FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023220248> ?p ?o ?g. }

• W2023220248 endingPage "8530" @default.
• W2023220248 startingPage "8519" @default.
• W2023220248 abstract "Insulin-induced gene proteins (INSIGs) function in control of cellular cholesterol. Mammalian INSIGs exert control by directly interacting with proteins containing sterol-sensing domains (SSDs) when sterol levels are elevated. Mammalian 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase (HMGR) undergoes sterol-dependent, endoplasmic-reticulum (ER)-associated degradation (ERAD) that is mediated by INSIG interaction with the HMGR SSD. The yeast HMGR isozyme Hmg2 also undergoes feedback-regulated ERAD in response to the early pathway-derived isoprene gernanylgeranyl pyrophosphate (GGPP). Hmg2 has an SSD, and its degradation is controlled by the INSIG homologue Nsg1. However, yeast Nsg1 promotes Hmg2 stabilization by inhibiting GGPP-stimulated ERAD. We have proposed that the seemingly disparate INSIG functions can be unified by viewing INSIGs as sterol-dependent chaperones of SSD clients. Accordingly, we tested the role of sterols in the Nsg1 regulation of Hmg2. We found that both Nsg1-mediated stabilization of Hmg2 and the Nsg1-Hmg2 interaction required the early sterol lanosterol. Lowering lanosterol in the cell allowed GGPP-stimulated Hmg2 ERAD. Thus, Hmg2-regulated degradation is controlled by a two-signal logic; GGPP promotes degradation, and lanosterol inhibits degradation. These data reveal that the sterol dependence of INSIG-client interaction has been preserved for over 1 billion years. We propose that the INSIGs are a class of sterol-dependent chaperones that bind to SSD clients, thus harnessing ER quality control in the homeostasis of sterols. Insulin-induced gene proteins (INSIGs) function in control of cellular cholesterol. Mammalian INSIGs exert control by directly interacting with proteins containing sterol-sensing domains (SSDs) when sterol levels are elevated. Mammalian 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase (HMGR) undergoes sterol-dependent, endoplasmic-reticulum (ER)-associated degradation (ERAD) that is mediated by INSIG interaction with the HMGR SSD. The yeast HMGR isozyme Hmg2 also undergoes feedback-regulated ERAD in response to the early pathway-derived isoprene gernanylgeranyl pyrophosphate (GGPP). Hmg2 has an SSD, and its degradation is controlled by the INSIG homologue Nsg1. However, yeast Nsg1 promotes Hmg2 stabilization by inhibiting GGPP-stimulated ERAD. We have proposed that the seemingly disparate INSIG functions can be unified by viewing INSIGs as sterol-dependent chaperones of SSD clients. Accordingly, we tested the role of sterols in the Nsg1 regulation of Hmg2. We found that both Nsg1-mediated stabilization of Hmg2 and the Nsg1-Hmg2 interaction required the early sterol lanosterol. Lowering lanosterol in the cell allowed GGPP-stimulated Hmg2 ERAD. Thus, Hmg2-regulated degradation is controlled by a two-signal logic; GGPP promotes degradation, and lanosterol inhibits degradation. These data reveal that the sterol dependence of INSIG-client interaction has been preserved for over 1 billion years. We propose that the INSIGs are a class of sterol-dependent chaperones that bind to SSD clients, thus harnessing ER quality control in the homeostasis of sterols. Regulation of the sterol pathway is critical for maintaining physiological homeostasis and the function of cellular membranes. Lessons learned from the natural mechanisms of sterol regulation are directly applicable to clinical management of cholesterol. A rate-limiting step in the highly conserved cholesterol synthesis pathway is catalyzed by HMGR 2The abbreviations used are: HMGRHMG-CoA reductaseSSDsterol-sensing domainERendoplasmic reticulumERADendoplasmic reticulum-associated degradationSREBPsterol regulatory element-binding proteinSCAPSREBP cleavage-activating proteinINSIGinsulin-induced gene proteinHRDHMG-CoA reductase degradationFPPfarnesyl pyrophosphateGGPPgeranylgeranyl pyrophosphateCHXcycloheximideRo48Ro48-8071TbterbinafinePIprotease inhibitors. that produces mevalonate from HMG-CoA (1Goldstein J.L. Brown M.S. Regulation of the mevalonate pathway.Nature. 1990; 343: 425-430Crossref PubMed Scopus (4544) Google Scholar). As such, HMGR is subject to multiple forms of feedback control by the sterol pathway; high flux through the pathway results in lower levels of HMGR, whereas lower flux results in higher HMGR (2Brown M.S. Goldstein J.L. Multivalent feedback regulation of HMG CoA reductase, a control mechanism coordinating isoprenoid synthesis and cell growth.J. Lipid Res. 1980; 21: 505-517Abstract Full Text PDF PubMed Google Scholar, 3Jo Y. Debose-Boyd R.A. Control of cholesterol synthesis through regulated ER-associated degradation of HMG CoA reductase.Crit. Rev. Biochem. Mol. Biol. 2010; 45: 185-198Crossref PubMed Scopus (121) Google Scholar). Understanding feedback regulation of HMGR has implications for the clinic because HMGR is the target of cholesterol-lowering statin drugs, and sterol pathway feedback impacts the efficacy of these drugs. HMG-CoA reductase sterol-sensing domain endoplasmic reticulum endoplasmic reticulum-associated degradation sterol regulatory element-binding protein SREBP cleavage-activating protein insulin-induced gene protein HMG-CoA reductase degradation farnesyl pyrophosphate geranylgeranyl pyrophosphate cycloheximide Ro48-8071 terbinafine protease inhibitors. The most selective mechanism controlling HMGR is the feedback regulation of its stability. Lipid signals generated by the sterol pathway feed back to regulate HMGR degradation (3Jo Y. Debose-Boyd R.A. Control of cholesterol synthesis through regulated ER-associated degradation of HMG CoA reductase.Crit. Rev. Biochem. Mol. Biol. 2010; 45: 185-198Crossref PubMed Scopus (121) Google Scholar, 4Hampton R.Y. Garza R.M. Protein quality control as a strategy for cellular regulation. Lessons from ubiquitin-mediated regulation of the sterol pathway.Chem. Rev. 2009; 109: 1561-1574Crossref PubMed Scopus (75) Google Scholar). When the synthesis of sterol pathway products is high, degradation is fast and HMGR protein levels fall. When synthesis is low, degradation is slow and HMGR protein levels rise (2Brown M.S. Goldstein J.L. Multivalent feedback regulation of HMG CoA reductase, a control mechanism coordinating isoprenoid synthesis and cell growth.J. Lipid Res. 1980; 21: 505-517Abstract Full Text PDF PubMed Google Scholar, 5Hampton R.Y. Rine J. Regulated degradation of HMG-CoA reductase, an integral membrane protein of the endoplasmic reticulum, in yeast.J. Cell Biol. 1994; 125: 299-312Crossref PubMed Scopus (181) Google Scholar). HMGR resides in the ER and is thus subject to ER-associated degradation (ERAD). HMGR consists of an N-terminal membrane-spanning domain and a C-terminal cytosolic catalytic domain; the N-terminal domain is necessary and sufficient for HMGR-regulated degradation (3Jo Y. Debose-Boyd R.A. Control of cholesterol synthesis through regulated ER-associated degradation of HMG CoA reductase.Crit. Rev. Biochem. Mol. Biol. 2010; 45: 185-198Crossref PubMed Scopus (121) Google Scholar). HMGR-regulated degradation is conserved between mammals and yeast; accordingly, we have exploited Saccharomyces cerevisiae to discover the mechanisms of degradation and its control by the sterol pathway (4Hampton R.Y. Garza R.M. Protein quality control as a strategy for cellular regulation. Lessons from ubiquitin-mediated regulation of the sterol pathway.Chem. Rev. 2009; 109: 1561-1574Crossref PubMed Scopus (75) Google Scholar). There are two HMGR isozymes in yeast, Hmg1 and Hmg2. Hmg1 is a stable isoform, whereas Hmg2 undergoes ubiquitin-mediated degradation by the ER-localized HRD pathway (4Hampton R.Y. Garza R.M. Protein quality control as a strategy for cellular regulation. Lessons from ubiquitin-mediated regulation of the sterol pathway.Chem. Rev. 2009; 109: 1561-1574Crossref PubMed Scopus (75) Google Scholar). In response to high signal, Hmg2 undergoes HRD-dependent ubiquitination, extraction from the ER membrane, and degradation by the 26 S proteasomes (6Garza R.M. Sato B.K. Hampton R.Y. In vitro analysis of Hrd1p-mediated retrotranslocation of its multispanning membrane substrate 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase.J. Biol. Chem. 2009; 284: 14710-14722Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 4Hampton R.Y. Garza R.M. Protein quality control as a strategy for cellular regulation. Lessons from ubiquitin-mediated regulation of the sterol pathway.Chem. Rev. 2009; 109: 1561-1574Crossref PubMed Scopus (75) Google Scholar). The HRD pathway primarily functions in protein quality control to target misfolded or damaged proteins in the ER lumen or membrane for ERAD. When sterol pathway activity is high, Hmg2 appears to adopt a structure recognized by the HRD quality control pathway, allowing feedback-regulated destruction of Hmg2 (7Shearer A.G. Hampton R.Y. Lipid-mediated, reversible misfolding of a sterol-sensing domain protein.EMBO J. 2005; 24: 149-159Crossref PubMed Scopus (59) Google Scholar, 8Garza R.M. Tran P.N. Hampton R.Y. Geranylgeranyl pyrophosphate is a potent regulator of HRD-dependent 3-hydroxy-3-methylglutaryl-CoA reductase degradation in yeast.J. Biol. Chem. 2009; 284: 35368-35380Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar). Hmg2 entry into the HRD pathway is controlled by a signal derived from farnesyl pyrophosphate (FPP), a 15-carbon early pathway isoprene. High FPP results in more degradation and lower HMGR levels, and low FPP results in less degradation and higher HMGR protein levels (9Gardner R.G. Hampton R.Y. A highly conserved signal controls degradation of 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase in eukaryotes.J. Biol. Chem. 1999; 274: 31671-31678Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar) (Fig. 1A). In more recent work, we identified the 20-carbon FPP derivative gernaylgeranyl pyrophosphate (GGPP) as the likely endogenous FPP-derived signal (8Garza R.M. Tran P.N. Hampton R.Y. Geranylgeranyl pyrophosphate is a potent regulator of HRD-dependent 3-hydroxy-3-methylglutaryl-CoA reductase degradation in yeast.J. Biol. Chem. 2009; 284: 35368-35380Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar). In addition, an oxysterol signal augments the isoprene signal to promote Hmg2-regulated degradation by the HRD pathway (10Gardner R.G. Shan H. Matsuda S.P. Hampton R.Y. An oxysterol-derived positive signal for 3-hydroxy-3-methylglutaryl-CoA reductase degradation in yeast.J. Biol. Chem. 2001; 276: 8681-8694Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Response to either of these signals depends on the highly conserved sterol-sensing domain (SSD) in the Hmg2 transmembrane domain, such that the SSD is required for the degradation-enhancing effects of each class of signal (11Theesfeld C.L. Pourmand D. Davis T. Garza R.M. Hampton R.Y. The sterol-sensing domain (SSD) directly mediates signal-regulated endoplasmic reticulum-associated degradation (ERAD) of 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase isozyme Hmg2.J. Biol. Chem. 2011; 286: 26298-26307Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). Regulated degradation of mammalian HMGR also occurs by ERAD, and a homologue of the Hrd1 E3 ligase called gp78 is responsible for ubiquitination (12Song B.L. Sever N. DeBose-Boyd R.A. Gp78, a membrane-anchored ubiquitin ligase, associates with Insig-1 and couples sterol-regulated ubiquitination to degradation of HMG CoA reductase.Mol. Cell. 2005; 19: 829-840Abstract Full Text Full Text PDF PubMed Scopus (281) Google Scholar). In the presence of pathway signals, HMGR degradation is accelerated. The primary signal for mammalian HMGR degradation is a methylated derivative of lanosterol, called 24,25-dihydrolanosterol (13Song B.L. Javitt N.B. DeBose-Boyd R.A. Insig-mediated degradation of HMG CoA reductase stimulated by lanosterol, an intermediate in the synthesis of cholesterol.Cell Metab. 2005; 1: 179-189Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar, 14Nguyen A.D. McDonald J.G. Bruick R.K. DeBose-Boyd R.A. Hypoxia stimulates degradation of 3-hydroxy-3-methylglutaryl-coenzyme A reductase through accumulation of lanosterol and hypoxia-inducible factor-mediated induction of insigs.J. Biol. Chem. 2007; 282: 27436-27446Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). The use of a lanosterol derivative ensures that the regulation of the primary enzyme of sterol synthesis is keyed to the synthesis of this class of molecules (13Song B.L. Javitt N.B. DeBose-Boyd R.A. Insig-mediated degradation of HMG CoA reductase stimulated by lanosterol, an intermediate in the synthesis of cholesterol.Cell Metab. 2005; 1: 179-189Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). In addition, degradation of mammalian HMGR by gp78 is also increased by a 20-carbon isoprene, but the nature and action of this second signal is not clear (15Sever N. Song B.L. Yabe D. Goldstein J.L. Brown M.S. DeBose-Boyd R.A. Insig-dependent ubiquitination and degradation of mammalian 3-hydroxy-3-methylglutaryl-CoA reductase stimulated by sterols and geranylgeraniol.J. Biol. Chem. 2003; 278: 52479-52490Abstract Full Text Full Text PDF PubMed Scopus (238) Google Scholar). Sterol-regulated degradation of mammalian HMGR requires the highly conserved ER membrane-resident INSIG proteins (12Song B.L. Sever N. DeBose-Boyd R.A. Gp78, a membrane-anchored ubiquitin ligase, associates with Insig-1 and couples sterol-regulated ubiquitination to degradation of HMG CoA reductase.Mol. Cell. 2005; 19: 829-840Abstract Full Text Full Text PDF PubMed Scopus (281) Google Scholar). INSIG promotes HMGR degradation when sterol signal is high by recruiting the E3 ubiquitin ligase gp78 to HMGR. gp78, a HRD1-related ligase, promotes ubiquitination of both HMGR and INSIG that ultimately leads to their destruction by cytosolic 26 S proteasomes (3Jo Y. Debose-Boyd R.A. Control of cholesterol synthesis through regulated ER-associated degradation of HMG CoA reductase.Crit. Rev. Biochem. Mol. Biol. 2010; 45: 185-198Crossref PubMed Scopus (121) Google Scholar). This mechanism, a sterol-dependent association between HMGR and INSIG followed by HRD pathway destruction, functions to lower HMGR activity when sterol intermediates are high. Similarly, INSIG binds to the regulatory protein SCAP, to allow sterol-dependent control of the SREBP transcription factor's activation by cleavage. In the case of SCAP, cholesterol promotes the interaction, rather than lanosterol. Cholesterol induces INSIG binding to SCAP and traps it in the ER, blocking transfer of SCAP-bound SREBP to its site of activation in the Golgi. Both mammalian targets of INSIG, HMGR and SCAP, have SSDs, and these are required for the sterol-dependent interaction of each with INSIG. In fact, it has been suggested that the primary function of the SSD is interaction with INSIG (16Motamed M. Zhang Y. Wang M.L. Seemann J. Kwon H.J. Goldstein J.L. Brown M.S. Identification of luminal Loop 1 of Scap protein as the sterol sensor that maintains cholesterol homeostasis.J. Biol. Chem. 2011; 286: 18002-18012Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar), although our data and other recent data clearly show that the SSD has INSIG-independent functions as well (11Theesfeld C.L. Pourmand D. Davis T. Garza R.M. Hampton R.Y. The sterol-sensing domain (SSD) directly mediates signal-regulated endoplasmic reticulum-associated degradation (ERAD) of 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase isozyme Hmg2.J. Biol. Chem. 2011; 286: 26298-26307Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar, 17Hughes A.L. Stewart E.V. Espenshade P.J. Identification of twenty-three mutations in fission yeast Scap that constitutively activate SREBP.J. Lipid Res. 2008; 49: 2001-2012Abstract Full Text Full Text PDF PubMed Scopus (13) Google Scholar). Two conserved INSIGs are expressed in yeast (18Flury I. Garza R. Shearer A. Rosen J. Cronin S. Hampton R.Y. INSIG. A broadly conserved transmembrane chaperone for sterol-sensing domain proteins.EMBO J. 2005; 24: 3917-3926Crossref PubMed Scopus (56) Google Scholar), called Nsg1 and Nsg2, and they function to control regulation of Hmg2. However, rather than promote HMGR degradation, Nsgs stabilize Hmg2, and Nsg1 functions at its natural levels to block the regulated degradation of Hmg2 by GGPP (18Flury I. Garza R. Shearer A. Rosen J. Cronin S. Hampton R.Y. INSIG. A broadly conserved transmembrane chaperone for sterol-sensing domain proteins.EMBO J. 2005; 24: 3917-3926Crossref PubMed Scopus (56) Google Scholar). As expected from INSIG action in mammals, Nsg1 stabilizes Hmg2 by binding to its SSD-containing transmembrane domain. Thus, considering all the examples, INSIGs appear to have unrelated functions: retaining SCAP in the ER, recruiting an E3 for degradation of HMGR, or causing stabilization of Hmg2. However, these apparently distinct functions represent documented activities of chaperones, and we have proposed the idea that INSIGs are chaperones dedicated to SSD-containing proteins (18Flury I. Garza R. Shearer A. Rosen J. Cronin S. Hampton R.Y. INSIG. A broadly conserved transmembrane chaperone for sterol-sensing domain proteins.EMBO J. 2005; 24: 3917-3926Crossref PubMed Scopus (56) Google Scholar). Do these different INSIG functions toward SSD-containing proteins use the same mechanism? In mammals, INSIG function requires sterol-induced binding to the membrane anchors of HMGR and SCAP. If yeast INSIG, Nsg1, functions in a similar manner, we would expect the association between Hmg2 and Nsg1 to require a sterol molecule. Thus, we tested this idea. In this work, we demonstrate that the action of INSIGs toward HMGR is mechanistically conserved across a billion years of evolution between yeast and mammals. Nsg1 binding and stabilization of Hmg2 required lanosterol. INSIGs in yeast thus prohibit Hmg2 entry into the HRD ERAD when sterol synthesis is active. In the absence of sterols, when Hmg2 is freed from Nsg1, high GGPP caused Hmg2 to be degraded by the HRD pathway. We propose that this regulatory logic for Hmg2-regulated degradation (“GGPP yes, sterols no”) may be appropriate when the role of anaerobiosis is considered in the natural biology of yeast. When Hmg2 and Nsg1 were disengaged, Nsg1 was also subject to ER-associated degradation. Surprisingly, Nsg1 degradation appeared to use a novel ERAD pathway. The remarkable consistency between mammalian and yeast INSIG function and mechanism will be a valuable asset in understanding this key lipid regulatory axis and the interplay between sterol biology and ER protein quality control. All strains (Table 1) and plasmids (Table 2) were constructed with standard molecular biology techniques. To construct pRH2566 (pMET3-ERG11::URA3), 850 nucleotides of the 5′ portion of the ERG11 ORF were amplified from a tiling array plasmid (19Jones G.M. Stalker J. Humphray S. West A. Cox T. Rogers J. Dunham I. Prelich G. A systematic library for comprehensive overexpression screens in Saccharomyces cerevisiae.Nat. Methods. 2008; 5: 239-241Crossref PubMed Scopus (147) Google Scholar) with oligonucleotides oRH4219 and oRH4247, cut with PstI and ClaI, and cloned into pRH1205 cut with the same enzymes. pRH2566 was cut with BmgBI for integration at ERG11. pRH1206 (pMET3-ERG7::URA3) was cut with BamHI for integration at ERG7. DNA primers are listed in Table 3.TABLE 1Yeast strainsStrainGenotypeReference/SourceFigureRHY8204MATα ade2-101 met2 lys2-801 ura3-52 hmg2Δ::1mycHMG2 trp1::hisG leu2Δ his3Δ200 pdr5Δ::KanMX4loxP pNSG1-3HA::TRP1MX6This workFigs. 1 (B–D), 2A, 3C, 4A, 5 (A and B), and 6 (A and B)RHY8490MATa ade2-101 met2 lys2-801 ura3-52 hmg2Δ::1mycHMG2 trp1::hisG leu2Δ his3Δ200 pdr5Δ::KanMX4loxP TRP1empty vector nsg1Δ::KanMX4This work, from RHY8299 non-parental ditype tetradFigs. 4 (A and B) and 6BRHY8525MATα ade2-101 met2 lys2-801 ura3-52 hmg2Δ::1mycHMG2 trp1::hisG leu2Δ his3Δ200 pNSG1-3HA::TRP1MX6 pdr5Δ::KanMX4loxP hrd1Δ::LEU2This work, from RHY8204Fig. 6 (A and B)RHY8608MATa ade2-101 met2 lys2-801 ura3-52 hmg2Δ::1mycHMG2 trp1::hisG leu2Δ his3Δ200 pdr5Δ::KanMX4loxP TRP1empty vector nsg1Δ::KanMX4 nsg2Δ::NatMX4This work, from RHY8490Figs. 3C and 5 (B and C)RHY3425MATα ade2-101 met2 lys2-801 ura3-52 hmg2Δ::1mycHMG2 trp1::hisG leu2Δ his3Δ200 pNSG1-3HA::TRP1MX6Ref. 18Flury I. Garza R. Shearer A. Rosen J. Cronin S. Hampton R.Y. INSIG. A broadly conserved transmembrane chaperone for sterol-sensing domain proteins.EMBO J. 2005; 24: 3917-3926Crossref PubMed Scopus (56) Google ScholarFig. 3 (A and B)RHY8689MATα ade2-101 met2 lys2-801 ura3-52 hmg2Δ::NatMX4 trp1::hisG leu2Δ his3Δ200 pNSG1-3HA::TRP1MX6This work, from RHY3425Fig. 3 (A and B)RHY8723MATα ade2-101 met2 lys2-801 ura3-52 hmg2Δ::1mycHMG2 trp1::hisG leu2Δ his3Δ200 pNSG1-3HA::TRP1MX6 hmg1Δ::NatMX4This work, from RHY3425Fig. 3 (A and B)RHY3388MATa ade2-101 met2 lys2-801 ura3-52 hmg2Δ::1mycHMG2 trp1::hisG leu2Δ his3Δ200 nsg1Δ::KanMX4Ref. 18Flury I. Garza R. Shearer A. Rosen J. Cronin S. Hampton R.Y. INSIG. A broadly conserved transmembrane chaperone for sterol-sensing domain proteins.EMBO J. 2005; 24: 3917-3926Crossref PubMed Scopus (56) Google ScholarRHY7480MATα ade2-101::TDH3-NSG1–3HA::ADE2 met2 lys2-801 ura3-52 his3Δ200This workFig. 6CRHY7479MATα ade2-101::TDH3-NSG1-3HA::ADE2 met2 lys2-801 ura3-52 his3Δ200 hrd1Δ::KanMX4This workFig. 6CRHY7532MATα ade2-101::TDH3-NSG1-3HA::ADE2 met2 lys2-801 ura3-52 his3Δ200 doa10Δ::KanMX4This workFig. 6CRHY7536MATα ade2-101::TDH3-NSG1-3HA::ADE2 met2 lys2-801 ura3-52 his3Δ200 hrd1ΔKanMX4 doa10Δ::cloNATThis workFig. 6CRHY8299RHY8204 × RHY3388This workRHY8767MATα ade2-101 met2 lys2-801 ura3-52 hmg2Δ::1mycHMG2-GFP::HIS3MX6 trp1::hisG leu2Δ his3Δ200 pdr5Δ::KanMX4loxP pNSG1–3HA::TRP1MX6This workFig. 1DRHY8928MAT ade2-101 MET2 lys2-801 ura3-52 hmg2Δ::1mycHMG2 trp1::hisG leu2Δ his3Δ200 pNSG1-3HA::TRP1MX6 URA3 empty vectorThis workFig. 2 (B–D)RHY8896MAT ade2-101 MET2 lys2-801 ura3-52 hmg2Δ::1mycHMG2 trp1::hisG leu2Δ his3Δ200 pNSG1-3HA::TRP1MX6 pMET3-ERG7::URA3This workFig. 2 (B–D)RHY8899MAT ade2-101 MET2 lys2-801 ura3-52 hmg2Δ::1mycHMG2 trp1::hisG leu2Δ his3Δ200 pNSG1-3HA::TRP1MX6 pMET3-ERG11::URA3This workFig. 2 (B–D) Open table in a new tab TABLE 2PlasmidsPlasmidGenotypeReferencepRH311pRS404 TRP1 empty vectorRef. 30Sikorski R.S. Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.Genetics. 1989; 122: 19-27Crossref PubMed Google ScholarpRH313pRS406 URA3 empty vectorRef. 30Sikorski R.S. Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.Genetics. 1989; 122: 19-27Crossref PubMed Google ScholarpRH728pUG6 kanMX knockout cassetteRef. 31Güldener U. Heck S. Fielder T. Beinhauer J. Hegemann J.H. A new efficient gene disruption cassette for repeated use in budding yeast.Nucleic Acids Res. 1996; 24: 2519-2524Crossref PubMed Scopus (1361) Google ScholarpRH1658pAG25/Euroscarf 30104 natMX knockout cassetteRef. 32Goldstein A.L. McCusker J.H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae.Yeast. 1999; 15: 1541-1553Crossref PubMed Scopus (1376) Google ScholarpRH1812pFA6a-3HA-TRP1Ref. 33Longtine M.S. McKenzie 3rd, A. Demarini D.J. Shah N.G. Wach A. Brachat A. Philippsen P. Pringle J.R. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae.Yeast. 1998; 14: 953-961Crossref PubMed Scopus (4168) Google ScholarpRH1184hrd1Δ::LEU2Ref. 34Wilhovsky S. Gardner R. Hampton R. HRD gene dependence of endoplasmic reticulum-associated degradation.Mol. Biol. Cell. 2000; 11: 1697-1708Crossref PubMed Scopus (95) Google ScholarpRH1415MET2Ref. 10Gardner R.G. Shan H. Matsuda S.P. Hampton R.Y. An oxysterol-derived positive signal for 3-hydroxy-3-methylglutaryl-CoA reductase degradation in yeast.J. Biol. Chem. 2001; 276: 8681-8694Abstract Full Text Full Text PDF PubMed Scopus (46) Google ScholarpRH1206pMET3-ERG7::URA3Ref. 10Gardner R.G. Shan H. Matsuda S.P. Hampton R.Y. An oxysterol-derived positive signal for 3-hydroxy-3-methylglutaryl-CoA reductase degradation in yeast.J. Biol. Chem. 2001; 276: 8681-8694Abstract Full Text Full Text PDF PubMed Scopus (46) Google ScholarpRH1805pTDH3-NSG1-3HA::ADE2Ref. 18Flury I. Garza R. Shearer A. Rosen J. Cronin S. Hampton R.Y. INSIG. A broadly conserved transmembrane chaperone for sterol-sensing domain proteins.EMBO J. 2005; 24: 3917-3926Crossref PubMed Scopus (56) Google ScholarpRH2560pFA6a-GFP(S65T)-HIS3MX6Ref. 33Longtine M.S. McKenzie 3rd, A. Demarini D.J. Shah N.G. Wach A. Brachat A. Philippsen P. Pringle J.R. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae.Yeast. 1998; 14: 953-961Crossref PubMed Scopus (4168) Google ScholarpRH2566pMET3-ERG11::URA3This work Open table in a new tab TABLE 3OligonucleotidesOligonucleotideSequencePurpose, reference/sourceoRH1975GACCCTTTTAAGTTTTCGTATCCGCTCGTTCGAAAGACTTTAGACAAAACAGCTGAAGCTTCGTACGCKO PDR5, Ref. 35Carroll S.M. Hampton R.Y. Usa1p is required for optimal function and regulation of the Hrd1p endoplasmic reticulum-associated degradation ubiquitin ligase.J. Biol. Chem. 2010; 285: 5146-5156Abstract Full Text Full Text PDF PubMed Scopus (53) Google ScholaroRH1976AAAAGTCCATCTTGGTAAGTTTCTTTTCTTAACCAAATTCAAAATTCTACATAGGCCACTAGTGGATCTGKO PDR5, Ref. 35Carroll S.M. Hampton R.Y. Usa1p is required for optimal function and regulation of the Hrd1p endoplasmic reticulum-associated degradation ubiquitin ligase.J. Biol. Chem. 2010; 285: 5146-5156Abstract Full Text Full Text PDF PubMed Scopus (53) Google ScholaroRH1979CGCCGTGGTACGATATCTGTCheck pdr5Δ, Ref. 35Carroll S.M. Hampton R.Y. Usa1p is required for optimal function and regulation of the Hrd1p endoplasmic reticulum-associated degradation ubiquitin ligase.J. Biol. Chem. 2010; 285: 5146-5156Abstract Full Text Full Text PDF PubMed Scopus (53) Google ScholaroRH1980AAGACGGTTCGCCATTCGGCheck pdr5Δ, Ref. 35Carroll S.M. Hampton R.Y. Usa1p is required for optimal function and regulation of the Hrd1p endoplasmic reticulum-associated degradation ubiquitin ligase.J. Biol. Chem. 2010; 285: 5146-5156Abstract Full Text Full Text PDF PubMed Scopus (53) Google ScholaroRH4160CGAAGATAAACGACAAAGTATTTCTCAAAGAAAACAGCATACAGACAGCTGAAGCTTCGTACGCKO NSG2, this workoRH4161TCTTGTACTTCTAATTAATAATATTTACTCGTCAGAATTTCGACTGCATAGGCCACTAGTGGATCTGKO NSG2, this workoRH4155GTATATACGAACGTCGCTGGCheck nsg2Δ, this workoRH4156GAAATGTCAAGTGTTACAGCCCheck nsg2Δ, This workoRH4171AAACAACAGCAATTTTATTTTGGACCTGCATAATATTTACCGAAATATGCAGCTGAAGCTTCGTACGCKO HMG2, this workoRH4172TAGAGTCAAAATATACCGTGTTTAGTATTGTAGCATTTAACTTATCTGTGCATAGGCCACTAGTGGATCTGKO HMG2, This workoRH4173ACAGTGTTGACCATACCAGGCheck hmg2Δ, this workoRH4174GGCAACACGGAAATGATCACCheck hmg2Δ, this workoRH1716GACTGCTGAAGTGCTGGAGTTCheck hrd1Δ Ref. 18Flury I. Garza R. Shearer A. Rosen J. Cronin S. Hampton R.Y. INSIG. A broadly conserved transmembrane chaperone for sterol-sensing domain proteins.EMBO J. 2005; 24: 3917-3926Crossref PubMed Scopus (56) Google ScholaroRH1717CATTTAGTCATGAACGCTTCTCCheck hrd1Δ, Ref. 18Flury I. Garza R. Shearer A. Rosen J. Cronin S. Hampton R.Y. INSIG. A broadly conserved transmembrane chaperone for sterol-sensing domain proteins.EMBO J. 2005; 24: 3917-3926Crossref PubMed Scopus (56) Google ScholaroRH4219CGG ATc tgc agg gat ctA TGT CTG CTA CCA AGT CAA TCG TTG GAG AGG CClone MET3-ERG11oRH4247CAATTCTTGTTGGACATCTGGClone MET3-ERG11oRH4182GAATCGCCAATTTTAGTTTCCGAAAAATTGCCCTTCAGAAATTATGATTATcggatccccgggttaattaaMake 1mycHmg2-GFPoRH4183TATTGGCATATAGCCGATGACATTTTCACAGCAAGCTCCAAAAACGCGATCgaattcgagctcgtttaaacMake 1mycHmg2-GFP Open table in a new tab All stocks were stored at −20 °C unless stated. Cycloheximide (CHX; 1001B3, ICN Biomedicals, Inc.) stock was 50 mg/ml in DMSO. Lovastatin (a gift from Merck) stock was 25 mg/ml in methanol ammonia at 4 °C. Ro48-8071 (Ro48; a gift from Johannes Aebi at Hoffmann-La Roche) stock was 40 mg/ml in DMSO. Terbinafine was prepared as an ethanolic solution (10 mg/ml). Ketoconazole (K1003, Sigma) was 10 mg/ml in DMSO. Fenpropimorph (36772, Sigma) was 100 mg/ml in 95% ethanol. MG132 (benzyloxycarbonyl-Leu-Leu-aldehyde; C2211, Sigma) was 25 mg/ml in DMSO. GGPP (G6025, Sigma) was 200 μg/vial in methanol/ammonia (7:3). Digitonin (5628, Sigma) was recrystallized three times in ethanol and dried in aliquots using a SpeedVac. The following immunological reagents were used: anti-HA monoclonal antibody ascites (1:2500; Covance); anti-Myc 9E10.2 monoclonal antibody from hybridoma supernatants prepared in the laboratory; anti-HA affinity matrix (AFC-101P, Covance); goat anti-mouse-HRP (1:10,000; Jackson Immunochemicals); anti-Pgk1 (1:2500; A6457, Molecular Probes); and anti-ubiquitin monoclonal antibody (gift from Richard Gardner, University of Washington). S. cerevisiae strains (Table 1) were derived from S288C background and are isogenic. Yeasts were grown at 30 °C in minimal medium with 2% glucose. Experiments were performed on cultures in log phase between 0.2 and 0.6 OD/ml (A600 nm). Standard yeast techniques were used to introduce plasmids and prepare gene deletions. The hrd1Δ, nsg1Δ, nsg2Δ, and hmg2Δ null strains were made by PCR-mediated homologous recombination of the KanMX4 or nourseothricin gene (NatMX4) cassettes flanked by 50 base pairs of homology to the coding regions (Table 3, Oligonucleotide). Nulls were confirmed by PCR and associated deletion phenotypes. To make 1mycHmg2-GFP expressed from the HMG2 promoter, a PCR fragment was generated using pFA6a-GFP(S65T)-HIS3MX6 as a template. The primers contained 50 base pairs of homology to the HMG2 gene, such that GFP is inserted after amino acid 668, the same pos" @default.
• W2023220248 created "2016-06-24" @default.
• W2023220248 creator A5006211367 @default.
• W2023220248 creator A5080520354 @default.
• W2023220248 date "2013-03-01" @default.
• W2023220248 modified "2023-09-29" @default.
• W2023220248 title "Insulin-induced Gene Protein (INSIG)-dependent Sterol Regulation of Hmg2 Endoplasmic Reticulum-associated Degradation (ERAD) in Yeast" @default.
• W2023220248 cites W1561715118 @default.
• W2023220248 cites W1850569493 @default.
• W2023220248 cites W1860242155 @default.
• W2023220248 cites W1966072209 @default.
• W2023220248 cites W1988420806 @default.
• W2023220248 cites W1997761763 @default.
• W2023220248 cites W1997859335 @default.
• W2023220248 cites W2007320849 @default.
• W2023220248 cites W2016441481 @default.
• W2023220248 cites W2018515506 @default.
• W2023220248 cites W2035112393 @default.
• W2023220248 cites W2041092523 @default.
• W2023220248 cites W2049281448 @default.
• W2023220248 cites W2057680047 @default.
• W2023220248 cites W2059202648 @default.
• W2023220248 cites W2061238163 @default.
• W2023220248 cites W2065394018 @default.
• W2023220248 cites W2066889359 @default.
• W2023220248 cites W2068689195 @default.
• W2023220248 cites W2071124826 @default.
• W2023220248 cites W2072038070 @default.
• W2023220248 cites W2089949661 @default.
• W2023220248 cites W2091557924 @default.
• W2023220248 cites W2094718316 @default.
• W2023220248 cites W2102814404 @default.
• W2023220248 cites W2107575026 @default.
• W2023220248 cites W2115420718 @default.
• W2023220248 cites W2116404848 @default.
• W2023220248 cites W2121812741 @default.
• W2023220248 cites W2126453322 @default.
• W2023220248 cites W2150761911 @default.
• W2023220248 cites W2153101930 @default.
• W2023220248 cites W2153458899 @default.
• W2023220248 cites W2158157260 @default.
• W2023220248 cites W2162295516 @default.
• W2023220248 cites W2169333620 @default.
• W2023220248 doi "https://doi.org/10.1074/jbc.m112.404517" @default.
• W2023220248 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3605666" @default.
• W2023220248 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/23306196" @default.
• W2023220248 hasPublicationYear "2013" @default.
• W2023220248 type Work @default.
• W2023220248 sameAs 2023220248 @default.
• W2023220248 citedByCount "21" @default.
• W2023220248 countsByYear W20232202482014 @default.
• W2023220248 countsByYear W20232202482015 @default.
• W2023220248 countsByYear W20232202482016 @default.
• W2023220248 countsByYear W20232202482017 @default.
• W2023220248 countsByYear W20232202482018 @default.
• W2023220248 countsByYear W20232202482019 @default.
• W2023220248 countsByYear W20232202482020 @default.
• W2023220248 countsByYear W20232202482021 @default.
• W2023220248 countsByYear W20232202482022 @default.
• W2023220248 crossrefType "journal-article" @default.
• W2023220248 hasAuthorship W2023220248A5006211367 @default.
• W2023220248 hasAuthorship W2023220248A5080520354 @default.
• W2023220248 hasBestOaLocation W20232202481 @default.
• W2023220248 hasConcept C139447449 @default.
• W2023220248 hasConcept C158617107 @default.
• W2023220248 hasConcept C158619295 @default.
• W2023220248 hasConcept C185592680 @default.
• W2023220248 hasConcept C2777576037 @default.
• W2023220248 hasConcept C2779222958 @default.
• W2023220248 hasConcept C2992195973 @default.
• W2023220248 hasConcept C55493867 @default.
• W2023220248 hasConcept C86803240 @default.
• W2023220248 hasConcept C95444343 @default.
• W2023220248 hasConceptScore W2023220248C139447449 @default.
• W2023220248 hasConceptScore W2023220248C158617107 @default.
• W2023220248 hasConceptScore W2023220248C158619295 @default.
• W2023220248 hasConceptScore W2023220248C185592680 @default.
• W2023220248 hasConceptScore W2023220248C2777576037 @default.
• W2023220248 hasConceptScore W2023220248C2779222958 @default.
• W2023220248 hasConceptScore W2023220248C2992195973 @default.
• W2023220248 hasConceptScore W2023220248C55493867 @default.
• W2023220248 hasConceptScore W2023220248C86803240 @default.
• W2023220248 hasConceptScore W2023220248C95444343 @default.
• W2023220248 hasIssue "12" @default.
• W2023220248 hasLocation W20232202481 @default.
• W2023220248 hasLocation W20232202482 @default.
• W2023220248 hasLocation W20232202483 @default.
• W2023220248 hasLocation W20232202484 @default.
• W2023220248 hasOpenAccess W2023220248 @default.
• W2023220248 hasPrimaryLocation W20232202481 @default.
• W2023220248 hasRelatedWork W2047296322 @default.
• W2023220248 hasRelatedWork W2108412187 @default.
• W2023220248 hasRelatedWork W2139653729 @default.
• W2023220248 hasRelatedWork W2253768935 @default.
• W2023220248 hasRelatedWork W2897243648 @default.
• W2023220248 hasRelatedWork W2922642391 @default.
• W2023220248 hasRelatedWork W3177368341 @default.
• W2023220248 hasRelatedWork W37241425 @default.

• next