FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023144832> ?p ?o ?g. }

• W2023144832 endingPage "3816" @default.
• W2023144832 startingPage "3808" @default.
• W2023144832 abstract "Human immunodeficiency virus reverse transcribes its single-stranded RNA genome making a DNA copy. As synthesis proceeds, the RNA is simultaneously degraded to oligomers; one of these, the polypurine tract, primes synthesis of a plus strand DNA. The viral reverse transcriptase (RT) degrades all of the non-polypurine tract oligomers. We show that unlike other DNA polymerases the retroviral RT can bind either end of an annealed RNA primer, the 5′-end for degradation and the 3′-end for synthesis. The competition between the two binding modes at any primer determines whether it will be extended or degraded. The 5′-end binding can be suppressed in at least two ways. The sequence of the primer can be such that a region at the 5′-end is unannealed or a DNA primer can be annealed just adjacent to the 5′-end of the RNA primer. This promotes binding of RT to the RNA 3′-end, allowing a primer that would normally be degraded to be extended. Implications for human immunodeficiency virus replication and antiviral therapy are discussed. Human immunodeficiency virus reverse transcribes its single-stranded RNA genome making a DNA copy. As synthesis proceeds, the RNA is simultaneously degraded to oligomers; one of these, the polypurine tract, primes synthesis of a plus strand DNA. The viral reverse transcriptase (RT) degrades all of the non-polypurine tract oligomers. We show that unlike other DNA polymerases the retroviral RT can bind either end of an annealed RNA primer, the 5′-end for degradation and the 3′-end for synthesis. The competition between the two binding modes at any primer determines whether it will be extended or degraded. The 5′-end binding can be suppressed in at least two ways. The sequence of the primer can be such that a region at the 5′-end is unannealed or a DNA primer can be annealed just adjacent to the 5′-end of the RNA primer. This promotes binding of RT to the RNA 3′-end, allowing a primer that would normally be degraded to be extended. Implications for human immunodeficiency virus replication and antiviral therapy are discussed. Reverse transcriptase (RT) 1The abbreviations used are: RT, reverse transcriptase; HIV, human immunodeficiency virus; PPT, polypurine tract; cPPT, central polypurine tract; nt, nucleotide(s); wt, wild type. catalyzes the conversion of retroviral single-stranded genomic RNA to double-stranded DNA following entry of the virus into the cytoplasm of the host cell. RT is a multifunctional enzyme that displays DNA polymerase activity on both RNA and DNA templates, RNase H, strand displacement, and strand transfer functions, which are all essential steps in viral replication (1Telesnitsky A. Goff S.P. Skalka A.M. Goff S.P. Reverse Transcriptase. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1993: 49-83Google Scholar). Minus strand DNA synthesis is initiated from a cellular tRNA primer packaged within the virion (for a review see Ref. 2Litvak S. Litvak S. Retroviral Reverse Transcriptase. Chapman and Hall, New York1996: 83-114Google Scholar). DNA synthesis is accompanied by the cleavage of genomic RNA by the RT-RNase H. A critical component of retroviral replication is the creation and extension of a polypurine-rich genomic RNA fragment, the polypurine tract (PPT), that primes plus strand DNA synthesis (3Champoux J.J. Skalka A.M. Goff S.P. Reverse Transcriptase. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1993: 103-117Google Scholar). According to the model of reverse transcription for viral replication, the proper utilization and precise removal of both minus strand and plus strand RNA primers are vital for the creation of the proper length terminal repeat ends required for proviral integration (4Gilboa G.M. Mitra S.W. Goff S. Baltimore D. Cell. 1979; 18: 93-100Abstract Full Text PDF PubMed Scopus (421) Google Scholar, 5Whitcomb J.M. Hughes S.H. Annu. Rev. Cell Biol. 1992; 8: 275-306Crossref PubMed Scopus (189) Google Scholar). Cuts are made in the HIV-1 genomic RNA during minus strand synthesis, while the polymerization active site of the RT is bound to the 3′-end of the growing DNA primer as shown in Fig. 1 A (6Gopalakrishnan V. Peliska J.A. Benkovic S.J. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 10763-10767Crossref PubMed Scopus (173) Google Scholar, 7Furfine E.S. Reardon J.E. J. Biol. Chem. 1991; 266: 406-412Abstract Full Text PDF PubMed Google Scholar, 8Mizrahi V. Biochemistry. 1989; 28: 9088-9094Crossref PubMed Scopus (23) Google Scholar, 9Palaniappan C. Fuentes G.M. Rodriguez-Rodriguez L. Fay P.J. Bambara R.A. J. Biol. Chem. 1996; 271: 2063-2070Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 10DeStefano J.J. Nucleic Acids Res. 1995; 23: 3901-3908Crossref PubMed Scopus (39) Google Scholar, 11DeStefano J.J. Mallaber L.M. Fay P.J. Bambara R.A. Nucleic Acids Res. 1993; 21: 4330-4338Crossref PubMed Scopus (78) Google Scholar, 12DeStefano J.J. Buiser R.G. Mallaber L.M. Bambara R.A. Fay P.J. J. Biol. Chem. 1991; 266: 24295-24301Abstract Full Text PDF PubMed Google Scholar). This has been termed the DNA polymerase-dependent mode of cleavage (6Gopalakrishnan V. Peliska J.A. Benkovic S.J. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 10763-10767Crossref PubMed Scopus (173) Google Scholar, 7Furfine E.S. Reardon J.E. J. Biol. Chem. 1991; 266: 406-412Abstract Full Text PDF PubMed Google Scholar). The polymerase and RNase H activities are not totally coupled during this process (13DeStefano J.J. Mallaber L.M. Fay P.J. Bambara R.A. Nucleic Acids Res. 1994; 22: 3793-3800Crossref PubMed Scopus (51) Google Scholar). RNA fragments of size ranging from 13 to 45 nts are left behind uncleaved and remain annealed to the newly synthesized minus strand DNA. We have shown that these can be removed by a rebinding of the RT to each RNA segment (9Palaniappan C. Fuentes G.M. Rodriguez-Rodriguez L. Fay P.J. Bambara R.A. J. Biol. Chem. 1996; 271: 2063-2070Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 13DeStefano J.J. Mallaber L.M. Fay P.J. Bambara R.A. Nucleic Acids Res. 1994; 22: 3793-3800Crossref PubMed Scopus (51) Google Scholar). During this rebinding, positioning of the RT and subsequent cleavage is dictated by the 5′-end of the substrate RNA primer now recessed on the DNA template as shown in Fig. 1 B. Initial cleavage occurred between 14 and 20 nts from the RNA 5′-end, a distance reminiscent of the spatial separation between the polymerase and RNase H active sites (9Palaniappan C. Fuentes G.M. Rodriguez-Rodriguez L. Fay P.J. Bambara R.A. J. Biol. Chem. 1996; 271: 2063-2070Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 10DeStefano J.J. Nucleic Acids Res. 1995; 23: 3901-3908Crossref PubMed Scopus (39) Google Scholar, 11DeStefano J.J. Mallaber L.M. Fay P.J. Bambara R.A. Nucleic Acids Res. 1993; 21: 4330-4338Crossref PubMed Scopus (78) Google Scholar,13DeStefano J.J. Mallaber L.M. Fay P.J. Bambara R.A. Nucleic Acids Res. 1994; 22: 3793-3800Crossref PubMed Scopus (51) Google Scholar, 14Fuentes G.M. Fay P.J. Bambara R.A. Nucleic Acids Res. 1996; 24: 1719-1726Crossref PubMed Scopus (25) Google Scholar, 15Kohlstaedt L.A. Wang J. Friedman J.M. Rice P.A. Steitz T.A. Science. 1992; 256: 1783-1790Crossref PubMed Scopus (1763) Google Scholar, 16Jacobo-Molina A. Ding J. Nanni R.G. Clark Jr., A.D. Lu X. Tantillo C. Williams R.L. Kamer G. Ferris A.L. Clark P. Hizi A. Hughes S.H. Arnold E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6320-6324Crossref PubMed Scopus (1122) Google Scholar). The dominant influence of the RNA 5′-end on RT positioning was confirmed by biochemical and mutational analyses (9Palaniappan C. Fuentes G.M. Rodriguez-Rodriguez L. Fay P.J. Bambara R.A. J. Biol. Chem. 1996; 271: 2063-2070Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 17Palaniappan C. Wisniewski M. Jacques P.S. Le Grice S.F. Fay P.J. Bambara R.A. J. Biol. Chem. 1997; 272: 11157-11164Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Evidence for uncoupling of the polymerase and cleavage activities also comes from genetic studies conducted independently by Telesnitsky and Goff (18Telesnitsky A. Goff S.P. EMBO J. 1993; 12: 4433-4438Crossref PubMed Scopus (57) Google Scholar) using the Moloney murine leukemia system. The availability of a free 3′-OH on all of these short RNA intermediates should have allowed them to serve as primers for RT-mediated plus strand DNA synthesis. However, experiments performed by us and others (19Fuentes G.M. Rodriguez-Rodriguez L. Fay P.J. Bambara R.A. J. Biol. Chem. 1995; 270: 28169-28176Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 20Huber H.E. Richardson C.C. J. Biol. Chem. 1990; 265: 10565-10573Abstract Full Text PDF PubMed Google Scholar, 21Champoux J.J. Gilboa E. Baltimore D. J. Virol. 1984; 49: 686-691Crossref PubMed Google Scholar, 22Powell M.D. Levin J.G. J. Virol. 1996; 70: 5288-5296Crossref PubMed Google Scholar, 23Pullen K.A. Rattray A.J. Champoux J.J. J. Biol. Chem. 1993; 268: 6221-6227Abstract Full Text PDF PubMed Google Scholar, 24Randolph C.A. Champoux J.J. J. Biol. Chem. 1994; 269: 19207-19215Abstract Full Text PDF PubMed Google Scholar, 25Rattray A.J. Champoux J.J. J. Mol. Biol. 1989; 208: 445-456Crossref PubMed Scopus (66) Google Scholar, 26Resnick R. Omer C.A. Faras A.J. J. Virol. 1984; 51: 813-821Crossref PubMed Google Scholar, 27Smith J.K. Cywinski A. Taylor J.M. J. Virol. 1984; 52: 314-319Crossref PubMed Google Scholar, 28Schultz S.J. Champoux J.J. J. Virol. 1996; 70: 8630-8638Crossref PubMed Google Scholar, 29Wohrl B.M. Moelling K. Biochemistry. 1990; 29: 10141-10147Crossref PubMed Scopus (112) Google Scholar) verify that RNA segments with a large variety of sequences, nucleotide compositions, and lengths are ineffective as primers for RT-directed DNA synthesis. Only a PPT primer could be effectively extended. Furthermore, when a PPT sequence was present within a large segment of RNA, RT specifically degraded the adjoining segments and initiated nucleotide addition from the 3′-OH of the consensus PPT sequence (19Fuentes G.M. Rodriguez-Rodriguez L. Fay P.J. Bambara R.A. J. Biol. Chem. 1995; 270: 28169-28176Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 20Huber H.E. Richardson C.C. J. Biol. Chem. 1990; 265: 10565-10573Abstract Full Text PDF PubMed Google Scholar, 21Champoux J.J. Gilboa E. Baltimore D. J. Virol. 1984; 49: 686-691Crossref PubMed Google Scholar, 22Powell M.D. Levin J.G. J. Virol. 1996; 70: 5288-5296Crossref PubMed Google Scholar, 23Pullen K.A. Rattray A.J. Champoux J.J. J. Biol. Chem. 1993; 268: 6221-6227Abstract Full Text PDF PubMed Google Scholar, 24Randolph C.A. Champoux J.J. J. Biol. Chem. 1994; 269: 19207-19215Abstract Full Text PDF PubMed Google Scholar, 25Rattray A.J. Champoux J.J. J. Mol. Biol. 1989; 208: 445-456Crossref PubMed Scopus (66) Google Scholar, 26Resnick R. Omer C.A. Faras A.J. J. Virol. 1984; 51: 813-821Crossref PubMed Google Scholar, 27Smith J.K. Cywinski A. Taylor J.M. J. Virol. 1984; 52: 314-319Crossref PubMed Google Scholar, 28Schultz S.J. Champoux J.J. J. Virol. 1996; 70: 8630-8638Crossref PubMed Google Scholar, 29Wohrl B.M. Moelling K. Biochemistry. 1990; 29: 10141-10147Crossref PubMed Scopus (112) Google Scholar, 30Rausch J.W. Le Grice S.F. J. Biol. Chem. 1997; 272: 8602-8610Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). In vivo, synthesis initiated from any RNA primers from regions downstream of the PPT-U3 junction could not generate ends required for retroviral integration and would be disruptive to viral replication. In HIV and other lentiviruses a second copy of the U3-PPT sequence, referred to as the central PPT (cPPT), is present 5′ to the U3-PPT within the integrase coding region of the pol gene (31Charneau P. Alizon M. Clavel F. J. Virol. 1992; 66: 2814-2820Crossref PubMed Google Scholar, 32Hungnes O. Tjotta E. Grinde B. Virology. 1992; 190: 440-442Crossref PubMed Scopus (57) Google Scholar, 33Hungnes O. Tjotta E. Grinde B. Arch. Virol. 1991; 116: 133-141Crossref PubMed Scopus (39) Google Scholar). Synthesis from the cPPT appears to improve viral replication kinetics. Although mutations within the cPPT result in significantly delayed replication kinetics, proviral DNA formation competent for replication can still be completed (31Charneau P. Alizon M. Clavel F. J. Virol. 1992; 66: 2814-2820Crossref PubMed Google Scholar). This contrasts with a mutation in U3-PPT that does not allow complete reverse transcription. Although there is evidence for multiple plus strand initiation sites in both avian sarcoma-leukosis virus (for a review see Refs. 34Boone L.R. Skalka A.M. Skalka A.M. Goff S.P. Reverse Transcriptase. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1993: 119-133Google Scholar and 35Katz R.A. Skalka A.M. Annu. Rev. Biochem. 1994; 63: 133-173Crossref PubMed Scopus (535) Google Scholar) and HIV (36Miller M.D. Wang B. Bushman F.D. J. Virol. 1995; 69: 3938-3944Crossref PubMed Google Scholar), extension of RNA oligomers downstream from the U3-PPT has not been reported. Sequence analysis of intermediates in HIV replication revealed that plus strand synthesis initiated from the two PPT sequences was vastly higher than synthesis from any other RNA sequences on the genome (37Klarmann G.J. Yu H. Chen X. Daugherty J.P. Preston B.D. J. Virol. 1997; 71: 9259-9269Crossref PubMed Google Scholar). Furthermore, through mutational analysis, Powell and Levin (22Powell M.D. Levin J.G. J. Virol. 1996; 70: 5288-5296Crossref PubMed Google Scholar) reported that a stretch of six G residues present at the 3′-end of the PPT is a critical requirement for primer function. The ability of the RT to identify most RNA primers for degradation and only PPT primers for elongation is an important part of the viral replication mechanism. The question remains, what are the features of RT-nucleic acid interactions that preclude the usage of non-PPT RNA segments but allow the usage of PPT RNA segments as potential primers for plus strand DNA synthesis? When a DNA primer is recessed on an RNA template, as would be the case during minus strand synthesis, the preferential association of RT to DNA 3′-ends places RT in a mode conducive for synthesis (Fig. 1, mode A) (9Palaniappan C. Fuentes G.M. Rodriguez-Rodriguez L. Fay P.J. Bambara R.A. J. Biol. Chem. 1996; 271: 2063-2070Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 10DeStefano J.J. Nucleic Acids Res. 1995; 23: 3901-3908Crossref PubMed Scopus (39) Google Scholar, 11DeStefano J.J. Mallaber L.M. Fay P.J. Bambara R.A. Nucleic Acids Res. 1993; 21: 4330-4338Crossref PubMed Scopus (78) Google Scholar). This is also true when a DNA primer is recessed on a DNA template, as occurs during plus strand synthesis. However, when RNA primers are recessed on a DNA template, as would be the case immediately following minus strand synthesis, RTs preferentially associate to the RNA 5′-ends (9Palaniappan C. Fuentes G.M. Rodriguez-Rodriguez L. Fay P.J. Bambara R.A. J. Biol. Chem. 1996; 271: 2063-2070Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 10DeStefano J.J. Nucleic Acids Res. 1995; 23: 3901-3908Crossref PubMed Scopus (39) Google Scholar, 11DeStefano J.J. Mallaber L.M. Fay P.J. Bambara R.A. Nucleic Acids Res. 1993; 21: 4330-4338Crossref PubMed Scopus (78) Google Scholar). This places the enzymes in a mode non-conducive for DNA synthesis but at the same time favorable for RNase H action resulting in destruction of these RNAs (Fig. 1, mode B). However, the situation with the PPT RNA primer hybridized to the template appears to be different. Here, the RT association to the RNA 3′-end is favored (Fig. 1, mode C). One probable reason for the ability of PPT RNA to support synthesis is the structural resemblance of the PPT RNA/DNA hybrid to the major groove configuration of DNA primers when annealed to template DNA (38Fedoroff O. Ge Y. Reid B.R. J. Mol. Biol. 1997; 269: 225-239Crossref PubMed Scopus (62) Google Scholar). Primer utilization could depend on the ability of the RT to catalyze nucleotide addition to one type of primer structure versusanother. Alternatively, it could depend simply on the ability of the RT to bind the 3′-end. Here we present evidence that utilization of an RNA primer for synthesis depends on a binding competition of the RT for the 5′- versus 3′-ends. Results indicate that we can control the efficiency of an RNA primer for synthesis by creating conditions that block binding at the 5′-end, shifting the binding distribution to the 3′-end. Recombinant HIV-1 RT in its native heterodimeric form was purified to near homogeneity and supplied to us by Genetics Institute. The preparation of RT had a specific activity of 40,000 units/mg protein and was free of detectable nucleases. One unit is defined as an amount required to incorporate 1 nmol of dTTP into nucleic acid product in 10 min at 37 °C using poly(rA)-oligo(dT) as template-primer. An RNase H-deficient point mutant of HIV-1 RT (p66E478Q/p51) was a kind gift from Dr. Stuart LeGrice from Case Western Reserve University. An alteration of residue Glu-478 to Gln within the catalytic domain of the RNase H was previously demonstrated to result in an enzyme devoid of Mg2+-dependent RNase H function, and its preparation and purification is described elsewhere (39Schatz O. Cromme F.V. Gruninger-Leitch F. Le Grice S.F. FEBS Lett. 1989; 257: 311-314Crossref PubMed Scopus (132) Google Scholar, 40Le Grice S.F. Cameron C.E. Benkovic S.J. Methods Enzymol. 1995; 262: 130-144Crossref PubMed Scopus (121) Google Scholar). T4 polynucleotide kinase was from U. S. Biochemical Corp. DNase I, dNTPs, alkaline phosphatase, rNTPs, RNase inhibitor, T7 RNA polymerase, and quick spin gel filtration columns were purchased from Boehringer Mannheim. Radio nucleotides were from NEN Life Science Products. Plasmid pBS+ has been previously described and obtained from Stratagene. Non-PPT RNA primer 1 (21-mer) was generated by run-off transcription by T3 RNA polymerase from plasmid pBS+ following digestion by PstI. Non-PPT RNA primer 2 (41-mer) was prepared similarly from plasmid pBS+ following digestion by AccI and using T7 RNA polymerase. Subsequently the plasmid DNA was removed by DNase I digestion. Dephosphorylation of the RNA molecules was carried out using calf intestine alkaline phosphatase. A 19-nt PPT RNA (19Fuentes G.M. Rodriguez-Rodriguez L. Fay P.J. Bambara R.A. J. Biol. Chem. 1995; 270: 28169-28176Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 20Huber H.E. Richardson C.C. J. Biol. Chem. 1990; 265: 10565-10573Abstract Full Text PDF PubMed Google Scholar) was chemically synthesized and gel-purified by Midland Certified Reagent Co. When required, 5′-end labeling was carried out with [γ-32P]ATP(3000 Ci/mmol) in the presence of T4 polynucleotide kinase. RNA samples were gel purified and quantitated by “shift-up” assays using labeled DNA primers of known concentrations as described previously (11DeStefano J.J. Mallaber L.M. Fay P.J. Bambara R.A. Nucleic Acids Res. 1993; 21: 4330-4338Crossref PubMed Scopus (78) Google Scholar). For some experiments, an internally labeled 41-mer RNA primer was utilized by inclusion of labeled rNTPs in the run-off transcription mixture. Concentrations were determined according to Bradford (40Le Grice S.F. Cameron C.E. Benkovic S.J. Methods Enzymol. 1995; 262: 130-144Crossref PubMed Scopus (121) Google Scholar) using bovine serum albumin as standard. Annealing of RNA and DNA was performed in 10 mm Tris-HCl (pH 8.0), 1 mmEDTA, and 80 mm KCl. For annealing, the DNA and RNA components were added in equimolar amounts. Components were mixed, heated to 65 °C for 10 min, and slow cooled over a 90-min period. Final reaction mixtures (12.5 μl) contained 50 mm Tris-HCl (pH 8.0), 1 mmdithiothreitol, 1.0 mm EDTA, 34 mm KCl, 6 mm MgCl2, 50 μm all four dNTPs, 4 nm substrate, and HIV-1 RT. Reactions were performed at an approximate ratio of active RT molecules to substrate molecules of 1:2, unless otherwise stated. In all cases the enzyme was allowed to prebind to the substrate for 5 min at 37 °C. The reaction was initiated by addition of dNTPs and MgCl2, allowed to incubate for 15 min, and then terminated with 12.5 μl of 2 × termination mixture. For time course analysis, a mixture of all components except dNTPs and MgCl2 was prepared and allowed to react with RT at 37 °C for 5 min. Subsequent to the initiation of the reaction by the addition of dNTPs and MgCl2, 12.5-μl aliquots were drawn at varying intervals, and the reaction was terminated by adding those aliquots to an equal volume of the 2 × termination mixture (90% formamide (v/v), 10 mm EDTA (pH 8.0), and 0.1% each of xylene cyanole and bromphenol blue). Eight-μl samples were then subjected to denaturing electrophoresis to resolve reaction products. Unless otherwise specified, both extension products and cleavage products resulting from the action of RT were monitored by employing labeled primers. The gels were then vacuum-dried and subjected to autoradiography by employing standard protocols (42Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2 Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). Exposures were carried out using Kodak XAR-5 or Biomax films unless otherwise specified. A base hydrolysis ladder was generated by treatment of 5′-labeled RNA with alkali according to standard procedures (9Palaniappan C. Fuentes G.M. Rodriguez-Rodriguez L. Fay P.J. Bambara R.A. J. Biol. Chem. 1996; 271: 2063-2070Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar). MspI-digested fragments of plasmid pBR322 (Life Technologies, Inc.) that were labeled at the 5′-end were also run in each gel as additional size markers. The nucleotide sequences of templates and primers employed are as follows: RNA primer 1 (21-mer RNA), 5′-GGGAACAAAAGCUUGCAUGCC; DNA primer 1 (21-mer DNA), deoxynucleotide sequence of the above and “dT” in place of “U”; RNA primer 2 (41-mer RNA), 5′-GGGCGAAUUCGAGCUCGGUACCCGGGGAUCCUCUAGAGTCG; DNA primer 2 (41-mer DNA), deoxynucleotide sequence of the above and dT in place of U; RNA primer 3 (PPT RNA primer), 5′-UUUUAAAAGAAAGGGGGG; DNA primer 3 (PPT DNA primer), deoxynucleotide sequence of the above and dT in place of U; DNA template 1 (104 nts), 5′-TAGAGTCGACCTGCAGGCATGCAAGCTTTTGTTCCCCGAGGGTGTGGGGCCGGTGGCGCCTGTTAGTTAATTCACTGGCCGTCGTTTTACAACGACGTGACTGG (the underlined region binds to 21-mer primer); DNA template 2 (58 nts), 5′- GCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCGCCCTATAGTG (the underlined region binds to 41-mer primer); DNA template 3 (80 nts), 5′-TTGTCTTCTTTGGGAGTGAATTAGCCCTTCCAGTCCCCCCTTTTCTTTTAAAAAGTGGCTAAGATCTACAGCTGCCTTGT (the underlined region binds to PPT RNA primer); DNA template 4 (77 nts), 5′-TGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCGCCCTATAGTGAGTCGTATTACAAT (the underlined region binds to 41-mer RNA; the upstream blocking primers 1, 4, and 5 bind adjacent to this region); DNA template 5 (58 nts), 5′-GCCTGCAGGTCGACTCTAGAGGATCCCCGGGCCATTAATTCACAACTTACATATAGTG (template allows the formation of a 20 nt 5′-unannealed region when the 41-mer RNA is bound); upstream blocking DNA primer 1 (forms a nick, upstream of 41-mer primer), 5′-TAATACGACTCACTATA; upstream blocking DNA primer 2 (forms a nick, upstream of 21-mer primer), 5′-CCACCGGCCCCACACCCTCG; upstream blocking DNA primer 3 (binds upstream of PPT with a nick), 5′-CAGCTGTAGATCTTAGCCACT; upstream blocking DNA primer 4 (forms a 1-nt gap, upstream of 41-mer primer), 5′-GTAATACGACTCACTAT; upstream blocking DNA primer 5 (forms a 4-nt gap, upstream of 41-mer primer), 5′-TTGTAATACGACTCAC. Substrate A1 was formed by annealing DNA template 1 with RNA primer 1 (21-mer non-PPT RNA). Substrate A2 was formed by annealing DNA template 1 with DNA primer 1 (21-mer DNA). Substrates B1 and B2 were formed by annealing DNA template 2 with RNA primer 2 (41-mer non-PPT RNA) or DNA primer 2 (41-mer DNA), respectively. Substrates C1 and C2 were formed by annealing DNA template 3 with RNA primer 3 (19-mer PPT RNA) or DNA primer 3 (19-mer PPT DNA), respectively. The only difference between substrates B1 and B3 was that the template sequence was altered in B3 to allow for the formation of 20-nt long unannealed region at the 5′-end of RNA. Substrate D1 was formed by annealing RNA primer 2 (41-mer RNA) to DNA template 4. Substrate D3 was the same as D1, except that it had a short DNA primer (upstream blocking primer 1), annealed immediately upstream of the 41-mer RNA primer. Likewise, substrates A3 and C3 have short upstream DNA primers (upstream blocking primers 2 or 3) annealed immediately 5′ of 21-mer RNA or PPT RNA, respectively. In substrates D4 and D5, the upstream blocking DNA primers (upstream blocking primers 4 or 5) are placed to form a 1- or 4-nt gap, respectively, 5′ to the 41-mer RNA. The efficiency with which HIV-RT can extend the 3′-end of an RNA primer could depend on the binding distribution of the RT at the 3′- versus 5′-ends. We propose that the preferential association of RT molecules to the 5′-end of non-PPT RNA primers is responsible for their inability to support RT-directed DNA synthesis (Fig. 1, mode B). Blocking this preferred association to the 5′-end would allow binding of RT to the RNA 3′-end in a mode favorable for synthesis (Fig. 1, mode C). Such 5′-blocked RNA primers would be efficiently extended by the RT. We examined the ability of PPT versusnon-PPT RNA primers to support plus strand synthesis by HIV-1 RT. Substrates A1, B1, C1, A2, B2, and C2 were employed to monitor DNA synthesis by HIV-1 RT. In these substrates either a 5′-labeled RNA primer 1 (non-PPT 21-mer), RNA primer 2 (non-PPT 41-mer), PPT RNA primer (19-mer) or, respectively, corresponding DNA primers of identical sequence (DNA primer 1, 2, and PPT DNA primer) were annealed to templates as indicated under “Methods.” The profiles of the reaction products on denaturing polyacrylamide electrophoresis gels are shown in Fig. 2. Priming efficiency was calculated from band intensities determined by densitometry measurements. The proportion of extension product to the total band intensity per each reaction was calculated. DNA synthesis products are either absent or present at a very low level (<0.1% efficiency) in reactions containing substrates A1 and B1 incubated with wt HIV-1 RT. This demonstrates the inability of the two non-PPT RNA primers to support synthesis by wt RT. Instead, the majority of observed products derive from cleavage dictated by RT positioning at the RNA 5′-end as shown by our model in Fig. 1 B (Fig. 2, A and B, lane 1 of each). An initial cleavage about 18 nts from the 5′-end followed by subsequent digestion toward the 5′-end of the RNA result in a final product 9 nt long. In contrast, there is RT-mediated synthesis on substrate C1, PPT RNA (Fig. 2 C, lane 1), as expected. As a control we have employed SequenaseTM (modified T7 DNA polymerase), an enzyme proficient in utilizing RNA primers of various sequence composition for DNA synthesis. Sequenase-mediated DNA synthesis is observed with substrates A1, B1, or C1 (Fig. 2, A–C, lane 3 of each). The priming efficiency obtained using Sequenase was about 40% or more for each of the RNA primers tested. This verifies the capacity of all of the substrates to undergo DNA synthesis. It illustrates that the absence of synthesis seen with wt HIV RT on substrates A1 and B1, with non-PPT RNA primers, is a result of the nature of RT interaction with these primer-templates. The existence of an intact RNA/DNA hybrid was further confirmed by the thorough susceptibility of the RNA segment of the duplex to cleavage by Escherichia coli RNase H (Fig. 2, A–C, lane 4 of each). Furthermore, in substrates having a DNA rather than RNA primer (substrates A2, B2, and C2) HIV-RT carries out efficient DNA synthesis, making a similar amount of synthetic product as that observed in reactions containing Sequenase (Fig. 2, D–F, compare respective lanes). Although a low enzyme to substrate ratio seems to have caused a significant amount of pausing, priming efficiencies on DNA primers for RT and Sequenase-mediated synthesis were about equivalent. The values were found to be >80% for 41- and 21-mer non-PPT DNA primers and about 50% for the PPT DNA primer for all three enzyme preparations. This indicates that all tested DNA primers, of identical base composition to RNA primers employed here, support efficient RT-mediated plus strand DNA synthesis. Experiments with DNA primers also serve as controls to demonstrate that the specific activities of the different enzyme preparations are similar. This further demonstrates that differences in priming efficiencies seen on RNA primers are consequences of the properties of RT-nucleic acid interaction. We considered an alternate possibility that non-PPT primers fail to prime because they are simply not available for synthesis since they undergo destruction by RT-RNase H. Another possibility is that wt RT did perform synthesis from RNA primers but returned to remove the RNA portion following extension. Calculation of priming efficiency in experiments involving labeled RNA primers using wt RT imposes a complication by the inherent ability of RT to return after synthesis to cleave the RNA segment. In the case of PPT RNA, extension followed by precise cleavage at the RNA/DNA junction would return the RNA primer to its original location on the gel. One way to resolve these issues is by using an RT mutant deficient in RNase H function. Plus strand priming by an RNase H-defective RT point mutant was tested on all substrates. The RT-RNase H mutant behaved similarly to the wt RT with regard to priming on all substrates employed (Fig. 2, A–F, lane 2 in each). As with the wt HIV RT, the RNase H (−) RT did not support synthesis from both non-PPT RNA primers (21- and 41-mer RNA)," @default.
• W2023144832 created "2016-06-24" @default.
• W2023144832 creator A5000215774 @default.
• W2023144832 creator A5005315226 @default.
• W2023144832 creator A5032165612 @default.
• W2023144832 creator A5034527691 @default.
• W2023144832 creator A5054167197 @default.
• W2023144832 date "1998-02-01" @default.
• W2023144832 modified "2023-09-27" @default.
• W2023144832 title "Control of Initiation of Viral Plus Strand DNA Synthesis by HIV Reverse Transcriptase" @default.
• W2023144832 cites W112213681 @default.
• W2023144832 cites W1492217226 @default.
• W2023144832 cites W1493112672 @default.
• W2023144832 cites W1495040219 @default.
• W2023144832 cites W1501933018 @default.
• W2023144832 cites W1534126211 @default.
• W2023144832 cites W1546361071 @default.
• W2023144832 cites W1555146480 @default.
• W2023144832 cites W1579050066 @default.
• W2023144832 cites W1591988375 @default.
• W2023144832 cites W1593047936 @default.
• W2023144832 cites W1616353523 @default.
• W2023144832 cites W1668628402 @default.
• W2023144832 cites W1727379500 @default.
• W2023144832 cites W1738945493 @default.
• W2023144832 cites W1890208249 @default.
• W2023144832 cites W1918197787 @default.
• W2023144832 cites W1966963082 @default.
• W2023144832 cites W1969533877 @default.
• W2023144832 cites W1970543338 @default.
• W2023144832 cites W1980437255 @default.
• W2023144832 cites W1992512034 @default.
• W2023144832 cites W1994145517 @default.
• W2023144832 cites W1999103713 @default.
• W2023144832 cites W2003712894 @default.
• W2023144832 cites W2008954911 @default.
• W2023144832 cites W2009571668 @default.
• W2023144832 cites W2009581957 @default.
• W2023144832 cites W2015558688 @default.
• W2023144832 cites W2018809187 @default.
• W2023144832 cites W2030017358 @default.
• W2023144832 cites W2034223869 @default.
• W2023144832 cites W2079939178 @default.
• W2023144832 cites W2089590026 @default.
• W2023144832 cites W2096453600 @default.
• W2023144832 cites W2101146285 @default.
• W2023144832 cites W2101370516 @default.
• W2023144832 cites W2143467903 @default.
• W2023144832 cites W2166782710 @default.
• W2023144832 cites W2169088424 @default.
• W2023144832 cites W2175970307 @default.
• W2023144832 cites W4293247451 @default.
• W2023144832 doi "https://doi.org/10.1074/jbc.273.7.3808" @default.
• W2023144832 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9461561" @default.
• W2023144832 hasPublicationYear "1998" @default.
• W2023144832 type Work @default.
• W2023144832 sameAs 2023144832 @default.
• W2023144832 citedByCount "32" @default.
• W2023144832 countsByYear W20231448322012 @default.
• W2023144832 countsByYear W20231448322013 @default.
• W2023144832 countsByYear W20231448322014 @default.
• W2023144832 countsByYear W20231448322018 @default.
• W2023144832 crossrefType "journal-article" @default.
• W2023144832 hasAuthorship W2023144832A5000215774 @default.
• W2023144832 hasAuthorship W2023144832A5005315226 @default.
• W2023144832 hasAuthorship W2023144832A5032165612 @default.
• W2023144832 hasAuthorship W2023144832A5034527691 @default.
• W2023144832 hasAuthorship W2023144832A5054167197 @default.
• W2023144832 hasBestOaLocation W20231448321 @default.
• W2023144832 hasConcept C104317684 @default.
• W2023144832 hasConcept C156719811 @default.
• W2023144832 hasConcept C159047783 @default.
• W2023144832 hasConcept C3013748606 @default.
• W2023144832 hasConcept C54355233 @default.
• W2023144832 hasConcept C552990157 @default.
• W2023144832 hasConcept C67705224 @default.
• W2023144832 hasConcept C86803240 @default.
• W2023144832 hasConceptScore W2023144832C104317684 @default.
• W2023144832 hasConceptScore W2023144832C156719811 @default.
• W2023144832 hasConceptScore W2023144832C159047783 @default.
• W2023144832 hasConceptScore W2023144832C3013748606 @default.
• W2023144832 hasConceptScore W2023144832C54355233 @default.
• W2023144832 hasConceptScore W2023144832C552990157 @default.
• W2023144832 hasConceptScore W2023144832C67705224 @default.
• W2023144832 hasConceptScore W2023144832C86803240 @default.
• W2023144832 hasIssue "7" @default.
• W2023144832 hasLocation W20231448321 @default.
• W2023144832 hasOpenAccess W2023144832 @default.
• W2023144832 hasPrimaryLocation W20231448321 @default.
• W2023144832 hasRelatedWork W1487857142 @default.
• W2023144832 hasRelatedWork W1702322095 @default.
• W2023144832 hasRelatedWork W1865764402 @default.
• W2023144832 hasRelatedWork W1966013139 @default.
• W2023144832 hasRelatedWork W1975114493 @default.
• W2023144832 hasRelatedWork W2055975019 @default.
• W2023144832 hasRelatedWork W2118087741 @default.
• W2023144832 hasRelatedWork W2607725540 @default.
• W2023144832 hasRelatedWork W4236061050 @default.

• next