FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023082430> ?p ?o ?g. }

• W2023082430 endingPage "3121" @default.
• W2023082430 startingPage "3105" @default.
• W2023082430 abstract "G protein-coupled receptors are one of the largest protein families in nature; however, the mechanisms by which they activate G proteins are still poorly understood. To identify residues on the intracellular face of the human C5a receptor that are involved in G protein activation, we performed a genetic analysis of each of the three intracellular loops and the carboxyl-terminal tail of the receptor. Amino acid substitutions were randomly incorporated into each loop, and functional receptors were identified in yeast. The third intracellular loop contains the largest number of preserved residues (positions resistant to amino acid substitutions), followed by the second loop, the first loop, and lastly the carboxyl terminus. Surprisingly, complete removal of the carboxyl-terminal tail did not impair C5a receptor signaling. When mapped onto a three-dimensional structural model of the inactive state of the C5a receptor, the preserved residues reside on one half of the intracellular surface of the receptor, creating a potential activation face. Together these data provide one of the most comprehensive functional maps of the intracellular surface of any G protein-coupled receptor to date. G protein-coupled receptors are one of the largest protein families in nature; however, the mechanisms by which they activate G proteins are still poorly understood. To identify residues on the intracellular face of the human C5a receptor that are involved in G protein activation, we performed a genetic analysis of each of the three intracellular loops and the carboxyl-terminal tail of the receptor. Amino acid substitutions were randomly incorporated into each loop, and functional receptors were identified in yeast. The third intracellular loop contains the largest number of preserved residues (positions resistant to amino acid substitutions), followed by the second loop, the first loop, and lastly the carboxyl terminus. Surprisingly, complete removal of the carboxyl-terminal tail did not impair C5a receptor signaling. When mapped onto a three-dimensional structural model of the inactive state of the C5a receptor, the preserved residues reside on one half of the intracellular surface of the receptor, creating a potential activation face. Together these data provide one of the most comprehensive functional maps of the intracellular surface of any G protein-coupled receptor to date. G protein-coupled receptors (GPCRs) 2The abbreviations used are: GPCR, G protein-coupled receptor; 3AT, 3-amino-1,2,4-triazole; C5a, complement factor 5a; C5aR, complement factor 5a receptor; CT, carboxyl terminus; CT1, first half of the carboxyl terminus; CT2, second half of the carboxyl terminus; CXCR4, chemokine receptor 4; Endo-Hf, endo-β-N-acetylglucosaminidase H; ER, endoplasmic reticulum; IC1, intracellular loop 1; IC2, intracellular loop 2; IC3, intracellular loop 3; IP3, inositol-1,4,5-triphosphate; m5R, m5 muscarinic acetylcholine receptor; r.m.s.d., root mean square deviation; RSM, random saturation mutagenesis; TM, transmembrane; W5Cha, hexapeptide agonist of the C5a receptor; YFP, yellow fluorescent protein. are seven transmembrane (TM)-spanning proteins that play important roles in many diverse signaling processes, including olfaction, vision, taste, chemotaxis, and yeast cell mating. GPCRs activate signaling cascades by transmitting a signal to heterotrimeric G proteins composed of a Gα, Gβ, and Gγ subunit. Upon ligand binding, the GPCR acts as a guanine nucleotide exchange factor through a conformational change that is transmitted to Gα-GDP, leading to GTP exchange for GDP. Gα-GTP then dissociates from Gβγ, and both Gα-GTP and Gβγ can transmit the signal to downstream effectors such as adenylyl cyclase, phospholipase C, mitogen-activated protein kinases, and ion channels. Activation of these second messengers can lead to a wide variety of physiological responses. GPCRs are one of the largest protein families in nature and are found in nearly all organisms from yeast to human. An estimated 1% of the human genome encodes GPCRs and ∼30% of all pharmaceutical drugs target these receptors (1Miller K.J. Murphy B.J. Pelleymounter M.A. Curr. Drug. Targets CNS Neurol. Disord. 2004; 3: 357-377Crossref PubMed Scopus (15) Google Scholar). The GPCR family of proteins can be divided into three major subgroups based on sequence similarity (2Wess J. Pharmacol. Ther. 1998; 80: 231-264Crossref PubMed Scopus (370) Google Scholar). The largest subgroup is the rhodopsin-like family (class A), whose prototypical member, rhodopsin, is the only GPCR for which a crystal structure has been solved (3Palczewski K. Kumasaka T. Hori T. Behnke C.A. Motoshima H. Fox B.A. Le Trong I. Teller D.C. Okada T. Stenkamp R.E. Yamamoto M. Miyano M. Science. 2000; 289: 739-745Crossref PubMed Scopus (5038) Google Scholar, 4Teller D.C. Okada T. Behnke C.A. Palczewski K. Stenkamp R.E. Biochemistry. 2001; 40: 7761-7772Crossref PubMed Scopus (629) Google Scholar, 5Okada T. Fujiyoshi Y. Silow M. Navarro J. Landau E.M. Shichida Y. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5982-5987Crossref PubMed Scopus (658) Google Scholar, 6Li J. Edwards P.C. Burghammer M. Villa C. Schertler G.F. J. Mol. Biol. 2004; 343: 1409-1438Crossref PubMed Scopus (675) Google Scholar, 7Okada T. Sugihara M. Bondar A.N. Elstner M. Entel P. Buss V. J. Mol. Biol. 2004; 342: 571-583Crossref PubMed Scopus (942) Google Scholar). This family of receptors is distinguished by a set of 20 highly conserved amino acids near the cytoplasmic side of the TM core. The DRY motif, found in this region at the TM3-second intracellular loop junction, is essential for G protein activation (8Franke R.R. Sakmar T.P. Graham R.M. Khorana H.G. J. Biol. Chem. 1992; 267: 14767-14774Abstract Full Text PDF PubMed Google Scholar, 9Ernst O.P. Hofmann K.P. Sakmar T.P. J. Biol. Chem. 1995; 270: 10580-10586Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 10Acharya S. Karnik S.S. J. Biol. Chem. 1996; 271: 25406-25411Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). The intracellular and extracellular loop regions of GPCRs within the same family contain the most sequence diversity. The extracellular loops presumably require distinct sequences to accommodate a diverse set of ligands. However, the reason for the lack of homology among intracellular loops of receptors that couple to similar G proteins, and presumably activate them through a similar mechanism, is less clear. This lack of homology makes it extremely difficult to use bioinformatics to predict residues required for signaling as well as the G protein(s) to which a given receptor may couple. Thus, a large scale genetic approach is necessary to understand G protein coupling and activation. Despite intense focus on GPCRs it is still not known how they dock to G proteins and catalyze the exchange of GTP for GDP. A wide variety of techniques have been applied to the study of how GPCRs function as receptor switches for G protein binding and activation. These include peptide competition (11Konig B. Arendt A. McDowell J.H. Kahlert M. Hargrave P.A. Hofmann K.P. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 6878-6882Crossref PubMed Scopus (340) Google Scholar), cysteine or alanine scanning mutagenesis (12Ridge K.D. Zhang C. Khorana H.G. Biochemistry. 1995; 34: 8804-8811Crossref PubMed Scopus (40) Google Scholar, 13Farahbakhsh Z.T. Ridge K.D. Khorana H.G. Hubbell W.L. Biochemistry. 1995; 34: 8812-8819Crossref PubMed Scopus (186) Google Scholar, 14Yang K. Farrens D.L. Hubbell W.L. Khorana H.G. Biochemistry. 1996; 35: 12464-12469Crossref PubMed Scopus (97) Google Scholar, 15Cai K. Klein-Seetharaman J. Farrens D. Zhang C. Altenbach C. Hubbell W.L. Khorana H.G. Biochemistry. 1999; 38: 7925-7930Crossref PubMed Scopus (81) Google Scholar, 16Klein-Seetharaman J. Hwa J. Cai K. Altenbach C. Hubbell W.L. Khorana H.G. Biochemistry. 1999; 38: 7938-7944Crossref PubMed Scopus (67) Google Scholar, 17Natochin M. Gasimov K.G. Moussaif M. Artemyev N.O. J. Biol. Chem. 2003; 278: 37574-37581Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 18Conner A.C. Simms J. Howitt S.G. Wheatley M. Poyner D.R. J. Biol. Chem. 2006; 281: 1644-1651Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar), deletion mapping (8Franke R.R. Sakmar T.P. Graham R.M. Khorana H.G. J. Biol. Chem. 1992; 267: 14767-14774Abstract Full Text PDF PubMed Google Scholar), cross-linking (19Cai K. Itoh Y. Khorana H.G. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4877-4882Crossref PubMed Scopus (137) Google Scholar, 20Itoh Y. Cai K. Khorana H.G. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4883-4887Crossref PubMed Scopus (102) Google Scholar), intracellular loop swapping experiments (21Liu J. Conklin B.R. Blin N. Yun J. Wess J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11642-11646Crossref PubMed Scopus (198) Google Scholar, 22Liu J. Wess J. J. Biol. Chem. 1996; 271: 8772-8778Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar, 23Erlenbach I. Wess J. J. Biol. Chem. 1998; 273: 26549-26558Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 24Kim J.M. Hwa J. Garriga P. Reeves P.J. RajBhandary U.L. Khorana H.G. Biochemistry. 2005; 44: 2284-2292Crossref PubMed Scopus (130) Google Scholar), and random saturation mutagenesis targeting single intracellular loops (25Burstein E.S. Spalding T.A. Hill-Eubanks D. Brann M.R. J. Biol. Chem. 1995; 270: 3141-3146Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 26Hill-Eubanks D. Burstein E.S. Spalding T.A. Brauner-Osborne H. Brann M.R. J. Biol. Chem. 1996; 271: 3058-3065Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 27Burstein E.S. Spalding T.A. Brann M.R. J. Biol. Chem. 1998; 273: 24322-24327Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar, 28Erlenbach I. Kostenis E. Schmidt C. Serradeil-Le Gal C. Raufaste D. Dumont M.E. Pausch M.H. Wess J. J. Biol. Chem. 2001; 276: 29382-29392Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Although results differ depending on which GPCR is studied, the consensus is that intracellular loops 2 and 3 (IC2 and IC3) are critical for signaling and that the DRY motif of rhodopsin-like receptors is essential (8Franke R.R. Sakmar T.P. Graham R.M. Khorana H.G. J. Biol. Chem. 1992; 267: 14767-14774Abstract Full Text PDF PubMed Google Scholar, 9Ernst O.P. Hofmann K.P. Sakmar T.P. J. Biol. Chem. 1995; 270: 10580-10586Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 10Acharya S. Karnik S.S. J. Biol. Chem. 1996; 271: 25406-25411Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). To gain a more comprehensive understanding of the intracellular structural determinants that mediate GPCR signaling, we performed random saturation mutagenesis (RSM) screens targeting each of the individual intracellular loops (IC1, IC2, and IC3) as well as the carboxyl terminus (CT) of the human C5a receptor (C5aR). The C5aR, a member of the rhodopsinlike family, binds the 74-amino acid complement-derived C5a peptide and is involved in chemotaxis and activation of leukocytes. The C5aR exhibits 20% sequence identity and 35% sequence homology with bovine rhodopsin and has similarly sized loop regions, indicating that it may adopt a similar structure. We have previously used RSM to identify functional residues in the C5aR extracellular loops (29Klco J.M. Wiegand C.B. Narzinski K. Baranski T.J. Nat. Struct. Mol. Biol. 2005; 12: 320-326Crossref PubMed Scopus (137) Google Scholar, 30Klco J.M. Nikiforovich G.V. Baranski T.J. J. Biol. Chem. 2006; 281: 12010-12019Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 31Hagemann I.S. Narzinski K.D. Floyd D.H. Baranski T.J. J. Biol. Chem. 2006; 281: 36783-36792Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar) and TM regions (32Baranski T.J. Herzmark P. Lichtarge O. Gerber B.O. Trueheart J. Meng E.C. Iiri T. Sheikh S.P. Bourne H.R. J. Biol. Chem. 1999; 274: 15757-15765Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 33Geva A. Lassere T.B. Lichtarge O. Pollitt S.K. Baranski T.J. J. Biol. Chem. 2000; 275: 35393-35401Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). RSM is a powerful structure-function analysis tool, because it introduces many unbiased amino acid substitutions and allows one to infer the relative importance of each residue within a region judged by the ability of that position to tolerate mutations. This study provides one of the most comprehensive functional maps of the intracellular face of any GPCR. In addition, these data, combined with our previous RSM screens of the extracellular loops (29Klco J.M. Wiegand C.B. Narzinski K. Baranski T.J. Nat. Struct. Mol. Biol. 2005; 12: 320-326Crossref PubMed Scopus (137) Google Scholar, 30Klco J.M. Nikiforovich G.V. Baranski T.J. J. Biol. Chem. 2006; 281: 12010-12019Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 31Hagemann I.S. Narzinski K.D. Floyd D.H. Baranski T.J. J. Biol. Chem. 2006; 281: 36783-36792Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar) and the TM regions (32Baranski T.J. Herzmark P. Lichtarge O. Gerber B.O. Trueheart J. Meng E.C. Iiri T. Sheikh S.P. Bourne H.R. J. Biol. Chem. 1999; 274: 15757-15765Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 33Geva A. Lassere T.B. Lichtarge O. Pollitt S.K. Baranski T.J. J. Biol. Chem. 2000; 275: 35393-35401Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar), gives a broad view of residues critical for signaling of the C5aR. Library Construction and Site-directed Mutagenesis—Silent restriction sites were engineered at the approximate boundaries of the intracellular loops IC1 (MluI and NdeI), IC2 (PstI and SfiI), or IC3 (BspEI and HindIII) of the C5aR ORF cloned into the pBS-SK Bluescript vector. The carboxyl terminus was divided into two regions, CT1 (FseI and BspEI) and CT2 (BspEI and XbaI), because of its large size. To prevent contamination by wild-type receptor in the libraries, a piece of non-receptor DNA was inserted between MluI and NdeI for IC1 and PstI and SfiI for IC2, and premature stop codons were inserted into the IC3 loop and the CT1 and CT2 regions. The following oligonucleotides were used (Integrated DNA Technologies, Coralville, IA), where the underlined region denotes bases randomly doped at a 20% non-wild-type nucleotide substitution rate: IC1, 5′-TATAACGCGTTGGTTGTTTGGGTTACTGCTTTTGAAGCTAAAAGAACTATTAATGCCATATGG-3′; IC2, 5′-TATACTGCAGATCGTTTTCTACTAGTTTTTAAACCAATTTGGTGTCAAAATTTTCGTGGGGCCGGCTTGGCCAAG-3′; IC3, 5′-TATATCCGGACTTGGTCTAGAAGAGCTACTAGATCTACTAAAACTTTGAAAGTTGTTGTTGCTGTTGTTGCAAGCTTG-3′; CT1, 5′-ATAGTGGCCGGCCAAGGTTTTCAAGGTAGATTGAGAAAATCTTTGCCATCTTTGCTCCGGAG-3′; and CT2, 5′-ATACTCCGGAATGTTTTGACTGAAGAATCTGTTGTTAGAGAATCTAAATCTTTTACTAGATCTACTGTTGATACTATGGCTCAAAAAACTCAAGCTGTCTAGACA-3′. Oligonucleotides were mutually primed by palendromic sequences at their 3′-ends, and complementary sequences were generated by Klenow extension. The double-stranded regions were then cut with the appropriate restriction enzymes and subcloned into the C5aR gene in the pBS-SK Bluescript vector. The complexity and quality of the libraries were then determined by sequencing ten unselected receptors. The mutant receptors were subsequently subcloned into an ADE2 yeast expression vector. Single point mutations were made by designing complementary oligonucleotides encoding the desired mutation. A two-step PCR strategy was used to introduce the point mutation into the wild-type C5aR coding sequence in an ADE2 yeast expression vector. YFP-tagged receptors were made by subcloning point mutations into a C5aR-YFP fusion construct containing YFP at the carboxyl terminus. All point mutations were confirmed by sequencing at the Washington University Protein and Nucleic Acid Chemistry Laboratory. The RGS4 plasmid was a gift from Dr. Maurine Linder. Yeast Strains—The Saccharomyces cerevisiae strain BY1142 has been previously described (32Baranski T.J. Herzmark P. Lichtarge O. Gerber B.O. Trueheart J. Meng E.C. Iiri T. Sheikh S.P. Bourne H.R. J. Biol. Chem. 1999; 274: 15757-15765Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Briefly, the genotype is MATα far1Δ1442 tbt1-1 fus1::PFUS1-HIS3 can1 ste14:: trp1::LYS2 ste3Δ1156 gpa1 (41)-Gαi3 lys2 ura3 leu2 trp1 his3 ade2. This strain, modified from CY1141 (34Klein C. Paul J.I. Sauve K. Schmidt M.M. Arcangeli L. Ransom J. Trueheart J. Manfredi J.P. Broach J.R. Murphy A.J. Nat. Biotechnol. 1998; 16: 1334-1337Crossref PubMed Scopus (130) Google Scholar), expresses a fusion of the amino-terminal 41 amino acids of the yeast Gα protein, Gpa1, followed by residues 34–354 of human Gαi3. Activation of the C5aR leads to signaling through the mitogen-activated protein kinase cascade and expression of the PFUS1-HIS3 reporter gene, allowing the yeast to grow in the absence of histidine. The BY1143 strain was created by transforming the BY1142 strain with a URA3 plasmid encoding C5a (pBN444) as previously described (29Klco J.M. Wiegand C.B. Narzinski K. Baranski T.J. Nat. Struct. Mol. Biol. 2005; 12: 320-326Crossref PubMed Scopus (137) Google Scholar, 32Baranski T.J. Herzmark P. Lichtarge O. Gerber B.O. Trueheart J. Meng E.C. Iiri T. Sheikh S.P. Bourne H.R. J. Biol. Chem. 1999; 274: 15757-15765Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). The BY1144 strain was created by transforming the BY1142 strain with an empty URA3 vector (pBN443). BY1173 has the genotype MATa ura3 leu2 trp1 his3 can1 gpa1Δ::ade2Δ::3XHA far1Δ::ura3Δ fus1Δ::PFUS1-HIS3 LEU2::PFUS1-lacZ sst2Δ::ura3Δ ste2Δ::G418R trp1::GPA1/Gαi3 and has been previously described (35Brown A.J. Dyos S.L. Whiteway M.S. White J.H. Watson M.A. Marzioch M. Clare J.J. Cousens D.J. Paddon C. Plumpton C. Romanos M.A. Dowell S.J. Yeast. 2000; 16: 11-22Crossref PubMed Scopus (151) Google Scholar). BY1173 contains a fusion of amino acids 1–467 of the yeast Gα protein, Gpa1, followed by the last 5 amino acids of human Gαi3. Activation of the C5aR leads to expression of a PFUS1-β-galactosidase reporter gene. Yeast Transformation and Functional Receptor Selection— Yeast transformations were done according to standard lithium acetate or electroporation protocols. Mutant receptors were screened by transforming BY1143 with the various ADE2 mutant libraries and plating on non-selective medium for 1 day. Functional receptors were then selected by replica plating onto histidine-deficient medium containing either 5 mm 3-amino-1,2,4-triazole (3AT) (Sigma) for IC1, IC2, and IC3 or 100 mm 3AT for the CT1 and CT2 libraries. The higher concentration of 3AT was used for the carboxyl terminus to try to isolate receptors that signal at a high level, because many mutations were tolerated in this region. Receptor-encoding plasmids were recovered from the yeast and retested for signaling by retransforming into BY1143. Approximately 30 functional receptors were selected in each screen, because this number has been shown to be sufficient to determine critical residues (29Klco J.M. Wiegand C.B. Narzinski K. Baranski T.J. Nat. Struct. Mol. Biol. 2005; 12: 320-326Crossref PubMed Scopus (137) Google Scholar, 30Klco J.M. Nikiforovich G.V. Baranski T.J. J. Biol. Chem. 2006; 281: 12010-12019Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 32Baranski T.J. Herzmark P. Lichtarge O. Gerber B.O. Trueheart J. Meng E.C. Iiri T. Sheikh S.P. Bourne H.R. J. Biol. Chem. 1999; 274: 15757-15765Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 33Geva A. Lassere T.B. Lichtarge O. Pollitt S.K. Baranski T.J. J. Biol. Chem. 2000; 275: 35393-35401Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Relative signaling abilities were assayed by restreaking three transformants of each mutant onto histidine-deficient medium containing varying amounts of 3AT (0, 1, 5, 10, 20, and 50 mm). Signaling levels were compared with wild-type C5aR expressed from an ADE2 plasmid, pBN482 (grows on up to 5 mm 3AT), and a non-functional mutant C5aR containing a stop codon in TM3, pBN483 (does not grow on 1 mm 3AT), which were previously described (32Baranski T.J. Herzmark P. Lichtarge O. Gerber B.O. Trueheart J. Meng E.C. Iiri T. Sheikh S.P. Bourne H.R. J. Biol. Chem. 1999; 274: 15757-15765Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 33Geva A. Lassere T.B. Lichtarge O. Pollitt S.K. Baranski T.J. J. Biol. Chem. 2000; 275: 35393-35401Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Growth in the absence of histidine was inferred to be dependent on C5aR signaling based on colony color (red colonies lack the C5aR ADE2 plasmid). Plasmids encoding functional receptors were sequenced at the Washington University Protein and Nucleic Acid Chemistry Laboratory. All functional mutants were assessed for constitutive activity by expressing them in BY1144, which lacks a ligand, and replica plating on varying amounts of 3AT (0, 1, 5, 10, 20, and 50 mm). Receptor Expression Levels—Expression levels of RSM mutants and single point mutants were determined by Western blot. Overnight cultures of yeast carrying an empty ADE2 vector, or pBN482 encoding the wild-type C5aR, or plasmids encoding mutants were grown in liquid synthetic dropout medium-Ade. The A600 was determined and cultures were adjusted to A600 = 10.0. Cells harvested from 1 ml of adjusted cultures were lysed in 200 μl of 1 × sample buffer (50 mm Tris-Cl, pH 6.8, 2% SDS, 10% glycerol supplemented with 2% β-mercaptoethanol, 1 μg/ml leupeptin, 1 μg/ml aprotinin, and 500 μm phenylmethylsulfonyl fluoride) with glass beads by vortexing for 5 min at room temperature. Lysates were heated for 5 min at 50 °C. 25 μl of each lysate was resolved on a 12% SDS-PAGE gel, transferred to polyvinylidene difluoride, and immunoblotted with a rabbit polyclonal anti-C5aR antibody raised against residues 9–29 of the amino terminus. Blots of YFP-tagged receptors were immunoblotted instead with a rabbit polyclonal anti-GFP antibody (Santa Cruz Biotechnology, Santa Cruz, CA). All blots were then stripped in 0.2 n NaOH for 15 min at room temperature, washed, and probed with a mouse monoclonal anti-β-actin antibody (AbCam) as a loading control. Fluorescent Microscopy—BY1142-expressing YFP-tagged receptors was grown in liquid culture overnight, and live yeast were placed on a microscope slide. Images were recorded using a Zeiss color AxioCam HRc mounted on a Zeiss Axioscope microscope equipped with a Zeiss CP-Achromat 100× objective using a standard fluorescein isothiocyanate filter set. β-Galactosidase Assays—BY1173 was transformed with wild-type or single point mutant receptors and treated with a range of concentrations (10-10 m to 10-5 m) of the C5aR hexapeptide agonist W5Cha (Genscript), which unlike C5a can cross the yeast cell wall. Three independent transformants were used for each receptor, and assays were performed in triplicate as previously described (29Klco J.M. Wiegand C.B. Narzinski K. Baranski T.J. Nat. Struct. Mol. Biol. 2005; 12: 320-326Crossref PubMed Scopus (137) Google Scholar). Endo-β-N-acetylglucosaminidase Treatment and Western Blots—Single point mutants that showed impaired signaling in the yeast system were subcloned into pcDNA3.1(+) (Invitrogen) and transiently transfected into HEK293 cells by standard calcium phosphate methods. Cells were lysed 2 days after transfection in 250 μl of 1 × sample buffer (50 mm Tris-Cl, pH 6.8, 2% SDS, 10% glycerol) supplemented with 2% β-mercaptoethanol, 1 μg/ml leupeptin, 1 μg/ml aprotinin, and 500 μm phenylmethylsulfonyl fluoride by shearing through a 27-gauge syringe. Lysates were heated for 5 min at 50 °C. 27 μl of each lysate was treated with 1000 units of endo-β-N-acetylglucosaminidase H-maltose-binding protein fusion (Endo-Hf, New England Biolabs) at 37 °C for 3 h. Samples were heated for 5 min at 50 °C, resolved on a 12% SDS-PAGE gel, transferred to polyvinylidene difluoride, and immunoblotted with a rabbit polyclonal anti-C5aR antibody raised against residues 9–29 of the amino terminus. Blots were then stripped in 0.2 n NaOH for 15 min at room temperature, washed, and probed with a mouse monoclonal anti-β-actin antibody (AbCam) as a loading control. Inositol 1,4,5-Triphosphate Accumulation—Single point mutants in pcDNA3.1(+) (Invitrogen) and human Gα16 in pcDNA3.1(+) were transiently co-transfected into HEK293 cells. Cells were treated with 0.1 μm or 1 μm W5Cha (GenScript) or no ligand, and IP3 levels were measured as previously described (29Klco J.M. Wiegand C.B. Narzinski K. Baranski T.J. Nat. Struct. Mol. Biol. 2005; 12: 320-326Crossref PubMed Scopus (137) Google Scholar). Statistical significance was determined using a one-way analysis of variance test with Dunnett's post test and a 95% confidence level (GraphPad). Molecular Modeling—Generally, molecular modeling procedures were as described earlier (36Nikiforovich G.V. Marshall G.R. Biophys. J. 2005; 89: 3780-3789Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). All loops were mounted on the “template,” i.e. on a three-dimensional structure of the TM region of C5aR based on the x-ray structure of rhodopsin (PDB entry 1F88). TM helical fragments of C5aR were defined by sequence homology to the rhodopsin helices found by the ClustalW procedure (ca.expasy.org/tools) as follows: TM1, Ile38–Val50–Ala63 (the first, middle, and last residues, respectively); TM2, Asn71–Leu84–Gln98; TM3, Ala107–Ala122–Val138; TM4, Ala150–Trp161–Phe172; TM5, Glu199–Phe211–Phe224; TM6, Arg236–Phe251–Phe267; and TM7, Leu281–Tyr290–Tyr300. The helical fragments were assembled into a TM helical bundle by following the procedure of “enhanced homology modeling” previously described in detail (37Nikiforovich G.V. Marshall G.R. Biochemistry. 2003; 42: 9110-9120Crossref PubMed Scopus (44) Google Scholar, 38Nikiforovich G.V. Mihalik B. Catt K.J. Marshall G.R. J. Pept. Res. 2005; 66: 236-248Crossref PubMed Scopus (25) Google Scholar). All energy calculations were performed using the ECEPP/2 force field with rigid valence geometry (39Dunfield L.G. Burgess A.W. Scheraga H.A. J. Phys. Chem. 1978; 82: 2609-2616Crossref Scopus (180) Google Scholar, 40Nemethy G. Pottle M.S. Scheraga H.A. J. Phys. Chem. 1983; 87: 1883-1887Crossref Scopus (923) Google Scholar). Only trans conformations of Pro residues were considered, and residues Arg, Lys, Glu, and Asp were present as charged species. Geometrical sampling of the individual loops was performed from the smallest loop to the largest, i.e. from IC1 to IC2 to IC3. As soon as the resulting structures of the smaller loops were selected, the loop structure closest to the average spatial positions of the Cα atoms was included in the template, providing additional geometrical limitations for the larger loops. The sampling was, basically, a stepwise elongation of the loop covering all combinations of the possible backbone conformations for the stepwise growing loops, i.e. fragments 63–71 (IC1), 138–150 (IC2), 224–236 (IC3), and 300–310, the latter fragment representing the “minimal-length” carboxyl terminus as was found by the carboxyl-terminal screen (Fig. 6). Starting conformations of individual residues and overall sampling procedure were as described earlier (36Nikiforovich G.V. Marshall G.R. Biophys. J. 2005; 89: 3780-3789Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar) with limitations on the residue-residue contacts within the loop (Cα–Cα distances ≥4 Å), on the contacts between the loop and the template (Cα–Cα distances ≥6 Å); the values of coefficients EL and DEL were 3.0 and 0.0, respectively (see Ref. 36Nikiforovich G.V. Marshall G.R. Biophys. J. 2005; 89: 3780-3789Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). Elongation steps were as follows: a single step from residue 60 to residue 74 for IC1; from 138 to 146 to 148 to 150 for IC2, from 224 to 232 to 234 to 236 for IC3, and from 300 to 310 for the last fragment. After geometrical sampling selected all potentially loop-closing conformations for a specific loop, the selected structures were subjected to energy minimization employing the ECEPP/2 force field; the dielectric constant was set at 80 to mimic to some extent the water environment of the protruding loops. All parameters employed for energy minimization were as described previously (36Nikiforovich G.V. Marshall G.R. Biophys. J. 2005; 89: 3780-3789Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). Energy calculations yielded 23 low energy structures (those with relative energy ΔE = E - Emin ≤ 10 kcal/mol), which formed a single cluster of similar structures (defined by an r.m.s.d. value of ≤2 Å, Cα atoms only) for IC1; 90 structures within ΔE ≤ 18 kcal/mol falling into 21 different clusters for IC2; 25 structures within ΔE ≤ 12 kcal/mol falling into 3 different clusters for IC3; and 3 clusters for possible spatial arrangements of fragment 300–310. The elevated energy cut-off for IC2 was used to compensate for an energy gap of ∼6 kcal/mol between the lowest energy structure and the second lowest energy one, which otherwise might cause a drastic decrease of the number of selected low energy conformations. The lowest energy conformers in each cluster were selected as representatives for further consideration in the intracellular package comprising all combinations of conformations for IC1 + IC2 + IC3 + fragment 300–310 (189 combinations). Then, for all combinations of representatives, energy calculations were performed with the same limitations as those described earlier (36Nikiforovich G.V. Marshall G.R. Biophys. J. 2005; 89: 3780-3789Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). Fifty-six combinations were finally selected by an energy cut-off of 30 kcal/mol; they were div" @default.
• W2023082430 created "2016-06-24" @default.
• W2023082430 creator A5053115082 @default.
• W2023082430 creator A5061557305 @default.
• W2023082430 creator A5081155797 @default.
• W2023082430 creator A5087744497 @default.
• W2023082430 creator A5088294618 @default.
• W2023082430 date "2007-02-01" @default.
• W2023082430 modified "2023-10-03" @default.
• W2023082430 title "A Comprehensive Structure-Function Map of the Intracellular Surface of the Human C5a Receptor" @default.
• W2023082430 cites W1482237901 @default.
• W2023082430 cites W1485119817 @default.
• W2023082430 cites W1527823690 @default.
• W2023082430 cites W1541841154 @default.
• W2023082430 cites W1562323727 @default.
• W2023082430 cites W1569349971 @default.
• W2023082430 cites W1571589296 @default.
• W2023082430 cites W1579091371 @default.
• W2023082430 cites W1590595627 @default.
• W2023082430 cites W1681309649 @default.
• W2023082430 cites W1769081962 @default.
• W2023082430 cites W1904288160 @default.
• W2023082430 cites W1963523454 @default.
• W2023082430 cites W1967562709 @default.
• W2023082430 cites W1969077273 @default.
• W2023082430 cites W1980058356 @default.
• W2023082430 cites W1981493123 @default.
• W2023082430 cites W1983501707 @default.
• W2023082430 cites W1987771931 @default.
• W2023082430 cites W1990110274 @default.
• W2023082430 cites W1991977222 @default.
• W2023082430 cites W1993343824 @default.
• W2023082430 cites W1993346410 @default.
• W2023082430 cites W1994941602 @default.
• W2023082430 cites W2001130582 @default.
• W2023082430 cites W2001647007 @default.
• W2023082430 cites W2002232559 @default.
• W2023082430 cites W2006740795 @default.
• W2023082430 cites W2013230660 @default.
• W2023082430 cites W2013289991 @default.
• W2023082430 cites W2016172145 @default.
• W2023082430 cites W2016441306 @default.
• W2023082430 cites W2017969722 @default.
• W2023082430 cites W2019742616 @default.
• W2023082430 cites W2026357130 @default.
• W2023082430 cites W2038422963 @default.
• W2023082430 cites W2040310721 @default.
• W2023082430 cites W2043890981 @default.
• W2023082430 cites W2044835337 @default.
• W2023082430 cites W2045109604 @default.
• W2023082430 cites W2045439263 @default.
• W2023082430 cites W2046271055 @default.
• W2023082430 cites W2047053748 @default.
• W2023082430 cites W2049132647 @default.
• W2023082430 cites W2050218326 @default.
• W2023082430 cites W2059751684 @default.
• W2023082430 cites W2063588043 @default.
• W2023082430 cites W2069865904 @default.
• W2023082430 cites W2072353408 @default.
• W2023082430 cites W2072479057 @default.
• W2023082430 cites W2073690777 @default.
• W2023082430 cites W2075415414 @default.
• W2023082430 cites W2078899688 @default.
• W2023082430 cites W2080210935 @default.
• W2023082430 cites W2080273350 @default.
• W2023082430 cites W2083637735 @default.
• W2023082430 cites W2086840187 @default.
• W2023082430 cites W2088667287 @default.
• W2023082430 cites W2091886761 @default.
• W2023082430 cites W2092881720 @default.
• W2023082430 cites W2093562851 @default.
• W2023082430 cites W2097365951 @default.
• W2023082430 cites W2097948220 @default.
• W2023082430 cites W2103908315 @default.
• W2023082430 cites W2120684043 @default.
• W2023082430 cites W2122073716 @default.
• W2023082430 cites W2124961362 @default.
• W2023082430 cites W2133524076 @default.
• W2023082430 cites W2135689740 @default.
• W2023082430 cites W2137588110 @default.
• W2023082430 cites W2143197682 @default.
• W2023082430 cites W2149063573 @default.
• W2023082430 cites W2149963584 @default.
• W2023082430 cites W2156070415 @default.
• W2023082430 cites W2159298385 @default.
• W2023082430 cites W2163865126 @default.
• W2023082430 cites W2169295770 @default.
• W2023082430 cites W2170672524 @default.
• W2023082430 cites W2217392873 @default.
• W2023082430 cites W2414461651 @default.
• W2023082430 doi "https://doi.org/10.1074/jbc.m607679200" @default.
• W2023082430 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17135254" @default.
• W2023082430 hasPublicationYear "2007" @default.
• W2023082430 type Work @default.
• W2023082430 sameAs 2023082430 @default.
• W2023082430 citedByCount "16" @default.
• W2023082430 countsByYear W20230824302012 @default.
• W2023082430 countsByYear W20230824302013 @default.

• next