 133: 588-599Crossref PubMed Scopus (57) Google Scholar). protein kinase A catalytic regulatory neural tube defect embryonic day phosphate-buffered saline dorsal root ganglia protein kinase A catalytic regulatory neural tube defect embryonic day phosphate-buffered saline dorsal root ganglia Probably the most striking role of PKA in embryonic development is its negative regulation of the Hedgehog (Hh) signaling pathway. Lack of PKA activity leads to ectopic expression of Hh target genes in Drosophila imaginal discs (4Perrimon N. Cell. 1995; 80: 517-520Abstract Full Text PDF PubMed Scopus (144) Google Scholar). Manipulation of PKA activity in vertebrates has also suggested that the negative regulation of the Sonic hedgehog (Shh) signaling pathway is conserved (5Hammerschmidt M. Bitgood M.J. McMahon A.P. Genes Dev. 1996; 10: 647-658Crossref PubMed Scopus (318) Google Scholar, 6Epstein D.J. Marti E. Scott M.P. McMahon A.P. Development. 1996; 122: 2885-2894Crossref PubMed Google Scholar, 7Fan C.M. Porter J.A. Chiang C. Chang D.T. Beachy P.A. Tessier-Lavigne M. Cell. 1995; 81: 457-465Abstract Full Text PDF PubMed Scopus (317) Google Scholar, 8Hynes M. Porter J.A. Chiang C. Chang D. Tessier-Lavigne M. Beachy P.A. Rosenthal A. Neuron. 1995; 15: 35-44Abstract Full Text PDF PubMed Scopus (403) Google Scholar). Shh signaling has been implicated in diverse processes in vertebrate development including cartilage differentiation, myotome and sclerotome specification, limb morphogenesis, and the specification of different neuronal cell types along the dorsoventral axis of the neural tube (9Goodrich L.V. Scott M.P. Neuron. 1998; 21: 1243-1257Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar,10Ingham P.W. EMBO J. 1998; 17: 3505-3511Crossref PubMed Scopus (378) Google Scholar). Whether PKA is involved in all of these processes and how PKA functions as a negative regulator (directly in the Hedgehog pathway or in a parallel pathway) are unclear. There are two catalytic (Cα and Cβ) and four regulatory (RIα, RIβ, RIIα, and RIIβ) subunit genes of PKA identified in mice (11McKnight G.S. Curr. Opin. Cell Biol. 1991; 3: 213-217Crossref PubMed Scopus (153) Google Scholar). These regulatory and catalytic subunits assemble into a heterotetramer composed of two C and two R subunits, and this PKA holoenzyme dissociates to release active C subunit when cAMP binds to the R subunits. Although each of the regulatory subunit genes encodes a single protein isoform, the catalytic subunit genes encode multiple variants. The Cα gene encodes two variants, Cα1 and Cα2, from two distinct promoters. In adult mice, Cα1 is expressed ubiquitously, whereas Cα2 is testis-specific (12Desseyn J.L. Burton K.A. McKnight G.S. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6433-6438Crossref PubMed Scopus (60) Google Scholar). The Cβ gene produces three splice variants, Cβ1, Cβ2, and Cβ3. Although Cβ1 is found in all tissues examined, Cβ2 and Cβ3 are brain-specific (13Guthrie C.R. Skalhegg B.S. McKnight G.S. J. Biol. Chem. 1997; 272: 29560-29565Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). The expression pattern of PKA isoforms have also been examined by in situ hybridization in mouse embryos at late organogenesis stage, showing an expression pattern similar to that in adult mice (14Cadd G. McKnight G.S. Neuron. 1989; 3: 71-79Abstract Full Text PDF PubMed Scopus (189) Google Scholar). All studies on the roles of PKA in vertebrate development have utilized transgenic or pharmacological manipulations, which have limitations in their ability to mimic the spatial and temporal patterns of endogenous activity of PKA. One way to solve this problem is to use PKA knockout mice, and we have created null mutations in each of the four regulatory and two catalytic subunits of PKA expressed in the mouse. The only single knockout to show developmental abnormalities is the RIα regulatory subunit null mutation. The RIα knockout mouse dies during embryonic development because of a severe defect in mesoderm formation resulting from an increase in basal PKA activity. 2P. S. Amieux, D. Howe, H. Knickerbocker, D. C. Lee, T. Su, R. L. Idzerda, and G. S. McKnight, submitted for publication.2P. S. Amieux, D. Howe, H. Knickerbocker, D. C. Lee, T. Su, R. L. Idzerda, and G. S. McKnight, submitted for publication. The present study reports developmental consequences of decreased PKA activity in mice. A PKA-deficient mouse was generated with only one functional catalytic subunit allele, either Cα or Cβ, of PKA. The mutant mice with reduced PKA activity developed localized neural tube defects (NTDs). The spinal neural tube defect occurred at the thoracic to sacral regions of the neural tube, was 100% penetrant, and could lead to spina bifida in newborn mice, whereas exencephaly (open cranial neural tube) was partially penetrant and only present in mice with a single Cβ allele remaining. Histological examination of the abnormal spinal neural tube revealed a closed neural tube with an enlarged lumen and abnormal neuroepithelium. Marker analysis showed dorsal expansion of Shh-dependent cell types, resulting in a ventralized neuronal identity in the affected neural tube. Decreasing PKA activity also resulted in an increase in apoptotic cell death in the abnormal neuroepithelium and dorsal root ganglia, suggesting that PKA activity plays an anti-apoptotic role in the developing neural tube. All of the defects were observed in the posterior neural tube from the thoracic to sacral regions, whereas the cervical neural tube appeared normal, suggesting differential dependence on PKA activity along the anterior-posterior axis. The Cα and Cβ1 knockout mice were generated as previously described (15Skalhegg B.S. Huang Y., Su, T. Idzerda R.L. McKnight G.S. Burton K.A. Mol. Endocrinol. 2002; 16: 630-639PubMed Google Scholar, 16Qi M. Zhuo M. Skalhegg B.S. Brandon E.P. Kandel E.R. McKnight G.S. Idzerda R.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1571-1576Crossref PubMed Scopus (154) Google Scholar). Cα+/−Cβ1+/− heterozygous mice were maintained on a 129/C57BL6 mixed background. Genotyping of both Cα and Cβ alleles was performed on tail DNA by PCR analysis. The wild type Cα allele was detected by a pair of primers (CTGACCTTTGAGTATCTGCAC and GTCCCACACAAGGTCCAAGTA), which amplify a 250-nucleotide fragment of the intron between exons 6 and 7. The Cα knockout allele was detected by another pair of primers (GTGGTTTGTCCAAACTCATCAATGT and AGACTACTGCTCTATCACTGA), which amplify a 270-nucleotide fragment of the region between the 3′ end of the neomycin resistance gene and a portion of the intron just 3′ to exon 8. Genotyping of the Cβ wild type allele was performed using the primers Cβ PCR-1B (CCGTCATCCCTGCTTGCGGA) and Cβ PCR 2 (CTCCACTTCGCTGCCTTTCT), which amplify a 69-nucleotide fragment in the first exon. The knockout Cβ1 allele was detected using the primers Cβ PCR-1B and Cβ neo-2 (ATCCTCATCCTGTCTCTTGA), which amplify a 480-nucleotide fragment including the 5′ portion of exon 1 and the 5′ end of the neomycin resistance gene. PKA-deficient mice with different mutant combinations of Cα and Cβ1 alleles were generated by intercrossing Cα+/−Cβ1+/− heterozygous mice. When the vaginal plug was detected in the morning, noon of the same day was considered as E0.5 for the timing of embryos. All dissection was performed in M2 medium (Sigma). Genotyping of embryos was performed by PCR analysis using yolk sac DNA. After removing skin and viscera, carcasses were fixed overnight in 95% ethanol and stained overnight using 0.015% alcian blue in a solution of 4 parts of 95% ethanol and 1 part of acetic acid. Samples were put back in 95% ethanol for 2–5 h and then incubated in 0.5% KOH for 4–5 days. Skeletons were stained in 0.015% alizarin red, 0.5% KOH and cleared in 0.5% KOH, 20% glycerol for about 2 days. Skeletons were stored and photographed in a 1:1 mixture of glycerol and 95% ethanol. Embryos were fixed overnight in Methacarns (6 parts of methanol, 3 parts of chloroform, and 1 part of acetic acid) at room temperature and embedded in paraffin. Samples were sectioned at 8 μm and stained with hematoxylin and eosin. Sections were viewed under a Nikon microscope and photographed. Embryos were fixed in 4% paraformaldehyde at 4 °C for 2–4 h, washed in phosphate-buffered saline (PBS), and submerged in 30% sucrose plus PBS overnight at 4 °C. Samples were embedded in O.C.T. compound (Sakura Finetek) and cryosectioned at 20 μm. Sections were washed with PBS and blocked using 10% goat serum (Zymed Laboratories Inc., San Francisco, CA) in PBS with 0.1% Triton X-100. Incubation of primary antibodies was performed at 4 °C in 1% goat serum plus PBS with 0.1% Triton X-100 overnight. Secondary antibody was fluorescein-conjugated goat IgG fraction to mouse IgG (ICN, Aurora, OH). Sections were visualized using a Bio-Rad MRC 600 confocal laser scanning microscope, and images were captured using COSMOS software. The antibodies used in this study are described and referenced in the Developmental Studies Hybridoma Bank data base at the University of Iowa. Immunohistochemistry for cleaved caspase-3 was performed according to manufacturer's protocol (Cell Signaling Technology, Beverly, MA). The secondary antibody was biotinylated anti-rabbit IgG followed by fluorescein avidin D (Vector Laboratories, Inc., Burlingame, CA). The sections were visualized using a Leica spectral confocal microscope. RNA in situ hybridization was carried out as described (17Spector D. Goldman R.D. Leinwand L.A. Cells: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1998Google Scholar) using digoxigenin-labeled probe. Immunological detection was performed using preabsorbed anti-digoxigenin-AP Fab fragments (Roche Molecular Biochemicals) and colored with BM Purple AP substrate (Roche Molecular Biochemicals). Wild type C57/BL6 embryos at E9.5 were used for dissection of the following three portions of the neural tube: posterior neural tube (thoracic to sacral), anterior neural tube (cervical/brachial), and cranial neural tube. The dissection was performed in PBS, and tissues including the body wall, limb buds, heart, and the brachial arches were removed. Samples from a total of 65 embryos were pooled together and then homogenized in buffer (250 mm sucrose, 20 mmTris, pH 7.6, 5 mm MgAc, 0.1 mm EDTA, 0.5 mm EGTA, 10 mm dithiothreitol, 1.0% Triton X-100, 10% deoxycholate sodium salt, 2 μg/ml leupeptin, 3 μg/ml aprotinin, 0.2 mg/ml soybean trypsin inhibitor, 1 mm4-(2-aminoethyl) benzenesulfonyl fluoride), sonicated, and centrifuged for 10 min at 12,000 × g at 4 °C. Supernatants were collected, and the protein concentration was measured by Bradford method (Bio-Rad). Forty micrograms of protein were loaded onto individual lanes of a 10% SDS-PAGE and transferred to a nitrocellulose membrane. The blots were stained with 0.2% Ponceau S before blocking overnight in blocking buffer (10 mm Tris-Cl, pH 8.0, 150 mm NaCl, 5% bovine serum albumin, 0.05% Tween 20) and probed with anti-Cα or anti-Cβ polyclonal antibodies. The blots were then incubated with horseradish peroxidase secondary antibody and visualized using the Amersham ECL system. Protein homogenates from the dissected neural tubes were assayed for kinase activity in the presence and absence of cAMP using Kemptide (Sigma) as a substrate as described (18Clegg C.H. Correll L.A. Cadd G.G. McKnight G.S. J. Biol. Chem. 1987; 262: 13111-13119Abstract Full Text PDF PubMed Google Scholar). To investigate PKA function during embryonic development, we generated a PKA-deficient mouse with only one functional catalytic subunit allele by crossing the Cα and Cβ1 knockout mice. Cα and Cβ, the two catalytic subunit genes of PKA, had been previously disrupted using gene targeting in ES cells in mice. The Cα knockout disrupts exons 6–8 and eliminates expression of both Cα1 and Cα2 (15Skalhegg B.S. Huang Y., Su, T. Idzerda R.L. McKnight G.S. Burton K.A. Mol. Endocrinol. 2002; 16: 630-639PubMed Google Scholar). In these animals, PKA activity was greatly reduced in all tissues except brain, where there was only a 50% decrease of PKA activity because of a compensatory increase of Cβ proteins. The Cβ1 knockout used in these studies is disrupted in exon1 preventing expression of Cβ1 but allowing synthesis of Cβ2 and Cβ3 in brain (13Guthrie C.R. Skalhegg B.S. McKnight G.S. J. Biol. Chem. 1997; 272: 29560-29565Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 16Qi M. Zhuo M. Skalhegg B.S. Brandon E.P. Kandel E.R. McKnight G.S. Idzerda R.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1571-1576Crossref PubMed Scopus (154) Google Scholar). There was no significant change of PKA activity or apparent compensation of Cα levels in all tissues examined. Mice with one or two mutant C subunit alleles, either Cα or Cβ1, were born with no apparent embryonic defects (Table I). However, PKA-deficient mice with three mutant C subunit alleles were found to have malformations in their spinal columns (Fig. 1A). The spinal column defects in newborn PKA-deficient pups were located in their thoracic and lumbar regions. The malformed area was not covered by the vertebral arches, but only by skin. Skeleton preparation from the mutant newborn pups revealed that the vertebral arches failed to fuse at the dorsal midline between forelimbs and hindlimbs, whereas all other components of the vertebrae were present with regular ossification (Fig. 1, B and C). The malformation of vertebral arches defines the mutation in PKA-deficient mice as spina bifida. The spine also showed a ventral curvature at the defective region. The defective phenotype was 100% penetrant. The mutant pups, when kept with their parents, were rejected and left out of the litter, and later died probably from starvation. Moreover, all 22 mutant pups obtained were Cα+/−Cβ1−/− with a single functional Cα allele. None of them were found to have two mutant Cα alleles and a single functional Cβ allele. Analysis of embryos from timed mating revealed that the mutant embryos with a single functional Cβ allele died by embryonic day 14 (E14), indicating a more severe phenotype.Table IConsequences of successively removing catalytic subunit alleles of PKA in miceNos. of functional alleles of CGenotypesPhenotypes4Cα+/+Cβ1+/+Wild-type3Cα+/−Cβ1+/+ Cα+/+Cβ1+/−Normal in appearance2Cα+/−Cβ1+/− Cα−/−Cβ1+/+ Cα+/+Cβ1−/−Normal in appearance Growth retardation, male sterility Normal in appearance1Cα+/−Cβ1−/− Cα−/−Cβ1+/−100% spinal neural tube defects 75% spinal neural tube defects; 25% spinal neural tube defects and exencephaly0Cα−/−Cβ1−/−Early embryonic lethality Open table in a new tab Embryos were examined from E8.5 to E12.5 to ascertain when the spinal column defect in PKA-deficient mice occurred during embryogenesis. The genotypes of embryos were determined by PCR analysis of DNA isolated from visceral yolk sac. Mutant embryos can be first distinguished from their wild type littermates at E9.5 by an expansion of the dorsal neural canal (data not shown). The defect was only observed in the neural tube posterior to the forelimb buds. The anterior spinal cord appeared normal. At E10.5, the neural tube defect became more obvious with varying severity in individual embryos, probably because of embryo to embryo variations in developmental stage. The most severe phenotype was observed as a blister-like bulging of the neural tube along the dorsal midline covering the region of thoracic, lumbar and sacral neural tube (Fig. 1D). The bulging neural tube appeared to be covered by epithelial tissue, which was consistent with the observation of the affected spinal column in the newborn pups. In addition, some of the Cα−/−Cβ1+/−mutants also exhibited exencephaly (open cranial neural tube) (Fig. 1E). As summarized in Table I, all Cα+/−Cβ1−/− embryos had only spinal neural tube defect, whereas approximately one fourth of Cα−/−Cβ1+/− embryos developed exencephaly in addition to the spinal neural tube defect. Exencephaly alone was not observed. As described below, the morphology and the neuronal patterning in the defective spinal neural tube were indistinguishable in embryos of either the Cα+/−Cβ1−/− or Cα−/−Cβ1+/− genotype. Histological examination of the developing neural tube was performed in embryos from E9.5 to E12.5. Transverse sections through the thoracic to sacral neural tube of mutant embryos at E9.5 and also some embryos at E10.5 showed a closed neural tube with an expanded alar plate and enlarged lumen (Fig. 2, A and B). The neural tube at the cervical region appeared normal (data not shown). In the longitudinal sections through the dorsal half of the neural tube, the neuroepithelium appeared expanded (Fig. 2, C and D), indicating a possible overproliferation within the dorsal neural tube at this developmental stage. A similar phenotype in the neural tube has been observed in transgenic embryos expressing a dominant negative form of PKA in dorsal aspects of the mouse central nervous system (6Epstein D.J. Marti E. Scott M.P. McMahon A.P. Development. 1996; 122: 2885-2894Crossref PubMed Google Scholar). We examined bromodeoxyuridine incorporation in the spinal cord of mutant embryos to identify cells that have divided. The average number of labeled cells in sections of the affected neural tube of E9.5 and E10.5 embryos at hindlimb level was compared with that in corresponding sections of wild type controls. The result revealed no difference between the mutants and their controls in the number of proliferating cells in the whole transverse sections of neural tube (data not shown), suggesting that the aberrant morphology is not caused by overproliferation. In embryos older than E10.5, the expansion of the neural canal increased dramatically. Transverse sections showed that the lumen was significantly enlarged and the neuroepithelium contained a higher cell density compared with wild type control (Fig. 2, E and F). In addition to the change in neural tube morphology, dorsal root ganglia (DRG) were also affected. DRG were formed in the mutant E10.5 embryos, even though they appeared disorganized (Fig. 2D), but they regressed at E12.5, suggesting that PKA activity might be required for DRG maintenance. The loss of DRG cells could indicate a possible abnormal cell death in neural crest cell derivatives, which might also occur in the neural tube. To test the possibility of increasing apoptosis in the affected neuroepithelium and neural crest, immunohistochemistry was performed to detect activated caspase-3 in the developing neural tube of E10.5 embryos. Caspase-3 is one of the key executioner caspases of cell death and the activated form of caspase-3 is usually only found in cells undergoing apoptosis. In the neural tube of PKA-deficient embryos, apoptotic cells were frequently observed compared with the rare occurrence of apoptotic cells in wild type embryos (Fig. 3). Most of the apoptotic cells in the mutant were located in dorsal and/or lateral regions of the neural tube. In addition to the neural tube, a more significant increase in cell death was also detected in DRG adjacent to the affected neural tube, but not in DRG at other axial levels of PKA-deficient embryos (Fig. 3C). Despite the observed increase in apoptosis, the total number of apoptotic cells observed in the defective neuroepithelium was still very small and could easily be overcome by the large number of dividing cells in the neural tube. Therefore, the increased cell death is unlikely to be a major determinant of the neuroepithelial abnormality. The more significant increase in DRG cell death may account for the regression of these structures observed in mutant embryos. One interesting phenomenon in our study is that the neural tube defects were only detected posterior to the forelimb buds of PKA-deficient embryos. What makes the posterior part of the spinal neural tube more sensitive to the decrease in PKA activity compared with other regions? One possible reason could be that the expression of the catalytic subunits of PKA are differentially distributed along the anterior-posterior regions of the neural tube, causing PKA activity in some region to be closer to the cellular threshold below which mutations become apparent. The observed mutant phenotype might suggest a lower PKA activity at thoracic to sacral regions. To test this, we dissected the axial structures including the neural tube, paraxial mesoderm, and the attached ectoderm from E9.5 wild type C57/BL6 embryos. The axial structure was collected in three parts: cranial neural tube, anterior (cervical/brachial) neural tube, and posterior (thoracic to sacral) neural tube. Western blots using protein extracts were analyzed to quantitate the expression of C subunits. The analysis demonstrated that there was slightly less C subunit expression in the posterior neural tube compared with the anterior neural tube (Fig. 4A), and this correlated with a 20% decrease in PKA activity in the posterior compared with anterior regions (Fig. 4B). Both the results from Western blot and kinase assay indicate a modest difference in overall expression of catalytic subunits of PKA, but we believe that this is unlikely to explain the dramatic differences we see in morphology and gene expression (see below) in the affected posterior region. The Western analysis also demonstrated that both Cα and Cβ genes were expressed as a single protein isoform, Cα1 and Cβ1, respectively, in the axial tissues of mouse embryos at E9.5. Cα2, the testis-specific isoform in adult mice, was not detectable at this developmental stage, and the brain-specific isoforms, Cβ2 and Cβ3, were also absent. The PKA pathway has been implicated as a negative regulator of Sonic hedgehog signaling in development, and Shh signaling is a major organizer for dorsal/ventral patterning in the neural tube. Therefore, we examined the manifestations of Shh signaling and the specification of neuronal identity in the neural tube of PKA-deficient embryos at E10.5. Shh is sufficient for the induction of floor plate cells (19Roelink H. Augsburger A. Heemskerk J. Korzh V. Norlin S. Ruiz i Altaba A. Tanabe Y. Placzek M. Edlund T. Jessell T.M. Cell. 1994; 76: 761-775Abstract Full Text PDF PubMed Scopus (744) Google Scholar), which express Hnf3β and Shh itself. In PKA-deficient embryos, the expression of both Shh and Hnf3β was expanded dorsally (Fig. 5, B and F). Shh expression was detected in the ventral half of the neural tube at levels similar to a normal floor plate. The expression domain of Hnf3β was also greatly expanded in the ventral neural tube, albeit at levels lower than those found at the ventral midline (Fig. 5F). Cells with lower Hnf3β expression did not display typical floor plate morphology, i.e. a single layer with basal nuclei. Interestingly, the dorsal expansion of Shh and Hnf3β expression was correlated only with the abnormal morphology in the affected neural tube. In the cervical neural tube, Shh and Hnf3β were expressed normally (Fig. 5, C and D; data not shown). The same localized effect was also observed with the whole mount in situ hybridization of PKA-deficient embryos at E9.5, which demonstrated that the ectopic expression of Hnf3β was localized to the region posterior to the forelimb buds (Fig. 5G). Shh is required for the induction of motor neurons and adjacent interneuron progenitors in the ventral neural tube, which is mediated by regulating the expression of several homeodomain proteins (20Marti E. Bumcrot D.A. Takada R. McMahon A.P. Nature. 1995; 375: 322-325Crossref PubMed Scopus (436) Google Scholar, 21Roelink H. Porter J.A. Chiang C. Tanabe Y. Chang D.T. Beachy P.A. Jessell T.M. Cell. 1995; 81: 445-455Abstract Full Text PDF PubMed Scopus (757) Google Scholar, 22Chiang C. Litingtung Y. Lee E. Young K.E. Corden J.L. Westphal H. Beachy P.A. Nature. 1996; 383: 407-413Crossref PubMed Scopus (2515) Google Scholar, 23Ericson J. Morton S. Kawakami A. Roelink H. Jessell T.M. Cell. 1996; 87: 661-673Abstract Full Text Full Text PDF PubMed Scopus (748) Google Scholar, 24Ericson J. Rashbass P. Schedl A. Brenner-Morton S. Kawakami A. van Heyningen V. Jessell T.M. Briscoe J. Cell. 1997; 90: 169-180Abstract Full Text Full Text PDF PubMed Scopus (820) Google Scholar, 25Briscoe J. Sussel L. Serup P. Hartigan-O'Connor D. Jessell T.M. Rubenstein J.L. Ericson J. Nature. 1999; 398: 622-627Crossref PubMed Scopus (590) Google Scholar). The dorsalized expression of Shh in PKA-deficient embryos may lead to an altered patterning of neuronal identity in the neural tube. We analyzed the pattern of ventral neuronal progenitors in the PKA-deficient neural tube by focusing on the expression of two homeodomain proteins, Pax6 and Nkx2.2. Shh signaling represses the expression of Pax6, which, in turn, represses the expression of Nkx2.2 in V3 interneuron progenitor cells at the region dorsolateral to the floor plate (24Ericson J. Rashbass P. Schedl A. Brenner-Morton S. Kawakami A. van Heyningen V. Jessell T.M. Briscoe J. Cell. 1997; 90: 169-180Abstract Full Text Full Text PDF PubMed Scopus (820) Google Scholar, 25Briscoe J. Sussel L. Serup P. Hartigan-O'Connor D. Jessell T.M. Rubenstein J.L. Ericson J. Nature. 1999; 398: 622-627Crossref PubMed Scopus (590) Google Scholar) (Fig. 6,A and C). In the affected neural tube of PKA-deficient embryos, the expression of Pax6 was repressed in most of the neural tube, with some dorsal Pax6 expressing cells remaining (Fig. 6B). Consistent with this, expression of Nkx2.2 was dorsally expanded with the dorsal boundary extending into the medial/dorsal ventricular zone of the neural tube (Fig. 6D). The dorsalized expression of Pax6 could be a consequence of ectopic activation of the Shh response in the affected neural tube. These results indicate a change of neuronal identity in the affected neural tube that leads to a ventralized neural tube, which we confirmed by examining the induction of motor neurons. Motor neuron progenitor cells, which are located immediately dorsal to V3 interneuron progenitors, express low levels of Pax6 but not Nkx2.2. The post-mitotic motor neurons were detected by the expression of the homeodomain proteins Islet1/2, which mark DRG cells and differentiated motor neurons (24Ericson J. Rashbass P. Schedl A. Brenner-Morton S. Kawakami A. van Heyningen V. Jessell T.M. Briscoe J. Cell. 1997; 90: 169-180Abstract Full Text Full Text PDF PubMed Scopus (820) Google Scholar). In wild type mice, Islet1/2-expressing motor neurons are located immediately dorsal to V3 interneurons in ventrolateral regions adjacent to the ventricular zone of the neural tube (Fig. 6G). In PKA-deficient mice, Islet1/2-labeled motor neurons were dorsally expanded into the intermediate zone, consistent with the Nkx2.2 expansion and Pax6 repression (Fig. 6H). Because of the appearance of ventral neuronal progenitors in the dorsal neural tube, we next examined the fate of dorsal cell types in the affected neural tube. Pax7, one of the class I homeodomain proteins (26Briscoe J. Pierani A. Jessell T.M. Ericson J. Cell. 2000; 101: 435-445Abstrac" @default.
• W2022877314 created "2016-06-24" @default.
• W2022877314 creator A5007773253 @default.
• W2022877314 creator A5017044526 @default.
• W2022877314 creator A5033672356 @default.
• W2022877314 date "2002-05-01" @default.
• W2022877314 modified "2023-10-16" @default.
• W2022877314 title "Protein Kinase A Deficiency Causes Axially Localized Neural Tube Defects in Mice" @default.
• W2022877314 cites W1481472040 @default.
• W2022877314 cites W1538129425 @default.
• W2022877314 cites W1550813715 @default.
• W2022877314 cites W1895052039 @default.
• W2022877314 cites W1944404325 @default.
• W2022877314 cites W1970642341 @default.
• W2022877314 cites W1975670140 @default.
• W2022877314 cites W1982087641 @default.
• W2022877314 cites W1983310594 @default.
• W2022877314 cites W1983341583 @default.
• W2022877314 cites W1994952789 @default.
• W2022877314 cites W1999100324 @default.
• W2022877314 cites W2003518121 @default.
• W2022877314 cites W2004344017 @default.
• W2022877314 cites W2006047257 @default.
• W2022877314 cites W2013137419 @default.
• W2022877314 cites W2018989596 @default.
• W2022877314 cites W2019150363 @default.
• W2022877314 cites W2021103771 @default.
• W2022877314 cites W2031399848 @default.
• W2022877314 cites W2034404899 @default.
• W2022877314 cites W2055350432 @default.
• W2022877314 cites W2055662392 @default.
• W2022877314 cites W2056079046 @default.
• W2022877314 cites W2058016050 @default.
• W2022877314 cites W2059000943 @default.
• W2022877314 cites W2059205089 @default.
• W2022877314 cites W2059614045 @default.
• W2022877314 cites W2071539055 @default.
• W2022877314 cites W2072159023 @default.
• W2022877314 cites W2083485306 @default.
• W2022877314 cites W2088472722 @default.
• W2022877314 cites W2090204791 @default.
• W2022877314 cites W2097606482 @default.
• W2022877314 cites W2102345821 @default.
• W2022877314 cites W2122598160 @default.
• W2022877314 cites W2134386050 @default.
• W2022877314 cites W2138526982 @default.
• W2022877314 cites W2140654443 @default.
• W2022877314 cites W2152173743 @default.
• W2022877314 cites W2152277071 @default.
• W2022877314 cites W2157215000 @default.
• W2022877314 cites W2159199900 @default.
• W2022877314 cites W2163838718 @default.
• W2022877314 cites W2204025208 @default.
• W2022877314 cites W4248042899 @default.
• W2022877314 doi "https://doi.org/10.1074/jbc.m111412200" @default.
• W2022877314 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11886853" @default.
• W2022877314 hasPublicationYear "2002" @default.
• W2022877314 type Work @default.
• W2022877314 sameAs 2022877314 @default.
• W2022877314 citedByCount "99" @default.
• W2022877314 countsByYear W20228773142012 @default.
• W2022877314 countsByYear W20228773142013 @default.
• W2022877314 countsByYear W20228773142014 @default.
• W2022877314 countsByYear W20228773142015 @default.
• W2022877314 countsByYear W20228773142016 @default.
• W2022877314 countsByYear W20228773142017 @default.
• W2022877314 countsByYear W20228773142018 @default.
• W2022877314 countsByYear W20228773142019 @default.
• W2022877314 countsByYear W20228773142020 @default.
• W2022877314 countsByYear W20228773142021 @default.
• W2022877314 countsByYear W20228773142022 @default.
• W2022877314 countsByYear W20228773142023 @default.
• W2022877314 crossrefType "journal-article" @default.
• W2022877314 hasAuthorship W2022877314A5007773253 @default.
• W2022877314 hasAuthorship W2022877314A5017044526 @default.
• W2022877314 hasAuthorship W2022877314A5033672356 @default.
• W2022877314 hasBestOaLocation W20228773141 @default.
• W2022877314 hasConcept C105702510 @default.
• W2022877314 hasConcept C127413603 @default.
• W2022877314 hasConcept C159985019 @default.
• W2022877314 hasConcept C192562407 @default.
• W2022877314 hasConcept C196843134 @default.
• W2022877314 hasConcept C2777551473 @default.
• W2022877314 hasConcept C2780594696 @default.
• W2022877314 hasConcept C35377427 @default.
• W2022877314 hasConcept C66938386 @default.
• W2022877314 hasConcept C86803240 @default.
• W2022877314 hasConcept C95444343 @default.
• W2022877314 hasConceptScore W2022877314C105702510 @default.
• W2022877314 hasConceptScore W2022877314C127413603 @default.
• W2022877314 hasConceptScore W2022877314C159985019 @default.
• W2022877314 hasConceptScore W2022877314C192562407 @default.
• W2022877314 hasConceptScore W2022877314C196843134 @default.
• W2022877314 hasConceptScore W2022877314C2777551473 @default.
• W2022877314 hasConceptScore W2022877314C2780594696 @default.
• W2022877314 hasConceptScore W2022877314C35377427 @default.
• W2022877314 hasConceptScore W2022877314C66938386 @default.
• W2022877314 hasConceptScore W2022877314C86803240 @default.

• next