FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022978842> ?p ?o ?g. }

• W2022978842 endingPage "27560" @default.
• W2022978842 startingPage "27552" @default.
• W2022978842 abstract "It is now well established that locus-wide chromatin remodeling and dynamic alterations of histone modifications are required for the developmentally regulated activation of tissue-specific genes. However, little is known about the dynamics of these events during cell differentiation and how chromatin of an entire gene locus responds to signal transduction processes. To address this issue we investigated chromatin accessibility, linker histone distribution, and the histone methylation status at the macrophage-specific chicken lysozyme locus and the ubiquitously expressed gas41 locus in multipotent precursor cell lines and BM2 monoblast cells. The latter can be induced to go through macrophage maturation by treatment with phorbol-12-myristate acetate and can be further stimulated with bacterial lipopolysaccharide. We show that expression of the lysozyme gene in undifferentiated monoblasts is low and that a high level of gene expression requires both cell differentiation and lipopolysaccharide stimulation. However, depletion of the linker histone H1 is observed already in lysozyme non-expressing multipotent precursor cells. In undifferentiated monoblasts, the lysozyme regulatory regions are marked by the presence of monomethylated histone H3 lysine 4, which becomes increasingly converted into trimethylated H3 lysine K4 during cell differentiation. We also present evidence for extensive, differentiation-dependent alterations in nuclease accessibility at the lysozyme promoter without alterations of nucleosome and transcription factor occupancy. It is now well established that locus-wide chromatin remodeling and dynamic alterations of histone modifications are required for the developmentally regulated activation of tissue-specific genes. However, little is known about the dynamics of these events during cell differentiation and how chromatin of an entire gene locus responds to signal transduction processes. To address this issue we investigated chromatin accessibility, linker histone distribution, and the histone methylation status at the macrophage-specific chicken lysozyme locus and the ubiquitously expressed gas41 locus in multipotent precursor cell lines and BM2 monoblast cells. The latter can be induced to go through macrophage maturation by treatment with phorbol-12-myristate acetate and can be further stimulated with bacterial lipopolysaccharide. We show that expression of the lysozyme gene in undifferentiated monoblasts is low and that a high level of gene expression requires both cell differentiation and lipopolysaccharide stimulation. However, depletion of the linker histone H1 is observed already in lysozyme non-expressing multipotent precursor cells. In undifferentiated monoblasts, the lysozyme regulatory regions are marked by the presence of monomethylated histone H3 lysine 4, which becomes increasingly converted into trimethylated H3 lysine K4 during cell differentiation. We also present evidence for extensive, differentiation-dependent alterations in nuclease accessibility at the lysozyme promoter without alterations of nucleosome and transcription factor occupancy. Epigenetic processes involve the establishment of patterns of gene expression via the coordinated and heritable alterations in chromatin structure. These alterations involve a change in the covalent modification of histone N-terminal tails as well as global reorganization of chromatin architecture, all of which is driven by sequence-specific transcription factors recruiting the enzymatic machinery performing these reactions. Such histone tail modifications are not only able to alter the charge or biochemical surface of the chromatin fiber, but also serve as “docking” sites for transcription factor and chromatin remodeling complexes, thus stabilizing the interaction of such complexes with chromatin templates (1Fischle W. Wang Y. Jacobs S.A. Kim Y. Allis C.D. Khorasanizadeh S. Genes Dev. 2003; 17: 1870-1881Crossref PubMed Scopus (796) Google Scholar). High levels of gene expression go along with an increase in the accessibility of the chromatin of extended genomic regions to nuclease digestion and hyperacetylation of the histone tails of all core histones. Another modification that is associated with active genes is the methylation of lysine 4 of histone H3 (H3K4) 1The abbreviations used are: H3K4, lysine 4 of histone H3; H3K9, lysine 9 of histone H3; PMA, phorbol-12-myristate acetate; LPS, bacterial lipopolysaccharide; DHS, DNase I-hypersensitive site; DMS, dimethyl sulfate; ChIP, chromatin immunoprecipitation; LM-PCR, ligation-mediated PCR; MNase, micrococcal nuclease. (2Strahl B.D. Ohba R. Cook R.G. Allis C.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 14967-14972Crossref PubMed Scopus (414) Google Scholar, 3Litt M.D. Simpson M. Gaszner M. Allis C.D. Felsenfeld G. Science. 2001; 293: 2453-2455Crossref PubMed Scopus (521) Google Scholar, 4Santos-Rosa H. Schneider R. Bannister A.J. Sherriff J. Bernstein B.E. Emre N.C. Schreiber S.L. Mellor J. Kouzarides T. Nature. 2002; 419: 407-411Crossref PubMed Scopus (1608) Google Scholar). An interesting feature of histone methylation is the fact that, although the same enzyme modifies the histone tails, H3K4 residues can be mono-, di-, or trimethylated, and such differences are of functional consequence. It was recently shown that di- and trimethylated lysines, but not monomethylated lysines, bind the chromatin-remodeling complex ISWI with high affinity (5Santos-Rosa H. Schneider R. Bernstein B.E. Karabetsou N. Morillon A. Weise C. Schreiber S.L. Mellor J. Kouzarides T. Mol. Cell. 2003; 12: 1325-1332Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar). In turn, it was shown that the presence of any H3K4 methyl mark inhibits the binding of heterochromatic silencing factors (6Santos-Rosa H. Bannister A.J. Dehe P.M. Geli V. Kouzarides T. J. Biol. Chem. 2004; 279: 47506-47512Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). In this context several observations are noteworthy. In yeast it was shown that the Set1 methyltransferase enzyme that modifies H3K4 is recruited by the RNA-polymerase II complex and thus leaves a trail of trimethylated histone behind even when transcription has ceased (7Ng H.H. Robert F. Young R.A. Struhl K. Mol. Cell. 2003; 11: 709-719Abstract Full Text Full Text PDF PubMed Scopus (857) Google Scholar). This is also seen in higher eukaryotes (8Schneider R. Bannister A.J. Myers F.A. Thorne A.W. Crane-Robinson C. Kouzarides T. Nat. Cell Biol. 2004; 6: 73-77Crossref PubMed Scopus (617) Google Scholar). Interestingly, the K4-dimethyl mark seems to be regulated differently, because this appears also on non-transcribed genes and may indicate a poised chromatin state. Little is known about the role of H3K4 monomethylated histones at genes of higher eukaryotes and the functional significance of this modification. Our laboratory has been investigating the interplay between developmental gene locus activation, active histone marks, and transcription factor occupancy. As a model system we have adopted the chicken lysozyme locus, which is expressed in myeloid cells. The chicken lysozyme gene is located within a generally DNase I-sensitive chromatin domain that spans 24 kb (9Jantzen K. Fritton H.P. Igo-Kemenes T. Nucleic Acids Res. 1986; 14: 6085-6099Crossref PubMed Scopus (67) Google Scholar, 10Sippel A.E. Schafer G. Faust N. Saueressig H. Hecht A. Bonifer C. Cold Spring Harbor Symp. Quant. Biol. 1993; 58: 37-44Crossref PubMed Scopus (23) Google Scholar) and contains two differentially regulated genes in close proximity: the highly tissue-specific clys gene and the ubiquitously expressed gas41 gene (11Chong S. Riggs A.D. Bonifer C. Nucleic Acids Res. 2002; 30: 463-467Crossref PubMed Scopus (31) Google Scholar). However, a high level of general DNase I sensitivity at both genes is only observed in lysozyme-expressing cells, and the reason for this puzzling finding is not clear. Constitutive expression of the gas41 is driven by a CpG island with dual origin/promoter function. Lysozyme gene expression in macrophages is controlled by at least five tissue-specifically active cis-regulatory elements, three enhancer elements situated 6.1, 3.9, and 2.7 kb upstream of the transcription start site, a silencer element at –2.4 kb and a complex promoter (12Bonifer C. Jagle U. Huber M.C. J. Biol. Chem. 1997; 272: 26075-26078Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). Priming of chromatin structure as indicated by selective demethylation of DNA, a partial accessibility to transcription factor binding, and changes in DNA topology occurs already in multipotent precursor cells, which do not yet express the gene (13Kontaraki J. Chen H.H. Riggs A. Bonifer C. Genes Dev. 2000; 14: 2106-2122PubMed Google Scholar, 14Lefevre P. Melnik S. Wilson N. Riggs A.D. Bonifer C. Mol. Cell. Biol. 2003; 23: 4386-4400Crossref PubMed Scopus (49) Google Scholar, 15Tagoh H. Melnik S. Lefevre P. Chong S. Riggs A.D. Bonifer C. Blood. 2004; 103: 2950-2955Crossref PubMed Scopus (59) Google Scholar). The mechanistic basis for this observation is unknown. Lysozyme gene expression is first observed in granulocyte-macrophage precursors and in mature macrophages is rapidly induced by pro-inflammatory stimuli such as bacterial lipopolysaccharide (LPS). As judged by DNase I-hypersensitive site (DHS) mapping, enhancer and promoter elements are only fully active in LPS-treated mature macrophages where maximum level gene expression is observed. At each successive step of the developmental activation of the lysozyme locus, levels of histone H3 (K9 and K14) acetylation at the enhancers are increased and levels of histone H3 (K9) methylation are decreased (14Lefevre P. Melnik S. Wilson N. Riggs A.D. Bonifer C. Mol. Cell. Biol. 2003; 23: 4386-4400Crossref PubMed Scopus (49) Google Scholar). However, up to date, H3K4 methylation levels were not studied and the dynamics of histone methylation levels at the cis-elements regulating the two juxtaposed gene loci is not known. In the study presented here, we addressed this issue and we also examined how histone methylation levels and chromatin architecture of the entire locus respond to the induction of differentiation and high level expression by external signals. We studied dynamic alterations in chromatin accessibility, linker histone distribution, and the histone methylation status within the lysozyme chromatin domain in lysozyme non-expressing multipotent precursor cells as well as BM2 cells representing monoblast cells, which represent committed macrophage precursor cells. The latter express the lysozyme gene at a low level, can be differentiated into monocytes by treatment with PMA, and can be further differentiated into macrophages by LPS stimulation. Both stimuli are required for maximal lysozyme gene expression. Monomethylation of histone H3K4 in the lysozyme regulatory region is found in undifferentiated monoblasts. Cell differentiation and induced gene expression leads to high levels of H3K4 trimethylation over the coding region. Interestingly, already in lysozyme non-expressing precursor cells histone H1 is depleted at the promoter and is further depleted in a locus-wide fashion in response to PMA, but not LPS treatment. Cell Culture—The chicken monocytic BM2 cell line (16Bagnis C. Cosset F.L. Samarut J. Moscovici G. Moscovici C. Oncogene. 1993; 8: 737-743PubMed Google Scholar), HD50 MEP, and HD37 cells (17Graf T. McNagny K. Brady G. Frampton J. Cell. 1992; 70: 201-213Abstract Full Text PDF PubMed Scopus (106) Google Scholar) were grown in Dulbecco's modified Eagle's medium containing 8% fetal calf serum, 2% chicken serum, 75 μg/ml conalbumin (Sigma), 0.03 units/ml insulin, 10–4m β-mercaptoethanol, 100 units/ml penicillin, and 100 μg/ml streptomycin. When indicated the BM2 cells were stimulated with 50 ng/ml PMA (Sigma) for 48 h and/or 5 μg/ml LPS (Sigma) for 4 h. Reverse Transcription-PCR—Total RNA was prepared using TRIzol (Invitrogen) according to the manufacturer's instructions, and genomic DNA was removed by DNase I treatment. First-strand cDNA synthesis from RNA samples was carried out using oligo(dT)15 primer and Moloney murine leukemia virus reverse transcriptase (Invitrogen) in a reaction volume of 20 μl. PCRs were performed using real-time quantitative PCR (ABI Prism 7700 sequence detection system, PerkinElmer Life Sciences) with SYBR green. Relative expression was calculated as a ratio of lysozyme or gas41 to β-actin. Primers were designed using Primer Express 1.5 software and primer sequences for the different genes are shown in Supplemental Table 2B. In Vivo Footprinting Analysis—In vivo dimethyl sulfate (DMS) treatment was performed by incubating cells in 0.2% DMS in phosphate-buffered saline for 5 min. Cells were washed with phosphate-buffered saline and lysed in lysis buffer (100 mm Tris, pH 8.0, 40 mm EDTA, 2% SDS, 200 μg/ml proteinase K) overnight at room temperature, and genomic DNA was purified by treatment with RNase, organic extractions, and ethanol precipitation. DMS-modified guanines were then cleaved by treatment with piperidine at 0.1 m for 10 min at 90 °C, followed by three lyophilizations in water. DNase I treatment was performed as follows: suspension cells were spun down, whereas the adherent differentiated BM2 cells were first detached with trypsin and resuspended in phosphate-buffered saline containing 0.25 mm phenylmethylsulfonyl fluoride. Cells were subsequently washed with ice-cold ψ buffer (11 mm KPO4, pH 7.4, 108 mm KCl, 22 mm NaCl, 5 mm MgCl2, 1 mm CaCl2, 1 mm dithiothreitol) and resuspended at 108 cells per ml in ψ buffer containing 1 mm ATP. To 100 μl of this cell suspension, 104 μl of ice-cold buffer, consisting of 77% ψ buffer containing 1 mm ATP, 0.38% Nonidet P-40, and various amounts of DNase I (Worthington, Lakewood, NJ) was added. After 6 min at room temperature, the reaction was stopped by the addition of 200 μl of lysis buffer and incubated overnight, and DNA was purified. In vitro DNase I samples were generated by essentially the same procedure on purified genomic DNA, except that lower amounts of DNase I were used and incubation was performed on ice for 3 min. For all samples, 1 μg from DMS-treated DNA and 1.5 μg from DNase I-treated DNA were used for LM-PCR. LM-PCR on DMS-treated and DNase I-treated DNA was performed exactly as described previously (14Lefevre P. Melnik S. Wilson N. Riggs A.D. Bonifer C. Mol. Cell. Biol. 2003; 23: 4386-4400Crossref PubMed Scopus (49) Google Scholar, 15Tagoh H. Melnik S. Lefevre P. Chong S. Riggs A.D. Bonifer C. Blood. 2004; 103: 2950-2955Crossref PubMed Scopus (59) Google Scholar, 18Tagoh H. Himes R. Clarke D. Leenen P.J. Riggs A.D. Hume D. Bonifer C. Genes Dev. 2002; 16: 1721-1737Crossref PubMed Scopus (107) Google Scholar). Briefly, a primer extension reaction with biotinylated primers was carried out using Vent exo-DNA polymerase (New England Biolabs). Primer extension products were then ligated to linker LP25–21, which consists of a 25-mer (GCGGTGACCCGGGAGATCTGAATTC) annealed to a 21-mer (GAATTCAGATCTCCCGGGTCA). After ligation, specific biotinylated products were bound to streptavidin paramagnetic beads (DYNAL) and washed as described by the manufacturer and then subjected to PCR amplification using a nested specific primer and the linker primer (LP25). Primer extension and PCR conditions were optimized for each primer set using a robotic workstation (Biomek 2000, Beckman) and a gradient PCR machine as described in precise detail in a previous study (19Ingram R. Tagoh H. Riggs A.D. Bonifer C. Nucleic Acids Res. 2005; 33: e1Crossref PubMed Scopus (10) Google Scholar). PCR products were labeled by primer extension using γ-32P-labeled nested primers and were analyzed on 6% denaturing polyacrylamide gels. To analyze the lysozyme promoter, LM-PCR was performed using gene-specific nested primers P1–P3 and P351–P353. LM-PCR on MNase-treated material was performed on a robotic workstation as described in detail before (19Ingram R. Tagoh H. Riggs A.D. Bonifer C. Nucleic Acids Res. 2005; 33: e1Crossref PubMed Scopus (10) Google Scholar). Briefly, DNA obtained as input samples for ChIP was phosphorylated with polynucleotide kinase and directly ligated to the linker, LP25–21. Primer extension was performed by using biotinylated gene-specific primers. Primer extension products were bound to magnetic beads and then amplified by LM-PCR as described above. Primers P1–P3 and P351–P353 and β-actin promoter-specific primers are shown in Supplemental Table 2A. Chromatin Immunoprecipitation Assays and Real-time PCR Analysis—Chromatin immunoprecipitation using sonicated material was performed exactly as previously described (14Lefevre P. Melnik S. Wilson N. Riggs A.D. Bonifer C. Mol. Cell. Biol. 2003; 23: 4386-4400Crossref PubMed Scopus (49) Google Scholar). Chromatin immunoprecipitation assays using MNase treated material is described before (20Lefevre P. Bonifer C. Methods Mol. Biol. 2005; (in press)Google Scholar). After preclearing, 50 μl of the chromatin preparation was kept as control (Input), and 500 μl was incubated with 1 mg of rabbit IgG (Upstate Biotechnology, 12-370) to estimate the background level for each amplicon (data not shown), anti-histone H3 C-terminal (Abcam ab1791), anti-histone H3 1me-, 2me-, or 3me-Lys-4 (Abcam ab8895, ab7766, and ab8580), histone H1 (Abcam ab7789–250) or anti-histone H3 1me- or 2me-Lys-9 (Abcam ab9045 and ab7312) antibodies. Primers were designed using Primer Express 1.5 software and tested against a standard curve of sonicated genomic DNA. Primer sequences are shown in Supplemental Table S1. PCR signals from immunoprecipitated material were first calculated in percentage of the Input for all primers. To correct for the variation of the quality of different batches of chromatin from different cells and for varying background signals generated by different antibodies, signals were normalized to those obtained with internal control primers such as the hepatocyte-specific gene VLD-Lapo2 primers or primers specific for the coding region of the β-actin gene. Non-normalized data are shown in Supplemental Fig. S2 for five different primers, including primers specific for the control genes. Maximal Expression of the Chicken Lysozyme Gene Requires Both PMA-mediated Monocytic Differentiation and LPS Signaling—In previous studies we measured transcription factor occupancy and chromatin structure in retrovirally transformed cell lines representing different stages of myeloid differentiation (16Bagnis C. Cosset F.L. Samarut J. Moscovici G. Moscovici C. Oncogene. 1993; 8: 737-743PubMed Google Scholar, 17Graf T. McNagny K. Brady G. Frampton J. Cell. 1992; 70: 201-213Abstract Full Text PDF PubMed Scopus (106) Google Scholar, 21Beug H. von Kirchbach A. Doderlein G. Conscience J.F. Graf T. Cell. 1979; 18: 375-390Abstract Full Text PDF PubMed Scopus (559) Google Scholar) and identified the transcription factors binding to the different cis-regulatory elements by chromatin immunoprecipitation (ChIP) assays and in vivo footprinting experiments. The results of these experiments are summarized in Fig. 1A. Fig. 1B depicts the cell models used in this study. These include multipotent progenitor cells (HD50 MEP) as well as HD37 representing a non-macrophage cell type (erythroblasts). HD50 myl cells represent bi-potent granulocyte-macrophage precursors. BM2 cells are v-myb-transformed committed macrophage precursors (monoblasts). BM2 cells grow in suspension and differentiate into adherent monocytes after treatment with PMA and can be further differentiated to activated macrophages after treatment with LPS. We measured lysozyme and gas41 mRNA expression in the different cell types by real-time PCR (Fig. 1C). gas41 was expressed at low level in all cell types analyzed. In contrast, lysozyme mRNA was not detected in HD37 erythroblasts and HD50 MEP progenitor cells. Un-stimulated BM2 cells showed a low level of expression, which was not significantly increased by treatment with PMA alone, whereas stimulation with LPS alone up-regulated mRNA levels. Treatment with both agonists leads to a synergistic increase in mRNA levels, indicating that both signals are required for high levels of lysozyme gene expression. Developmental Regulation of Histone H3 Lysine 9 and Lysine 4 Methylation Patterns—We next examined the distribution of histone H3K9 methylation and H3K4 methylation across the lysozyme chromatin domain. Using sonicated chromatin, we had previously measured the distribution of Histone H3K9 methylation by ChIP using an antibody that did not distinguish between mono (1me)-, di (2me)-, or tri (3me)-methylated K9. These experiments showed that H3K9 methylation levels were high in HD37 erythroblasts and HD50 MEP progenitor cells, but dramatically decreased in mature macrophages (14Lefevre P. Melnik S. Wilson N. Riggs A.D. Bonifer C. Mol. Cell. Biol. 2003; 23: 4386-4400Crossref PubMed Scopus (49) Google Scholar). Here we asked the question at which stage of macrophage differentiation the H3K9 methyl mark was lost, and we also examined whether H3K9 methylation levels were altered during the differentiation of BM2 monoblasts to activated macrophages. This question is of importance, because the H3K9 methyl mark is very stable (22Bannister A.J. Schneider R. Kouzarides T. Cell. 2002; 109: 801-806Abstract Full Text Full Text PDF PubMed Scopus (426) Google Scholar) and PMA-treated differentiating cells cease proliferating (data not shown). To answer these questions we used antibodies against 1me, 2me, and 3me Lys-9. To increase resolution without having to purify mononucleosomes, we prepared cross-linked chromatin from the indicated cell types (HD37, HD50 MEP, untreated BM2 cells, and BM2 cells treated with LPS, PMA, and PMA plus LPS) and then digested such chromatin preparations with micrococcal nuclease. It has been shown before that this avoids nucleosome movement during the preparation of native chromatin while generating chromatin fragments of mostly nucleosome length (23Fragoso G. Hager G.L. Methods. 1997; 11: 246-252Crossref PubMed Scopus (33) Google Scholar) (an example for such a digestion profile can be seen later in Fig. 5D). To be able to normalize signals and to precisely measure the relative representation of each amplicon, this material (input) was subjected to a real-time PCR analysis using 13 primer pairs across the lysozyme chromatin domain, plus different internal control primers. The results of a ChIP experiment with an antibody against H3 1meK9 are depicted in Fig. 2A and show that histones in the lysozyme cis-regulatory elements have already lost most of the H3 1meK9 mark in undifferentiated BM2 cells. The same results were obtained with an antibody against the H3 2meK9 (data not shown), and methylation levels remained low during further differentiation. Significant histone H3K9 methylation was still observed between cis-elements at all stages of differentiation. We could not detect any H3 3meK9 anywhere across the locus (data not shown). No histone H3K9 methylation was seen at the gas41 CpG island, whereas the histones at the promoter of the liver-specific VLDLapo2 gene, which is inactive in all examined cell types, were highly methylated at H3K9 (Supplemental Fig. S2D).Fig. 2ChIP assay using MNase-treated chromatin and examining histone H3 1meK9 (A), H3 1meK4 (B), and H3 3meK4 (C) status during myeloid differentiation. The top part of the figure presents the map of the lysozyme locus with DNase I-hypersensitive sites in white arrows for the cis-regulatory elements and in black for the constitutive DHS corresponding to the gas41 CpG island. A dotted arrow marks the –7.9-kb constitutive DHS. Amplicons are represented by gray and white rectangles for flanking/coding region and cis-regulatory elements, respectively, with the exception of the silencer element which is shown in black. Each chart contains results obtained with one or two different amplicons and with the cells indicated on the x-axis as HD37 (1), HD50 MEP (2), and BM2 (3), and PMA-treated BM2 (4), LPS-treated BM2 (5) and PMA- and LPS-treated BM2 (6). Data are expressed as precipitate/Input (IP/Input) of test amplicons versus precipitate/input for control amplicons (IPc/Inputc) as outlined under “Experimental Procedures.” The antibody used is indicated on the left. Results represent the average of at least two independent chromatin preparations assayed in triplicate.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We next analyzed H3K4 methylation and performed ChIP assays with antibodies against 1me, 2me, and 3me H3K4. No H3 1meK4 was observed anywhere across clys in lysozyme non-expressing cells (Fig. 2B), but it was present across the entire 5′ regulatory region in lysozyme-expressing cells (even at the far-upstream amplicon at –10 kb), and increased slightly upon cell differentiation. H3 1meK4 levels in the lysozyme coding region were low, and it was absent in the gas41 gene and absent in the 5′ coding region of the β-actin gene (data not shown). H3 2meK4 and 3meK4 patterns were similar to each other, but different to the H3 1meK4 patterns (Fig. 2C). Interestingly, some H3 3meK4 could be found in HD50 MEP cells, but not in HD37 cells, and levels increased during cell differentiation at and in between the cis-elements. H3 3meK4 levels in the coding regions increased parallel to the increase in mRNA levels, which were consistently higher in cells treated with LPS (Fig. 1C). Irrespective of the cell type, H3 3meK4 levels at the gas41 CpG island were significantly higher than in the lysozyme gene and within the lysozyme gene were highest in the coding region. Macrophage Maturation Leads to Site-specific Alterations in Chromatin Architecture and a Gene-wide Depletion of Histone H1—In macrophages, the chicken lysozyme locus is organized in a DNase I-sensitive domain that also harbors the gas41 gene (10Sippel A.E. Schafer G. Faust N. Saueressig H. Hecht A. Bonifer C. Cold Spring Harbor Symp. Quant. Biol. 1993; 58: 37-44Crossref PubMed Scopus (23) Google Scholar). We have previously mapped nucleosome positions at low resolution using micrococcal nuclease digestion and have observed a significant reorganization of nucleosomal architecture at specific cis-regulatory elements after the activation of gene expression (24Huber M.C. Kruger G. Bonifer C. Nucleic Acids Res. 1996; 24: 1443-1452Crossref PubMed Scopus (22) Google Scholar). In the experiments described here we wanted to further investigate this finding and also test whether the increase in general DNase I sensitivity goes along with a loss of the linker histone H1. The results of these experiments are summarized in Fig. 3. In the ChIP experiments described above we noticed that not all amplicons were equally represented in the input fraction, indicating significant differences in MNase accessibility and chromatin architecture across the lysozyme locus. Fig. 3A depicts an analysis of the relative representation of input material of cross-linked and MNase-digested chromatin as measured by real-time PCR. From the results depicted in Fig. 3A it is obvious that sequences within the DNase I-hypersensitive cores of the enhancers and the promoter, but not the flanking or coding regions, were becoming progressively under-represented in the Input material the higher the gene was expressed (compare amplicons depicted in white or black to amplicons depicted in gray). The promoter was highly MNase-sensitive over more than 100 bp as measured by looking at two juxtaposed amplicons (–75 to –156 bp (black) and –190 to –255 bp (white)). Interestingly, this under-representation was not seen at the gas41 CpG island, even though this element harbors a constitutive DHS. Control experiments using amplicons in the inactive VLDLapo2 promoter or the active β-actin gene did not yield differences in relative amplicon representation between cell types (Supplemental Fig. S2A). Because it has been documented that MNase can generate single strand cuts on a nucleosomal template (25Modak S.P. Beard P. Nucleic Acids Res. 1980; 8: 2665-2678Crossref PubMed Scopus (29) Google Scholar), the question arose whether this loss of material in the input fraction was due to an increased accessibility within nucleosomes or to nucleosome loss. To this end, we prepared chromatin by sonication and performed a ChIP assay with an antibody against the C terminus of histone H3 (Fig. 3B). Here, input signals for specific fragments were similar for all cell types (Supplemental Fig. S1). This analysis yielded a different picture to that of MNase-digested chromatin. Progressive and significant nucleosome loss as indicated by a decrease in precipitated chromatin with increased expression level was observed at the –6.1-kb enhancer and the –2.7-kb enhancer. This was less prominent at the other cis-elements or was not observed at all (including the VLDLapo2 promoter (Supplemental Fig. S2B)). Interestingly, although we observed a strong reduction of input signal at the promoter after MNase digestion (Fig. 3A), with the same amplicon no difference in H3 content was observed between cell types. This indicated that, although histone H3 was partly removed from a subset of enhancers, the promoter and other elements retained their nucleosomal structure. The reduction in input signal at these elements therefore had to originate from an enhanced accessibility of these nucleosomes to nuclease digestion. Our analysis of linker histone distribution in the different cells types is described in Fig. 3C. These experiments showed that H1 levels at the gas41 CpG island were consistently low. Except for the far-upstream amplicon, a" @default.
• W2022978842 created "2016-06-24" @default.
• W2022978842 creator A5015648656 @default.
• W2022978842 creator A5017439535 @default.
• W2022978842 creator A5021230921 @default.
• W2022978842 creator A5031320270 @default.
• W2022978842 creator A5036190831 @default.
• W2022978842 creator A5047593916 @default.
• W2022978842 creator A5069764840 @default.
• W2022978842 date "2005-07-01" @default.
• W2022978842 modified "2023-10-17" @default.
• W2022978842 title "Differentiation-dependent Alterations in Histone Methylation and Chromatin Architecture at the Inducible Chicken Lysozyme Gene" @default.
• W2022978842 cites W1858377163 @default.
• W2022978842 cites W1968569217 @default.
• W2022978842 cites W1968902673 @default.
• W2022978842 cites W1974193054 @default.
• W2022978842 cites W1985215036 @default.
• W2022978842 cites W1986592101 @default.
• W2022978842 cites W1992318151 @default.
• W2022978842 cites W1995462644 @default.
• W2022978842 cites W1996270170 @default.
• W2022978842 cites W2002797826 @default.
• W2022978842 cites W2008618369 @default.
• W2022978842 cites W2008913175 @default.
• W2022978842 cites W2012830438 @default.
• W2022978842 cites W2014284275 @default.
• W2022978842 cites W2021292600 @default.
• W2022978842 cites W2021926378 @default.
• W2022978842 cites W2022416772 @default.
• W2022978842 cites W2022936129 @default.
• W2022978842 cites W2029734909 @default.
• W2022978842 cites W2032736838 @default.
• W2022978842 cites W2035348062 @default.
• W2022978842 cites W2048195613 @default.
• W2022978842 cites W2059180250 @default.
• W2022978842 cites W2080354204 @default.
• W2022978842 cites W2086997710 @default.
• W2022978842 cites W2100928698 @default.
• W2022978842 cites W2118240383 @default.
• W2022978842 cites W2128878636 @default.
• W2022978842 cites W2137001129 @default.
• W2022978842 cites W2144076689 @default.
• W2022978842 cites W2151614281 @default.
• W2022978842 cites W2155644156 @default.
• W2022978842 cites W2168639912 @default.
• W2022978842 cites W45123465 @default.
• W2022978842 doi "https://doi.org/10.1074/jbc.m502422200" @default.
• W2022978842 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15923188" @default.
• W2022978842 hasPublicationYear "2005" @default.
• W2022978842 type Work @default.
• W2022978842 sameAs 2022978842 @default.
• W2022978842 citedByCount "37" @default.
• W2022978842 countsByYear W20229788422012 @default.
• W2022978842 countsByYear W20229788422013 @default.
• W2022978842 countsByYear W20229788422014 @default.
• W2022978842 countsByYear W20229788422016 @default.
• W2022978842 countsByYear W20229788422020 @default.
• W2022978842 countsByYear W20229788422022 @default.
• W2022978842 crossrefType "journal-article" @default.
• W2022978842 hasAuthorship W2022978842A5015648656 @default.
• W2022978842 hasAuthorship W2022978842A5017439535 @default.
• W2022978842 hasAuthorship W2022978842A5021230921 @default.
• W2022978842 hasAuthorship W2022978842A5031320270 @default.
• W2022978842 hasAuthorship W2022978842A5036190831 @default.
• W2022978842 hasAuthorship W2022978842A5047593916 @default.
• W2022978842 hasAuthorship W2022978842A5069764840 @default.
• W2022978842 hasBestOaLocation W20229788421 @default.
• W2022978842 hasConcept C104317684 @default.
• W2022978842 hasConcept C153911025 @default.
• W2022978842 hasConcept C185592680 @default.
• W2022978842 hasConcept C2776966407 @default.
• W2022978842 hasConcept C33288867 @default.
• W2022978842 hasConcept C54355233 @default.
• W2022978842 hasConcept C64927066 @default.
• W2022978842 hasConcept C83640560 @default.
• W2022978842 hasConcept C86803240 @default.
• W2022978842 hasConcept C95444343 @default.
• W2022978842 hasConceptScore W2022978842C104317684 @default.
• W2022978842 hasConceptScore W2022978842C153911025 @default.
• W2022978842 hasConceptScore W2022978842C185592680 @default.
• W2022978842 hasConceptScore W2022978842C2776966407 @default.
• W2022978842 hasConceptScore W2022978842C33288867 @default.
• W2022978842 hasConceptScore W2022978842C54355233 @default.
• W2022978842 hasConceptScore W2022978842C64927066 @default.
• W2022978842 hasConceptScore W2022978842C83640560 @default.
• W2022978842 hasConceptScore W2022978842C86803240 @default.
• W2022978842 hasConceptScore W2022978842C95444343 @default.
• W2022978842 hasIssue "30" @default.
• W2022978842 hasLocation W20229788421 @default.
• W2022978842 hasOpenAccess W2022978842 @default.
• W2022978842 hasPrimaryLocation W20229788421 @default.
• W2022978842 hasRelatedWork W1541765418 @default.
• W2022978842 hasRelatedWork W2030159793 @default.
• W2022978842 hasRelatedWork W2067924147 @default.
• W2022978842 hasRelatedWork W2368942211 @default.
• W2022978842 hasRelatedWork W2382247014 @default.
• W2022978842 hasRelatedWork W2413824894 @default.
• W2022978842 hasRelatedWork W2441126129 @default.

• next