FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023201096> ?p ?o ?g. }

• W2023201096 endingPage "2625" @default.
• W2023201096 startingPage "2615" @default.
• W2023201096 abstract "Human maintenance DNA cytosine methyltransferase (DNMT1) regulates gene expression in a methylation-dependent and -independent manner. Anti-apoptotic survivin gene down-regulation is mediated by p53 recruitment of DNMT1 to its promoter. Survivin inhibits programmed cell death, regulates cell division, and is expressed in cancer cells. The survivin gene promoter is CG-rich containing several Sp1 canonical, Sp1-like, cell cycle-dependent element/cell cycle gene homology region, and p53-binding sites. Here we demonstrate that Sp1 transcription factor(s) play a role in transcriptional activation of the survivin promoter in Drosophila and human cells. Sp1 inhibition in vivo by mithramycin A leads to down-regulation of a luciferase reporter driven by the human survivin promoter in transfected cells. Mithramycin A or Sp1-specific short interfering RNA down-regulated the endogenous survivin gene expression, confirming Sp1 as the primary determinant for transcriptional activation. Furthermore, immobilized DNMT1 ligand bound to seven consensus amino acids corresponding to the N-terminal region of the Sp class of transcription factors in a phage display analysis. In the co-immunoprecipitation assay, the endogenous Sp1 or Sp3 pulled down DNMT1 and methyltransferase activity. Similarly, a glutathione S-transferase pulldown assay between DNMT1 and Sp1 demonstrates a direct interaction between the two proteins. Fluorescent fusions of DNMT1 and Sp1 co-localized in the mammalian nucleus, thus supporting binary complex formation between both the proteins. The kinetics of survivin promoter occupancy via chromatin immunoprecipitation following doxorubicin treatment show the presence of Sp1 and gradual accumulation of transcriptional repressors p53, DNMT1, histone methyltransferase G9a, and HDAC1 onto the promoter along with histone H3K9me2. These data suggest that the Sp1 transcription factor acts as a platform for recruitment of transcriptional repressors. Human maintenance DNA cytosine methyltransferase (DNMT1) regulates gene expression in a methylation-dependent and -independent manner. Anti-apoptotic survivin gene down-regulation is mediated by p53 recruitment of DNMT1 to its promoter. Survivin inhibits programmed cell death, regulates cell division, and is expressed in cancer cells. The survivin gene promoter is CG-rich containing several Sp1 canonical, Sp1-like, cell cycle-dependent element/cell cycle gene homology region, and p53-binding sites. Here we demonstrate that Sp1 transcription factor(s) play a role in transcriptional activation of the survivin promoter in Drosophila and human cells. Sp1 inhibition in vivo by mithramycin A leads to down-regulation of a luciferase reporter driven by the human survivin promoter in transfected cells. Mithramycin A or Sp1-specific short interfering RNA down-regulated the endogenous survivin gene expression, confirming Sp1 as the primary determinant for transcriptional activation. Furthermore, immobilized DNMT1 ligand bound to seven consensus amino acids corresponding to the N-terminal region of the Sp class of transcription factors in a phage display analysis. In the co-immunoprecipitation assay, the endogenous Sp1 or Sp3 pulled down DNMT1 and methyltransferase activity. Similarly, a glutathione S-transferase pulldown assay between DNMT1 and Sp1 demonstrates a direct interaction between the two proteins. Fluorescent fusions of DNMT1 and Sp1 co-localized in the mammalian nucleus, thus supporting binary complex formation between both the proteins. The kinetics of survivin promoter occupancy via chromatin immunoprecipitation following doxorubicin treatment show the presence of Sp1 and gradual accumulation of transcriptional repressors p53, DNMT1, histone methyltransferase G9a, and HDAC1 onto the promoter along with histone H3K9me2. These data suggest that the Sp1 transcription factor acts as a platform for recruitment of transcriptional repressors. In cancer cells de-regulation of genetic control of cell death and cell survival is common. Members of the inhibitor of apoptosis gene families have emerged as unique regulators of cell death (1Schimmer A.D. Welsh K. Pinilla C. Wang Z. Krajewska M. Bonneau M.J. Pedersen I.M. Kitada S. Scott F.L. Bailly-Maitre B. Glinsky G. Scudiero D. Sausville E. Salvesen G. Nefzi A. Ostresh J.M. Houghten R.A. Reed J.C. Cancer Cell. 2004; 5: 25-35Abstract Full Text Full Text PDF PubMed Scopus (384) Google Scholar) and are expressed robustly in cancer cells. One such member is Survivin, expressed exclusively in fetal and cancer cells but not in normal adult cells. Survivin binds to the mitotic spindle during mitosis and is thought to be responsible for anti-apoptotic activity in cancer cells via aberrant interaction with the mitotic spindle. There is also speculation that the Survivin protein can bind caspase-3 (an enzyme required for apoptosis) and inhibit its function. Architecturally the survivin gene promoter contains several Sp1 canonical, Sp1-like, and p53-binding elements, suggesting participation of the Sp1 transcription factor and/or p53 in gene regulation. Furthermore, survivin transcription is down-regulated by the DNA-damaging agent doxorubicin, which mediates p53 induction in acute lymphoblastic leukemia (2Hoffman W.H. Biade S. Zilfou J.T. Chen J. Murphy M. J. Biol. Chem. 2002; 277: 3247-3257Abstract Full Text Full Text PDF PubMed Scopus (703) Google Scholar). In the same study, binding of p53 to the survivin promoter is shown using immunoprecipitation with p53 antibodies, and overexpression of p53 led to down-regulation of Survivin. However, deletion and mutation analysis of p53-binding sites in the survivin promoter suggested that neither p53-binding site is required for survivin gene repression, although overexpression of wild type p53 led to repression of the survivin promoter in various cell types. It was also suggested that modification of chromatin in the survivin promoter might play a significant role in silencing of survivin gene transcription by p53 (3Mirza A. McGuirk M. Hockenberry T.N. Wu Q. Ashar H. Black S. Wen S.F. Wang L. Kirschmeier P. Bishop W.R. Nielsen L.L. Pickett C.B. Liu S. Oncogene. 2002; 21: 2613-2622Crossref PubMed Scopus (490) Google Scholar). The tumor suppressor p53 gene product is a key transcriptional activator/repressor. Its function is to eliminate and inhibit the proliferation of abnormal cells, thereby preventing neoplastic development. The p53 signaling pathway is in standby mode in normal cells and may be activated by cellular stress such as DNA damage or strand breaks, and in turn may activate programmed cell death. When the p53 gene is mutated, cells cannot respond correctly to various signals and are predisposed to neoplastic development. Indeed, in many cancers p53 gene mutation is common. p53 is shown to be associated with several protein factors that help transcriptional activation or repression of p53-responsive genes. The mechanism of p53-mediated repression is facilitated by histone deacetylases (HDACs) in association with the core repressor protein Sin3a. The p53-Sin3a complex targets HDACs to p53-repressive promoters to create a chromatin environment nonconducive for transcription (4Murphy M. Ahn J. Walker K.K. Hoffman W.H. Evans R.M. Levine A.J. George D.L. Genes Dev. 1999; 13: 2490-2501Crossref PubMed Scopus (393) Google Scholar). Tumor suppressor p53 is also shown to interact with Sp1 (5Lagger G. Doetzlhofer A. Schuettengruber B. Haidweger E. Simboeck E. Tischler J. Chiocca S. Suske G. Rotheneder H. Wintersberger E. Seiser C. Mol. Cell. Biol. 2003; 23: 2669-2679Crossref PubMed Scopus (165) Google Scholar, 6Koutsodontis G. Vasilaki E. Chou W.C. Papakosta P. Kardassis D. Biochem. J. 2005; 389: 443-455Crossref PubMed Scopus (61) Google Scholar), which is also believed to be a key element in regulation of important biological processes controlled by p53 via p21 gene activation such as DNA repair, cell growth, differentiation, and apoptosis. Sp1 was one of the first mammalian transcription factors to be cloned (7Kadonaga J.T. Carner K.R. Masiarz F.R. Tjian R. Cell. 1987; 51: 1079-1090Abstract Full Text PDF PubMed Scopus (1244) Google Scholar). It is a member of the family of transcription factors with a zinc finger-type DNA binding domain that binds GC-rich sequences, including GC and GT boxes (8Giglioni B. Comi P. Ronchi A. Mantovani R. Ottolenghi S. Biochem. Biophys. Res. Commun. 1989; 164: 149-155Crossref PubMed Scopus (16) Google Scholar, 9Imataka H. Sogawa K. Yasumoto K. Kikuchi Y. Sasano K. Kobayashi A. Hayami M. Fujii-Kuriyama Y. EMBO J. 1992; 11: 3663-3671Crossref PubMed Scopus (306) Google Scholar). Sp1 transcription factor is essential for mammalian development since Sp1 knock-out mice die approximately at day 11.5 of gastrulation (10Marin M. Karis A. Visser P. Grosveld F. Philipsen S. Cell. 1997; 89: 619-628Abstract Full Text Full Text PDF PubMed Scopus (440) Google Scholar). Sp1 is also required for terminal cell differentiation. This transcription factor undergoes post-translational modifications such as phosphorylation and glycosylation (11Jackson S.P. MacDonald J.J. Lees-Miller S. Tjian R. Cell. 1990; 63: 155-165Abstract Full Text PDF PubMed Scopus (512) Google Scholar, 12Jackson S.P. Tjian R. Cell. 1988; 55: 125-133Abstract Full Text PDF PubMed Scopus (645) Google Scholar), indicating secondary modifications may regulate its biological function. Earlier studies indicate that Sp1 is responsible for recruitment of TATA-binding proteins to the promoter and fixing the transcription start site of TATA-less genes (13Liao W.C. Geng Y. Johnson L.F. Gene (Amst.). 1994; 146: 183-189Crossref PubMed Scopus (15) Google Scholar, 14Lu J. Lee W. Jiang C. Keller E.B. J. Biol. Chem. 1994; 269: 5391-5402Abstract Full Text PDF PubMed Google Scholar, 15Pugh B.F. Tjian R. Genes Dev. 1991; 5: 1935-1945Crossref PubMed Scopus (475) Google Scholar). Most housekeeping genes are TATA-less and contain CpG islands (16Cross S.H. Bird A.P. Curr. Opin. Genet. Dev. 1995; 5: 309-314Crossref PubMed Scopus (406) Google Scholar). Often embedded within the CpG islands are the Sp1-binding sites. Binding of Sp1 transcription factors on the CpG-rich regions protects it from de novo methylation (17Brandeis M. Frank D. Keshet I. Siegfried Z. Mendelsohn M. Nemes A. Temper V. Razin A. Cedar H. Nature. 1994; 371: 435-438Crossref PubMed Scopus (620) Google Scholar). Sp1 transcription factors contain regions that are crucial for transactivation, DNA binding, and oligomerization and were identified using Drosophila SL2 cell lines that are naturally deficient in the Sp class of transcription factors and their related activities. The N-terminal glutamine, serine/threonine-rich domains of Sp1 are essential for transcriptional activation (18Courey A.J. Tjian R. Cell. 1988; 55: 887-898Abstract Full Text PDF PubMed Scopus (1073) Google Scholar). The C-terminal domain is shown to be involved in interaction with other transcription factors (19Li R. Knight J.D. Jackson S.P. Tjian R. Botchan M.R. Cell. 1991; 65: 493-505Abstract Full Text PDF PubMed Scopus (224) Google Scholar). Furthermore, Sp1 interacts physically and cooperates functionally with several sequence-specific activators such as NF-κB, GATA, YY1, E2F1, pRb, SREBP1, and p53 (20Black A.R. Black J.D. Azizkhan-Clifford J. J. Cell. Physiol. 2001; 188: 143-160Crossref PubMed Scopus (877) Google Scholar). Sp1 is also shown to bind human maintenance DNA (cytosine-5-)-methyltransferase (DNMT1) in vivo via immunoprecipitation of HeLa cell nuclear extract (21Song J. Ugai H. Kanazawa I. Sun K. Yokoyama K.K. J. Biol. Chem. 2001; 276: 19897-19904Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Like Sp1, human DNMT1 is known to be associated with several different proteins during DNA replication and to participate in transcriptional regulation (22Pradhan S. Esteve P.O. Clin. Immunol. 2003; 109: 6-16Crossref PubMed Scopus (80) Google Scholar). DNMT1 has two domains. The N terminus and the C terminus are known as regulatory and catalytic regions, respectively. The N terminus is shown to recruit transcriptional repressors such as histone deacetylases (23Fuks F. Burgers W.A. Brehm A. Hughes-Davies L. Kouzarides T. Nat. Genet. 2000; 24: 88-91Crossref PubMed Scopus (802) Google Scholar), Sin3a (24Geiman T.M. Sankpal U.T. Robertson A.K. Chen Y. Mazumdar M. Heale J.T. Schmiesing J.A. Kim W. Yokomori K. Zhao Y. Robertson K.D. Nucleic Acids Res. 2004; 32: 2716-2729Crossref PubMed Scopus (99) Google Scholar), and retinoblastoma (25Pradhan S. Kim G.D. EMBO J. 2002; 21: 779-788Crossref PubMed Scopus (92) Google Scholar, 26Robertson K.D. Ait-Si-Ali S. Yokochi T. Wade P.A. Jones P.L. Wolffe A.P. Nat. Genet. 2000; 25: 338-342Crossref PubMed Scopus (792) Google Scholar) to specific classes of promoters for transcriptional gene silencing. For example, recruitment of HDACs alters the acetylation status of the histones on chromatin, thus making the promoter less accessible to transcription factors. Alternatively, DNMT1 may be recruited by specific transcription factors such as p53 (27Esteve P.O. Chin H.G. Pradhan S. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1000-1005Crossref PubMed Scopus (141) Google Scholar) or PML-RAR (28Di Croce L. Raker V.A. Corsaro M. Fazi F. Fanelli M. Faretta M. Fuks F. Coco F.Lo Kouzarides T. Nervi C. Minucci S. Pelicci P.G. Science. 2002; 295: 1079-1082Crossref PubMed Scopus (682) Google Scholar, 29Di Croce L. Hum. Mol. Genet. 2005; 14: 77-84Crossref PubMed Scopus (60) Google Scholar) for hypermethylation of responsive promoters. The above phenomenon of methylation-independent and -dependent gene repression by DNMT1 makes it an ideal transcriptional repressor. Furthermore, DNMT1 can also recruit de novo methyltransferases such as DNMT3A and DNMT3B for DNA methylation (30Kim G.D. Ni J. Kelesoglu N. Roberts R.J. Pradhan S. EMBO J. 2002; 21: 4183-4195Crossref PubMed Scopus (294) Google Scholar). In colorectal cancer cells, DNMT1 and DNMT3B are essential for maintenance of genomic methylation (31Rhee I. Bachman K.E. Park B.H. Jair K.W. Yen R.W. Schuebel K.E. Cui H. Feinberg A.P. Lengauer C. Kinzler K.W. Baylin S.B. Vogelstein B. Nature. 2002; 416: 552-556Crossref PubMed Scopus (1021) Google Scholar). Although de novo methyltransferases participate in maintenance of DNA methylation, they may recruit other transcriptional repressors such as RP58 and HDACs for methylation-independent gene repression (32Fuks F. Burgers W.A. Godin N. Kasai M. Kouzarides T. EMBO J. 2001; 20: 2536-2544Crossref PubMed Scopus (461) Google Scholar). Furthermore, homozygous deletion of DNMT1 or DNMT3A and DNMT3B leads to embryonic lethality (33Li E. Bestor T.H. Jaenisch R. Cell. 1992; 69: 915-926Abstract Full Text PDF PubMed Scopus (3159) Google Scholar, 34Okano M. Bell D.W. Haber D.A. Li E. Cell. 1999; 99: 247-257Abstract Full Text Full Text PDF PubMed Scopus (4348) Google Scholar) like that of Sp1 null mice (10Marin M. Karis A. Visser P. Grosveld F. Philipsen S. Cell. 1997; 89: 619-628Abstract Full Text Full Text PDF PubMed Scopus (440) Google Scholar) suggesting involvement of these proteins in mammalian development. In cancer cells, aberrant methylation of the tumor suppressor gene promoters is a hallmark (35Jair K.W. Bachman K.E. Suzuki H. Ting A.H. Rhee I. Yen R.W. Baylin S.B. Schuebel K.E. Cancer Res. 2006; 66: 682-692Crossref PubMed Scopus (180) Google Scholar, 36Kondo Y. Issa J.P. Cancer Metastasis Rev. 2004; 23: 29-39Crossref PubMed Scopus (258) Google Scholar), and overexpression of DNMT1 has been speculated (37Etoh T. Kanai Y. Ushijima S. Nakagawa T. Nakanishi Y. Sasako M. Kitano S. Hirohashi S. Am. J. Pathol. 2004; 164: 689-699Abstract Full Text Full Text PDF PubMed Scopus (245) Google Scholar). In mammalian cells gene expression is coordinated with precision. Therefore, aberrant expression of a key gene often leads to failure of cellular function, ultimately challenging the very survival of a cell. In human cells the balancing act between transcriptional activators and repressors brings harmony to transcription of a gene. Generally the proximal part of a human gene contains DNA sequences that can bind transcription factor(s) and other transcriptional co-activator(s). In our previous work in colorectal carcinoma cells (27Esteve P.O. Chin H.G. Pradhan S. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1000-1005Crossref PubMed Scopus (141) Google Scholar), we have demonstrated that survivin gene regulation is mediated by both epigenetic factors in conjunction with p53. After DNA damage, the survivin promoter was found to be hypermethylated, and chromatin immunoprecipitation shows the presence of p53-, DNMT1-, and K9-methylated H3s (27Esteve P.O. Chin H.G. Pradhan S. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1000-1005Crossref PubMed Scopus (141) Google Scholar). These observations gave a snapshot of the repressed promoter, but it did not address the transition between an actively expressed to a repressed survivin promoter. In this study we have worked to identify transcriptional activators/repressors of the survivin promoter and their dynamics during transcriptional activation and repression upon DNA damage. Cell Culture and Constructs—All the following cell lines were obtained from the ATCC: Jurkat (human T cell lymphoblast), HEK293 (human embryonic kidney), and COS-7 (SV40 transformed fibroblast). Cells were grown as per ATCC recommendations. Cultures of Drosophila melanogaster Schneider cell line 2 (SL2) were maintained in Schneider's Drosophila medium (Invitrogen), supplemented with 10% fetal bovine serum (Invitrogen), 100 units/ml penicillin, and 100 μg/ml streptomycin at 27 °C. Parental HCT116 and p53 knock-out cell lines p53-/- (HCT116 p53-/-) were grown as described previously (38Bunz F. Dutriaux A. Lengauer C. Waldman T. Zhou S. Brown J.P. Sedivy J.M. Kinzler K.W. Vogelstein B. Science. 1998; 282: 1497-1501Crossref PubMed Scopus (2505) Google Scholar). Doxorubicin was dissolved in Me2SO and mithramycin A in methanol. To generate DNA damage, cells were treated for up to 48 h with 1 μm doxorubicin. For mithramycin A treatment, cells were incubated for up to 48 h with 100 nm mithramycin A. For transient transfections, cells were pretreated with different concentrations of mithramycin A for an hour before transfections. All GST-DNMT, DNMT1fl-InCDB, and DNMT1Δ580-InCBD constructs have been described previously (30Kim G.D. Ni J. Kelesoglu N. Roberts R.J. Pradhan S. EMBO J. 2002; 21: 4183-4195Crossref PubMed Scopus (294) Google Scholar). The GFP 2The abbreviations used are: GFP, green fluorescent protein; siRNA, short interfering RNA; ChIP, chromatin immunoprecipitation; GST, glutathione S-transferase; PCNA, proliferating cell nuclear antigen; HDAC, histone deacetylases; RNAi, RNA interference. fusion construct of DNMT1 was made by PCR representing amino acids 1–1409. DsRed-Sp1 and pPACDNMT1/p53 constructs were made by PCR cloning. SpII, Cdc25C (pcdc25C-luc), Cdc2 (pcdc2-luc), pPAC-Sp1, and -Sp3 plasmids are described elsewhere (2Hoffman W.H. Biade S. Zilfou J.T. Chen J. Murphy M. J. Biol. Chem. 2002; 277: 3247-3257Abstract Full Text Full Text PDF PubMed Scopus (703) Google Scholar, 39Hagen G. Muller S. Beato M. Suske G. EMBO J. 1994; 13: 3843-3851Crossref PubMed Scopus (650) Google Scholar, 40Le Gac G. Esteve P.O. Ferec C. Pradhan S. J. Biol. Chem. 2006; 281: 24161-24170Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Immunoprecipitation, GST Pulldown, and Western Blot Analysis—Antibodies for p53, p21, and Survivin were from Cell Signaling Technology. Anti-DNMT1 antibody was from New England Biolabs. Antibodies for PCNA, Sp1, Sp3, and HDAC1 were from Upstate Biotechnology, Inc. Anti-GFP antibody was purchased from Roche Applied Science. Nuclear extracts were made as described previously (41Andrews N.C. Faller D.V. Nucleic Acids Res. 1991; 19: 2499Crossref PubMed Scopus (2207) Google Scholar). All the pulldowns were performed as described previously (30Kim G.D. Ni J. Kelesoglu N. Roberts R.J. Pradhan S. EMBO J. 2002; 21: 4183-4195Crossref PubMed Scopus (294) Google Scholar). Densitometric analysis (NIH image 1.59) was done on two independent blots. For peptide competition assay, GST fusion DNMT1 (DNMT1-(788–1109)) was incubated with competitor peptide (TLPSPLLTVH) or a nonspecific (KFPSSPLRIPGGNIYISPLKSP) peptide for 30 min. The interaction between DNMT1 and Sp1 was probed by Western blot analysis. DNA (Cytosine-5-)-Methyltransferase Assay—Methyltransferase assays were carried out at 37 °C for 30–60 min in duplicate with a total volume of 25 μl of reaction mix. Reaction conditions were as described previously (42Pradhan S. Bacolla A. Wells R.D. Roberts R.J. J. Biol. Chem. 1999; 274: 33002-33010Abstract Full Text Full Text PDF PubMed Scopus (459) Google Scholar). Transient Transfections, Luciferase Assay, and Immunocytochemistry—For transient transfections, COS-7 and HEK293 cells were incubated with a mixture of DNA and FuGENE 6 (Roche Applied Science) at a ratio of 1 μg/3 μl. The Cellfectin reagent (Invitrogen) was used to transfect DNA into SL2 cells. As an internal control, a constant amount of pCMVβ (Clontech), a vector containing the β-galactosidase gene, was also co-transfected. Forty eight hours post-transfection, the cells were harvested, and luciferase activity was measured and normalized with β-galactosidase activity. For cytochemistry, COS-7 cells were transfected with plasmid and visualized using a confocal microscope with a 63×/1.4 oil Zeiss objective lens at 488 nm for GFP-DNMT1 and 583 nm for DsRed-Sp1 fusions using Apotome device. Chromatin Immunoprecipitation Assays—HEK293 and HCT116 cells were grown on 150-mm dishes and were treated with 100 nm mithramycin A and/or 1 μm doxorubicin. After 24 h of treatment, 1% formaldehyde was added for 10 min at 37 °C to cross-link proteins to DNA. Cells were washed two times with ice-cold 1× phosphate-buffered saline, scraped, and lysed with SDS lysis buffer (Upstate Biotechnology, Inc.) in the presence of a mixture of protease inhibitors (Sigma). The lysates were sonicated to shear DNA to lengths between 200 and 1000 bp. After 10-fold dilution of the sonicated cell supernatants in ChIP dilution buffer (Upstate Biotechnology, Inc.) supplemented with protease inhibitors, immunoprecipitations were carried out overnight at 4 °C with rotation by using 4 μgof anti-Sp1, anti-DNMT1, anti-p53, anti-G9a (Upstate Biotechnology, Inc.), anti-dimethylated H3K9 (Upstate Biotechnology, Inc.), and anti-HDAC1 polyclonal antibodies for 2–4 mg of protein. Monoclonal GFP antibody (Roche Applied Science) was used as a control. 40 μl of protein G coupled to magnetic beads pre-adsorbed with salmon sperm DNA were added to the chromatin-antibody complexes for 1 h at 4°C with rotation. The beads were then isolated and washed according to the manufacturer's recommendation (Upstate Biotechnology, Inc.). The protein-DNA complexes were eluted with a buffer containing 1% SDS and 0.1 m NaHCO3. The protein DNA cross-links were reversed by incubating the eluates with NaCl (5 m) for 6 h at 65°C.A small portion of samples was tested first for their content in DNMT1, Sp1, or p53 by Western blot. To the rest of the samples, proteinase K (New England Biolabs) was added for 1 h at 45 °C,andthe DNA was recovered by phenol/chloroform extraction and ethanol precipitation. Immunoprecipitated DNA was analyzed for the presence of survivin gene (GenBank™ accession number U75285) promoter sequence by PCR with proximal (GACCACGGGCAGAGCCACGCGGCG and GCGCCCTGGGCAACCGTCTCCACC) and distal (TCCTGGAACTCGGTTTTGAG and ACCACTTTGGGGCAGAGATG) primer sets. PCR was performed using the following amplification parameters. After a hot start, the cycling parameters were 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s for a total of 30 cycles. PCR products were separated on a 1.5% agarose gel and stained with ethidium bromide and were observed under UV light. Phage Display Assay—Human DNMT1 with fused intein chitin binding domain (full-length DNMT1, DNMT1fl-InCBD; N-terminal 580 deletion DNMT1, DNMT1Δ580-inCBD) was expressed in Sf9 cells using the baculovirus expression system, and these fusions were incubated with chitin magnetic beads. Enzymes bound to the beads were isolated as depicted in Fig. 3A and incubated with a Ph.D.-12 phage display peptide library (New England Biolabs). After several washes, phages specifically bound to DNMT1 were isolated by incubating phage DNMT1fl-InCBD in 50 mm dithiothreitol. This process cleaves the DNMT1 from the InCBD fusion tag resulting in isolation of DNMT1 and the bound phages, whereas the In-CBD tag remains on the magnetic matrix. The phages were amplified for another round of bio-panning. The bio-panning procedure was repeated two more times to enrich specific DNMT1-binding phages. Sp1 Knockdown Assay—HCT116 cells were transfected using Lipofectamine™ 2000 reagent (Invitrogen) with two different Sp1 Validated Stealth™ RNAi duplex sequences (Invitrogen) according to the manufacturer's recommendations. For control transfection, a Stealth™ RNAi negative control duplex was used (Invitrogen). 48 h after transfection, Western blots were performed. Sp1 Transcription Factor Is Crucial for Transcriptional Activation of the survivin Promoter—Sequence analysis of the survivin promoter in both human (43Ambrosini G. Adida C. Altieri D.C. Nat. Med. 1997; 3: 917-921Crossref PubMed Scopus (2981) Google Scholar) and mouse (44Li F. Altieri D.C. Cancer Res. 1999; 59: 3143-3151PubMed Google Scholar) genes reveals the absence of a TATA box. A CpG island lies upstream of the transcription start site with at least seven putative Sp1 transcription factor-binding sites. Deletion analysis of the survivin promoter correlated promoter activity in the presence of Sp1-binding sites in a transfection assay (44Li F. Altieri D.C. Cancer Res. 1999; 59: 3143-3151PubMed Google Scholar). Also prominent in the promoter region are two putative p53-binding sites (Fig. 1A). To examine the functional association between Sp1-like transcription factors and the p53 tumor suppressor, we transfected SpII, a luciferase reporter plasmid construct under human survivin promoter regulation (2Hoffman W.H. Biade S. Zilfou J.T. Chen J. Murphy M. J. Biol. Chem. 2002; 277: 3247-3257Abstract Full Text Full Text PDF PubMed Scopus (703) Google Scholar), in combination with Sp1 or Sp1 and p53 into COS-7 cells, and we then measured luciferase activity. Overexpression of Sp1 in the COS-7 cells leads to ∼8-fold transcriptional activation of the survivin promoter, and this transactivation was strongly repressed in the presence of p53 (Fig. 1B) suggesting that the presence or absence of p53 directly affects survivin expression. We further deleted the p53-binding sites of the SpII plasmid to create SpIIΔp53, a plasmid also lacking two Sp1-binding sites, and used it as a negative control (Fig. 1A) for luciferase activity assay in the presence of exogenous p53 and/or Sp1 in COS-7 cells. Luciferase activity was not strongly affected in the presence of exogenous p53 in the SpIIΔp53 transfection assay confirming that p53-binding sites are crucial for survivin promoter repression. Introduction of Sp1 alone or with p53 in the SpIIΔp53 transfection assay did not affect the promoter activity, despite the presence of five more Sp1-binding sites on the deletion survivin promoter (Fig. 1B). These data suggest Sp1 can be recruited onto the survivin promoter for transactivation of the gene, and p53 can act as a negative modulator of the survivin promoter. In the above experiments (Fig. 1B), mammalian cells such as COS-7 contain the endogenous Sp1 class of transcription factors, which may influence the gene expression pattern. Thus, to avoid influence of the endogenous Sp1 class of transcription factors on transgene activation, we chose Drosophila embryo-derived cell line SL2 for our studies. These cells are devoid of the Sp1 class of transcription factors or Sp1-associated activities. Thus they represent a unique biological system to study Sp1-dependent transcriptional mechanisms. Both Sp1 and Sp3 expression constructs were transfected either in combination with SpII or SpII and p53. As in COS-7 cells (Fig. 1B), Sp1 and Sp3 transcription factors were able to transactivate the survivin promoter between 12- and 37-fold, and this transactivation was significantly reduced in the presence of p53 in SL2 cells, suggesting that p53 is capable of transcriptional repression despite the presence of Sp1 or Sp3 (Fig. 1C). To unequivocally confirm that the Sp1 class of transcription factors is indeed involved in survivin gene activation in human cells, we transfected HCT116 cells with a construct containing full-length Sp1, and we performed Western blot analysis on the total cell extract 48 h post-transfection to assess the changes in the level of Sp1 and survivin (Fig. 1D). Indeed, the Survivin level was up-regulated in a dose-dependent manner despite the presence of the endogenous Sp1 correlating with the amount of the transfected plasmid. The level of control PCNA remained similar (Fig. 1D). To confirm the role of Sp1 in transactivation, we co-transfected the Sp1 expression plasmid with two other positive controls, Cdc2 and Cdc25C, and compared the promoter activity to SpII wild type and SpIIΔp53 in SL2 cells. Cdc25C, Cdc2, and survivin (SpII) promoters were up-regulated, but SpIIΔp53 displayed ∼5-fold reduced transactivation, suggesting Sp1-binding sites are crucial for transactivation (supplemental Fig. 1). These experiments clearly demonstrate the transcriptional activation of the survivin promoter is dependent on Sp1 and Sp3, and p53 is a potent survivin down-regulator in the mammalian and insect cell system. Mithramycin A Down-regulates the Wild Type survivin Promoter via Effective Blocking of Sp1 on the Promoter—To further invest" @default.
• W2023201096 created "2016-06-24" @default.
• W2023201096 creator A5012364874 @default.
• W2023201096 creator A5012509736 @default.
• W2023201096 creator A5051263244 @default.
• W2023201096 date "2007-01-01" @default.
• W2023201096 modified "2023-10-17" @default.
• W2023201096 title "Molecular Mechanisms of Transactivation and Doxorubicin-mediated Repression of survivin Gene in Cancer Cells" @default.
• W2023201096 cites W1228798347 @default.
• W2023201096 cites W1521333964 @default.
• W2023201096 cites W1533942477 @default.
• W2023201096 cites W1667331074 @default.
• W2023201096 cites W1963567995 @default.
• W2023201096 cites W1973759523 @default.
• W2023201096 cites W1979547093 @default.
• W2023201096 cites W1980273804 @default.
• W2023201096 cites W1981929643 @default.
• W2023201096 cites W1982356313 @default.
• W2023201096 cites W1984894774 @default.
• W2023201096 cites W1987520716 @default.
• W2023201096 cites W1992960292 @default.
• W2023201096 cites W1993414761 @default.
• W2023201096 cites W2006077720 @default.
• W2023201096 cites W2007010211 @default.
• W2023201096 cites W2013980278 @default.
• W2023201096 cites W2018855284 @default.
• W2023201096 cites W2020427232 @default.
• W2023201096 cites W2024042273 @default.
• W2023201096 cites W2026898144 @default.
• W2023201096 cites W2029733458 @default.
• W2023201096 cites W2035523654 @default.
• W2023201096 cites W2036403623 @default.
• W2023201096 cites W2037653294 @default.
• W2023201096 cites W2042473783 @default.
• W2023201096 cites W2045184737 @default.
• W2023201096 cites W2046241907 @default.
• W2023201096 cites W2059644739 @default.
• W2023201096 cites W2060446375 @default.
• W2023201096 cites W2062219202 @default.
• W2023201096 cites W2063767041 @default.
• W2023201096 cites W2063957550 @default.
• W2023201096 cites W2064268598 @default.
• W2023201096 cites W2064697981 @default.
• W2023201096 cites W2068601002 @default.
• W2023201096 cites W2074469807 @default.
• W2023201096 cites W2077903723 @default.
• W2023201096 cites W2080125477 @default.
• W2023201096 cites W2085592229 @default.
• W2023201096 cites W2089126365 @default.
• W2023201096 cites W2093188241 @default.
• W2023201096 cites W2094646101 @default.
• W2023201096 cites W2116824534 @default.
• W2023201096 cites W2118827241 @default.
• W2023201096 cites W2133778193 @default.
• W2023201096 cites W2143206501 @default.
• W2023201096 cites W2149902033 @default.
• W2023201096 cites W2149935989 @default.
• W2023201096 cites W2154795389 @default.
• W2023201096 cites W2165223374 @default.
• W2023201096 cites W2168851383 @default.
• W2023201096 doi "https://doi.org/10.1074/jbc.m606203200" @default.
• W2023201096 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17124180" @default.
• W2023201096 hasPublicationYear "2007" @default.
• W2023201096 type Work @default.
• W2023201096 sameAs 2023201096 @default.
• W2023201096 citedByCount "99" @default.
• W2023201096 countsByYear W20232010962012 @default.
• W2023201096 countsByYear W20232010962013 @default.
• W2023201096 countsByYear W20232010962014 @default.
• W2023201096 countsByYear W20232010962015 @default.
• W2023201096 countsByYear W20232010962016 @default.
• W2023201096 countsByYear W20232010962017 @default.
• W2023201096 countsByYear W20232010962018 @default.
• W2023201096 countsByYear W20232010962019 @default.
• W2023201096 countsByYear W20232010962020 @default.
• W2023201096 countsByYear W20232010962021 @default.
• W2023201096 countsByYear W20232010962022 @default.
• W2023201096 crossrefType "journal-article" @default.
• W2023201096 hasAuthorship W2023201096A5012364874 @default.
• W2023201096 hasAuthorship W2023201096A5012509736 @default.
• W2023201096 hasAuthorship W2023201096A5051263244 @default.
• W2023201096 hasBestOaLocation W20232010961 @default.
• W2023201096 hasConcept C104317684 @default.
• W2023201096 hasConcept C121608353 @default.
• W2023201096 hasConcept C1292079 @default.
• W2023201096 hasConcept C150194340 @default.
• W2023201096 hasConcept C185592680 @default.
• W2023201096 hasConcept C186310378 @default.
• W2023201096 hasConcept C2775975398 @default.
• W2023201096 hasConcept C2776694085 @default.
• W2023201096 hasConcept C2781303535 @default.
• W2023201096 hasConcept C502942594 @default.
• W2023201096 hasConcept C54355233 @default.
• W2023201096 hasConcept C55493867 @default.
• W2023201096 hasConcept C86803240 @default.
• W2023201096 hasConcept C96232424 @default.
• W2023201096 hasConceptScore W2023201096C104317684 @default.
• W2023201096 hasConceptScore W2023201096C121608353 @default.

• next