FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023306543> ?p ?o ?g. }

• W2023306543 endingPage "21216" @default.
• W2023306543 startingPage "21206" @default.
• W2023306543 abstract "The fetoprotein transcription factor (FTF) gene was inactivated in the mouse, with a lacZ gene inserted inframe into exon 4. LacZ staining of FTF+/- embryos shows that the mFTF gene is activated at initial stages of zygotic transcription. FTF gene activity is ubiquitous at the morula and blastocyst stages and then follows expression patterns indicative of multiple FTF functions in fetal development. FTF-/- embryos die at E6.5–7.5, with features typical of visceral endoderm dysfunction. Adult FTF+/- mice are hypocholesterolemic, and express liver FTF at about 40% of the normal level. Overexpression of liver FTF in transgenic mice indicates in vivo that FTF is an activator of CYP7A1. However, CYP7A1 expression is increased in FTF+/- liver. Gene expression profiles indicate that higher CYP7A1 expression is caused by attenuated liver cell stress signaling. Diet experiments support a model where FTF is quenched both by activated c-Jun, and by SHP as a stronger feedback mechanism to repress CYP7A1. A DR4 element is conserved in the FTF gene promoter and activated by LXR-RXR and TR-RXR, qualifying the FTF gene as a direct metabolic sensor. Liver FTF increases in rats treated with thyroid hormone or a high cholesterol diet. The FTF DR4 element tightens functional links between FTF and LXRα in cholesterol homeostasis and can explain transient surges of FTF gene activities during development and FTF levels lower than predicted in FTF+/- liver. The FTF-lacZ mouse establishes a central role for FTF in developmental, nutritive, and metabolic functions from early embryogenesis through adulthood. The fetoprotein transcription factor (FTF) gene was inactivated in the mouse, with a lacZ gene inserted inframe into exon 4. LacZ staining of FTF+/- embryos shows that the mFTF gene is activated at initial stages of zygotic transcription. FTF gene activity is ubiquitous at the morula and blastocyst stages and then follows expression patterns indicative of multiple FTF functions in fetal development. FTF-/- embryos die at E6.5–7.5, with features typical of visceral endoderm dysfunction. Adult FTF+/- mice are hypocholesterolemic, and express liver FTF at about 40% of the normal level. Overexpression of liver FTF in transgenic mice indicates in vivo that FTF is an activator of CYP7A1. However, CYP7A1 expression is increased in FTF+/- liver. Gene expression profiles indicate that higher CYP7A1 expression is caused by attenuated liver cell stress signaling. Diet experiments support a model where FTF is quenched both by activated c-Jun, and by SHP as a stronger feedback mechanism to repress CYP7A1. A DR4 element is conserved in the FTF gene promoter and activated by LXR-RXR and TR-RXR, qualifying the FTF gene as a direct metabolic sensor. Liver FTF increases in rats treated with thyroid hormone or a high cholesterol diet. The FTF DR4 element tightens functional links between FTF and LXRα in cholesterol homeostasis and can explain transient surges of FTF gene activities during development and FTF levels lower than predicted in FTF+/- liver. The FTF-lacZ mouse establishes a central role for FTF in developmental, nutritive, and metabolic functions from early embryogenesis through adulthood. Development of the mammalian embryo relies upon nutritive functions fulfilled by the visceral endoderm and then by the liver (1Meehan R.R. Barlow D.P. Hill R.E. Hogan B.L.M. Hastie N.D. EMBO J. 1984; 3: 1881-1885Crossref PubMed Scopus (115) Google Scholar). A part of these functions is accomplished by nutrient carrier proteins of the albumin gene family, a multigene locus expressed by the liver and subject to precise developmental controls. One albumin-related gene, the α1-fetoprotein (AFP) 1The abbreviations used are: AFP, α1-fetoprotein; ABC1, ATP-binding cassette protein A1; ASBT, apical sodium-dependent bile salt transporter; BA, bile acid; CAT, chloramphenicol acetyltransferase; CYP7A1, cholesterol 7α-hydroxylase; CYP8B1, sterol 12α-hydroxylase; dpc, day post coitum; DR, direct repeat; E, embryonic day; EMSA, electrophoretic mobility shift assay; ES, embryonic stem cell; FGFR, fibroblast growth factor receptor; Ftz-F1, fushi tarazu factor 1; FTF, α1-fetoprotein transcription factor; FRE, FTF-response element; FXR, farnesoid X receptor; HNF, hepatocyte nuclear factor; JNK, c-Jun N-terminal kinase; LXR, liver X receptor; LXRE, LXR-response element; mFTF, mouse FTF; mrp3, multidrug resistance protein 3; MTI, metallothionein I; nt, nucleotide; RXR, retinoid X receptor; SF1, steroidogenic factor 1; SHP, small heterodimer partner; T3, triiodothyronine; TR, thyroid hormone receptor; PBS, phosphate-buffered saline; DMEM, Dulbecco's modified Eagle's medium; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HA, hemagglutinin. gene, is activated at the onset of liver differentiation and operates tightly coupled with liver growth (2Bélanger L. Hamel D. Lachance L. Dufour D. Tremblay M. Gagnon P.M. Nature. 1975; 256: 657-659Crossref PubMed Scopus (65) Google Scholar, 3Bélanger L. Roy S. Allard D. J. Biol. Chem. 1994; 269: 5481-5484Abstract Full Text PDF PubMed Google Scholar). In 1988, our group circumscribed a proximal AFP promoter element essential to AFP gene activity in hepatocytes, and distinct from promoter components regulating the other albumin loci (4Guertin M. LaRue H. Bernier D. Wrange O. Chevrette M. Gingras M.-C. Bélanger L. Mol. Cell. Biol. 1988; 8: 1398-1407Crossref PubMed Scopus (79) Google Scholar). The AFP-specific activator was then identified as orphan receptor fetoprotein transcription factor (5Bernier D. Thomassin H. Allard D. Guertin M. Hamel D. Blaquière M. Beauchemin M. LaRue H. Estable-Puig M. Bélanger L. Mol. Cell. Biol. 1993; 13: 1619-1633Crossref PubMed Google Scholar, 6Galarneau L. Paré J.-F. Allard D. Hamel D. Lévesque L. Tugwood J.D. Green S. Bélanger L. Mol. Cell. Biol. 1996; 16: 3853-3865Crossref PubMed Google Scholar, 7Galarneau L. Drouin R. Bélanger L. Cytogenet. Cell. Genet. 1998; 82: 269-270Crossref PubMed Google Scholar), so named for its first identified target locus (genome data base nomenclature, 2Genome Data Base Nomenclature Committee 9837397. NR5A2 in the nuclear receptor nomenclature, Ref. 9Nuclear Receptors Nomenclature CommitteeCell. 1999; 97: 161-163Abstract Full Text Full Text PDF PubMed Scopus (945) Google Scholar); also referred to as LRH1 or CPF). FTF belonged to a primitive class of nuclear receptors and emerged as a critical lead to connect AFP gene activation with early embryonic growth and differentiation processes. Subsequent studies indicated that developmental FTF functions even preceded its activation of the AFP locus in hepatocytes. In situ hybridization analysis in the mouse at embryonic day 8–9 showed abundant FTF transcripts in the foregut endoderm, before liver morphogenesis (10Rausa F.M. Galarneau L. Bélanger L. Costa R.H. Mech. Dev. 1999; 89: 185-188Crossref PubMed Scopus (73) Google Scholar). Characterization of the FTF gene promoter also revealed a cluster of regulatory motifs conserved in distant species and potential targets of cell lineage specification factors (11Paré J.-F. Roy S. Galarneau L. Bélanger L. J. Biol. Chem. 2001; 276: 13136-13144Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Among these were three proximal binding sites for GATA factors, known to be essential for visceral endoderm function (12Narita N. Bielinska M. Wilson D.B. Dev. Biol. 1997; 189: 270-274Crossref PubMed Scopus (173) Google Scholar, 13Morrisey E.E. Tang Z. Sigrist K. Lu M.M. Jiang F. Ip H.S. Parmacek M.S. Genes Dev. 1998; 12: 3579-3590Crossref PubMed Scopus (544) Google Scholar). Furthermore, three HNF genes important to liver differentiation, HNF1α, HNF4α, and HNF3β, were found to each contain double FTF-binding sites in their proximal promoter and to be activated by FTF in transfection assays (11Paré J.-F. Roy S. Galarneau L. Bélanger L. J. Biol. Chem. 2001; 276: 13136-13144Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Thus, a pivotal role was suggested for FTF in a transcriptional cascade using determination factors to activate FTF in prehepatic endodermal cells, and then using FTF to drive AFP and other effectors of the hepatic program. Besides functions in early development, FTF was expected to maintain important nutritive roles in the adult, FTF being maintained at high levels in liver, intestine, and acinar pancreas. A landmark finding was the identification of FTF as one factor that binds and regulates the CYP7A1 gene promoter, the rate-limiting enzyme in the conversion of cholesterol to bile acids (BA) (14Nitta M. Ku S. Brown C. Okamoto A.Y. Shan B. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 6660-6665Crossref PubMed Scopus (249) Google Scholar, 15Lu T.T. Makishima M. Repa J.J. Schoonjans K. Kerr T.A. Auwerx J. Mangelsdorf D.J. Mol. Cell. 2000; 6: 507-515Abstract Full Text Full Text PDF PubMed Scopus (1228) Google Scholar, 16Goodwin B. Jones S.A. Price R.R. Watson M.A. McKee D.D. Moore L.B. Galardi C. Wilson J.G. Lewis M.C. Roth M.E. Maloney P.R. Willson T.M. Kliewer S.A. Mol. Cell. 2000; 6: 517-526Abstract Full Text Full Text PDF PubMed Scopus (1515) Google Scholar, 17del Castillo-Olivares A. Gil G. Nucleic Acids Res. 2000; 28: 3587-3593Crossref PubMed Google Scholar). A model emerged whereby FTF would act as a “competence” factor driving the BA pathway, subject to negative feedback regulation by interaction of FTF with orphan receptor SHP, activated by the BA receptor FXR and by FTF itself (15Lu T.T. Makishima M. Repa J.J. Schoonjans K. Kerr T.A. Auwerx J. Mangelsdorf D.J. Mol. Cell. 2000; 6: 507-515Abstract Full Text Full Text PDF PubMed Scopus (1228) Google Scholar, 16Goodwin B. Jones S.A. Price R.R. Watson M.A. McKee D.D. Moore L.B. Galardi C. Wilson J.G. Lewis M.C. Roth M.E. Maloney P.R. Willson T.M. Kliewer S.A. Mol. Cell. 2000; 6: 517-526Abstract Full Text Full Text PDF PubMed Scopus (1515) Google Scholar, 18Sinal C.J. Tohkin M. Miyata M. Ward J.M. Lambert G. Gonzalez F.J. Cell. 2000; 102: 731-744Abstract Full Text Full Text PDF PubMed Scopus (1426) Google Scholar, 19Lee Y.-K. Parker K.L. Choi H.-S. Moore D.D. J. Biol. Chem. 1999; 274: 20869-20873Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). Additional reports associated further FTF action with membrane transporters of the enterohepatic BA recycling system (20Inokuchi A. Hinoshita E. Iwamoto Y. Kohno K. Kuwano M. Uchiumi T. J. Biol. Chem. 2001; 276: 46822-46829Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar, 21Chen F. Ma L. Dawson P.A. Sinal C.J. Sehayek E. Gonzalez F.J. Breslow J. Ananthanarayanan M. Shneider B.L. J. Biol. Chem. 2003; 278: 19909-19916Abstract Full Text Full Text PDF PubMed Scopus (202) Google Scholar) and with pancreatic cholesterol esterase (22Fayard E. Schoonjans K. Annicotte J.S. Auwerx J. J. Biol. Chem. 2003; 278: 35725-35731Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar), all of which pointing to an important systemic role for FTF in adult cholesterol/BA homeostasis. Here we document an FTF-lacZ gene knockout in the mouse, delineating FTF expression sites at all developmental stages and confirming crucial developmental and metabolic FTF functions from early embryogenesis to adulthood. We also identify a promoter DR4 regulatory element directly connecting FTF gene regulation with hormonal and metabolic homeostasis. FTF Gene Inactivation—A 7.5-kb SpeI mFTF gene fragment encompassing exons 4–6 was retrieved from a mouse 129/SV genomic library screened with rat FTF cDNA (11Paré J.-F. Roy S. Galarneau L. Bélanger L. J. Biol. Chem. 2001; 276: 13136-13144Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). The 7.5-kb fragment was used to generate a knockout vector carrying a lacZ gene inserted in-frame into mFTF exon 4. Briefly, a 4-kb lacZ fragment was derived from vector pCH110 (Amersham Biosciences) using PstI, S1 nuclease, and KpnI, and spliced into pSVK3 (Invitrogen) pretreated with EcoRI, Klenow, and KpnI. Recombinant pSVK3-lacZ was digested with SmaI/XbaI and ligated with the 5′-end mFTF gene fragment obtained with BglII (which cuts exon 4 at position 462 in the sequence shown in Ref. 6Galarneau L. Paré J.-F. Allard D. Hamel D. Lévesque L. Tugwood J.D. Green S. Bélanger L. Mol. Cell. Biol. 1996; 16: 3853-3865Crossref PubMed Google Scholar) and treated with Klenow. This placed lacZ (with a stop codon and polyadenylation signal at its end) in phase with the N-terminal portion of mFTF exon 4, interrupting the FTF sequence upstream from the first zinc finger of the DNA binding domain (11Paré J.-F. Roy S. Galarneau L. Bélanger L. J. Biol. Chem. 2001; 276: 13136-13144Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). An MC1-neo cassette was ligated to the 3′-BglII mFTF fragment and inserted downstream from lacZ in the opposite polarity, and an MC1-tk cassette was inserted at the 5′-SpeI end of the FTF gene fragment. The construct was then used for electroporation into ES cells. This knockout vector predicted that an FTF-lacZ allele would transcribe a 4-kb FTF-lacZ mRNA in all FTF-permissive cells (i.e. from either the mFTF promoter 5′-flanking exon 1, or any other putative promoter elements between exons 1 and 3) (11Paré J.-F. Roy S. Galarneau L. Bélanger L. J. Biol. Chem. 2001; 276: 13136-13144Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar), and that FTF-lacZ translation products would carry 19, 40, or 101 residues of the mFTF N-terminal domain (from three in-frame initiation codons in exons 1 and 3), with no DNA binding capacity and no other apparent regulatory function (6Galarneau L. Paré J.-F. Allard D. Hamel D. Lévesque L. Tugwood J.D. Green S. Bélanger L. Mol. Cell. Biol. 1996; 16: 3853-3865Crossref PubMed Google Scholar). For gene targeting in embryonic stem (ES) cells, mouse WW6 (129SV) ES cells (23Ioffe E. Liu Y. Bhaumik M. Poirier F. Factor S.M. Stanley P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7357-7361Crossref PubMed Scopus (66) Google Scholar) were grown on STO fibroblasts in high glucose Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum and recombinant LIF (24Charron J. Malynn B.A. Fisher P. Stewart V. Jeannotte L. Goff S.P. Robertson E.J. Alt F.W. Genes Dev. 1992; 6: 2248-2257Crossref PubMed Scopus (264) Google Scholar). ES cells were electroporated with FTF-lacZ plasmid DNA linearized with NotI, and cultured on neomycin-resistant STO fibroblasts for 14 days in selection medium containing 200 μg/ml G418 and 2 μm ganciclovir. Resistant colonies were genotyped by Southern blot using a mFTF probe flanking the SpeI site in intron 3 and detecting a 3.8-kb StuI fragment from the wild-type FTF allele and a 7.8-kb fragment from the mutant allele. Four ES clones carrying the lacZ-FTF allele were injected into mouse MF1 blastocysts which were then transferred to pseudopregnant C57BL/6J × CBA mice. The chimeric male progeny (129SV × MF1) was crossed with MF1 females to establish germ line transmission, and subsequent breeding was maintained in the 129SV × MF1 genetic background. Mice were housed in filter-topped microisolator cages, under 50–70 air changes per hour and 10:14 h dark/light cycle, and fed on Teklad standard chow TD2018. Neonatal mice were genotyped using tail DNA, by Southern blot as above or by PCR with neo gene primers 5′-GGGATCGGCCATTGAACAAGATGG-3′ and 5′-CGTAAAGCACGAGGAAGCGGTCAG-3′. Embryos from E9.5 onward were genotyped by Southern blot using yolk sac DNA. At E7.5 and E8.5, whole-embryo DNA was used with PCR primers from FTF exon 4 (5′-flanking the BglII lacZ insertion site) (ATGGTGAATTACTCCTATGATGAAG) and FTF exon 5 (GTAGGGACATCGTTTTCTCTGCC), generating a 1.7-kb product only from a wild-type FTF allele; the FTF primers also amplified a 204-bp segment from the FTF pseudogene (11Paré J.-F. Roy S. Galarneau L. Bélanger L. J. Biol. Chem. 2001; 276: 13136-13144Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar), common to all genotypes and providing an internal PCR control. At E5.5 and E6.5, we used in situ hybridization (below) to distinguish FTF-/- embryos from FTF+/+ or FTF+/- embryos. In Situ Hybridization—Conditions were adapted from Aubin et al. (25Aubin J. Lemieux M. Tremblay M. Berard J. Jeannotte L. Dev. Biol. 1997; 192: 432-445Crossref PubMed Scopus (166) Google Scholar) and Rausa et al. (26Rausa F.M. Ye H. Lim L. Duncan S.A. Costa R.H. Methods. 1998; 16: 29-41Crossref PubMed Scopus (22) Google Scholar). FTF riboprobes were generated from a 1.2-kb ClaI/HindIII mFTF cDNA fragment (nt 661–1856 in Ref. 6Galarneau L. Paré J.-F. Allard D. Hamel D. Lévesque L. Tugwood J.D. Green S. Bélanger L. Mol. Cell. Biol. 1996; 16: 3853-3865Crossref PubMed Google Scholar) cloned in pBluescript SK+: the sense probe was obtained with HindIII-digested DNA and T7 RNA polymerase and the antisense probe with ClaI-digested DNA and T3 RNA polymerase, with radiolabeling using [α-33P]UTP. HNF3β probes were obtained as before (10Rausa F.M. Galarneau L. Bélanger L. Costa R.H. Mech. Dev. 1999; 89: 185-188Crossref PubMed Scopus (73) Google Scholar). Embryos were fixed 15–20 h in 4% paraformaldehyde/PBS, dehydrated in ethanol and toluene, and embedded in paraffin. Whole mount sections (8 μm) were treated with xylene, ethanol and 4% paraformaldehyde, washed with PBS, and then treated for 7.5 min with proteinase K (20 μg/ml in 50 mm Tris, pH 8.0, 5 mm EDTA), washed with PBS and treated again with 4% paraformaldehyde and PBS. This was followed by a 10-min incubation in 0.25% acetic anhydride in 0.1 m triethanolamine, pH 8.0, washes in PBS, saline, and water, and dehydration in ethanol gradients (30–100%). Slides were then overlaid with 150 μl of 1:1 mix of formamide (Fisher Super Pure) and hybridization buffer (20 mm Tris, pH 7.5, 1.2 m NaCl, 4 mm EDTA, 2× Denhardt's, 1 mg/ml yeast tRNA, 200 μg/ml salmon sperm DNA) and incubated for 2 h at room temperature. Hybridization was conducted with 5 × 106 cpm of riboprobe overlaid on tissue sections in 75 μl of a 2:2:1 mix of hybridization buffer:formamide: 50% dextran sulfate and overnight incubation at 65 °C with a coverslip. Slides were then washed twice at 50 °C with 5× SSC and 10 mm dithiothreitol, once at 65 °C with 2× SSC, 50% formamide, and 20 mm dithiothreitol, followed by RNase A treatment (50 μg/ml), washes at 65 °C in 2× SSC and 50% formamide then at room temperature in 2× SSC and 0.1× SSC, and dehydration in ethanol gradients in 0.3 m NaOAc, pH 5.5. Slides were embedded in a Kodak emulsion and left 2–4 weeks in a dark dessicator at 4 °C. They were developed with the Kodak D19 reagent and stained with hematoxylin-eosin. LacZ Activity—Expression from the FTF/lacZ transgene was monitored by β-galactosidase staining on whole embryos or cryostat tissue sections, essentially as described by Larochelle et al. (27Larochelle C. Tremblay M. Bernier D. Aubin J. Jeannotte L. Dev. Dyn. 1999; 214: 127-140Crossref PubMed Scopus (37) Google Scholar). Embryos were fixed 5–30 min at 4 °C with 0.2% glutaraldehyde and 4% paraformaldehyde in PBS, washed three times with PBS, and stained 15–20 h at 30 °C in 4 mm K4Fe(CN)6·3H2O, 4 mm K3Fe(CN)6, 2 mm MgCl2, and 1 mg/ml X-gal in PBS. Morulae and blastocysts were treated with 0.5% Pronase 10 min at 37 °C before fixation. For tissue sections, organs were incubated overnight in 30% sucrose in PBS and embedded in OCT before freezing. Microarray Analysis—Liver gene expression profiles were established in 2–4-month-old male FTF+/- and FTF+/+ mice (groups of 4–6 littermates from 4 or 5 litters) fed a normal diet or a diet supplemented with cholesterol or cholic acid (below). Total liver RNA was purified using the RNeasy Mini Kit (Qiagen, Valencia, CA), quantitated by spectroscopy and pooled (equal amounts of RNA from each mouse). RNA labeling, hybridization, and image analysis were performed at the McGill University Genome Quebec Innovation Center, using the Affymetrix U74Av2 and 430A GeneChip arrays and GENECHIP data processing software (Affymetrix, Santa Clara, CA). Fold changes in mRNA levels were calculated for fluorescence intensities greater than 250. Northern Blots—Total liver RNA was purified with guanidine thiocyanate (28Chirgwin J.M. Przybyla A.E. MacDonald R.J. Rutter W.J. Biochemistry. 1979; 18: 5294-5299Crossref PubMed Scopus (16654) Google Scholar), and poly(A)+ RNA was isolated with the Oligotex mRNA Maxi Kit (Qiagen). Poly(A)+ RNA (15 μg) was run on a 1% agarose/10 mm guanidine thiocyanate gel, transferred onto a positively charged nylon membrane (Roche Applied Science), and hybridized with FTF, SHP, CYP7A1, and GAPDH cDNA probes PCR-labeled with digoxigenin-11-dUTP (Roche Applied Science). mRNA bands were detected with a chemiluminescence kit (Roche Applied Science) and quantitated with IMAGEQUANT (Molecular Dynamics). Quantitative PCR—Real-time quantitative PCR (qPCR) was used to determine the relative expression levels of liver FTF, SHP, CYP7A1, c-Jun, HNF1α, and HNF4α mRNAs. Total RNA (5 μg) was reverse-transcribed with oligo(dT) primer and Superscript II reverse transcriptase (Invitrogen). Quantitative PCR was carried out with 0.5% of the reverse transcription product in a 20-μl reaction volume of Platinum SYBR Green qPCR superMix UDG (Invitrogen), using the Light-Cycler 1.2 instrument and software (Roche Applied Science) and the following sets of primers: FTF forward, 5′-CCTATGATGAAGATCTGGAAGAGC-3′; FTF reverse, 5′-GTTTTCTCTGCGTTTTGTCAATTT-3′; SHP forward, 5′-AGCTGGGTCCCAAGGAGTAT-3′; SHP reverse, 5′-CTTGAGGGTAGAGGCCATGA-3′; CYP7A1 forward, 5′-TCCTTGAATATCCGGACAGC-3′; CYP7A1 reverse, 5′-TGGTCTTTGCTTTCCCACTT-3′; c-Jun forward, 5′-TCCCCTATCGACATGGAGTC3′; c-Jun reverse, 5′-TGAGTTGGCACCCACTGTTA-3′; HNF1α forward 5′-GCCTCCTCTTCCCAGTAACC-3′; HNF1α reverse 5′-GGAGCAGCAGTGTCAATGAA-3′; HNF4α forward 5′-TCCCAACAGATCACCTCTCC-3′; HNF4α reverse 5′-AGGAGCAGCACGTCCTTAAA-3′; GAPDH forward 5′-ACCCAGAAGACTGTGGATGG-3′; GAPDH reverse 5′-CACATTGGGGGTAGGAACAC-3′. Each reaction was carried out in triplicate and repeated at least twice. Relative mRNA expression levels were calculated by ΔΔCT analysis, using GAPDH mRNA for internal normalization. Electromobility Shift and Scatchard Assays—Saturation electromobility shift analyses were conducted in 2-month-old FTF+/+ and FTF+/- mice, as described before (6Galarneau L. Paré J.-F. Allard D. Hamel D. Lévesque L. Tugwood J.D. Green S. Bélanger L. Mol. Cell. Biol. 1996; 16: 3853-3865Crossref PubMed Google Scholar). Livers were pooled from five or more littermates per group, and tested in parallel. Five micrograms of total nuclear protein was incubated 30 min on ice with 0.9–9 nm 32P-labeled FTF probe TGTTCAAGGACA (from the AFP gene promoter) (6Galarneau L. Paré J.-F. Allard D. Hamel D. Lévesque L. Tugwood J.D. Green S. Bélanger L. Mol. Cell. Biol. 1996; 16: 3853-3865Crossref PubMed Google Scholar), and FTF-bound and free double-strand probes were resolved by PAGE and counted with a phosphorimager. Nonspecific binding (50-fold excess cold oligo) was subtracted, and net counts were used to obtain a Scatchard plot. EMSA analysis of the DR4-like sequence at position +6/+21 in the mFTF gene promoter was carried out with mFTF probe -1AGACATGGTTTACAGCAGGTCATAC+24 (probe F), its mutated version AGACATcaTTTAgAGCAttTCATAC (mF oligo), and DR4 elements from the CYP7A1 promoter (TGCTTTGGTCACTCAAGTTCAAGTTAT) (oligo 7A) (17del Castillo-Olivares A. Gil G. Nucleic Acids Res. 2000; 28: 3587-3593Crossref PubMed Google Scholar) and the ABC1 promoter (GCGCAGAGGTTACTATCGGTCAAAGCC) (oligo AB) (29Costet P. Luo Y. Wang N. Tall A.R. J. Biol. Chem. 2000; 275: 28240-28245Abstract Full Text Full Text PDF PubMed Scopus (851) Google Scholar). EMSAs used 3 μg of total nuclear proteins from adult rat liver and 0.2 ng of 32P-labeled F probe, coincubated 30 min at 4 °C with 20-fold molar excess of cold competitors. For EMSA-antibody assays, nuclear proteins were preincubated 1 h at 4 °C with 1 μl of antiserum against LXRα (Santa Cruz Biotechnology C19x), RXR (SCB ΔN197x, reacting against RXR α, β, and γ), TR (SCB FL-408x, reacting against TR α1 and β1), or FXR (SCB Q-20x). EMSA for HNF1 and HNF4 used probes GCTTAATCATTTCTT and GCAGGTGACCTTTGCCCAGCGCC and their mutant (lower case letters) version GCTTggTCATTTCTT and GCAGcTGcCCgTTtCgCAGCGCC. Western Blots—Western blot assays were used to determine the relative amounts of FTF, HNF1α, HNF4α, and C/EBPα proteins in liver nuclei from rats fed a high-cholesterol diet or treated with thyroid hormone (T3) (below). Total liver nuclear proteins (pooled from 5 rats) were resolved by SDS-PAGE and transferred onto Immobilon-P membranes (Millipore). Blotted membranes were blocked in TBS (40 mm Tris-HCl, pH 8.0, 0.2 m NaCl, 5% w/v nonfat dry milk, 0.1% Tween-20) 1 h at room temperature under agitation, and incubated 1 h with antisera against mouse FTF (1:1000 dilution in TBS), rat C/EBPα (1:10,000), human HNF4α (1:10,000) (Santa Cruz 6556x), or mouse HNF1α (1:1000) (BD Biosciences H69220). Membranes were washed four times in TBS and incubated for 1 h with a 1:10,000 TBS dilution of secondary antibody linked to horseradish peroxidase (Jackson ImmunoResearch Laboratories). After four more washes in TBS, reactions were developed using the Amersham Biosciences Enhanced Chemiluminescence System, and signals were quantitated using the NIH Image software. Samples from high cholesterol and T3 groups were analyzed in triplicate sets of 10 or 20 μg of nuclear proteins against standard curves run in parallel with 2.5–25 μg of liver nuclear proteins from control groups. Transfection Assays—Transfection assays were conducted with FTF reporter vector 4F-CAT, which carries mFTF gene segment -3.9 kb to +79 bp cloned into pBluescript SK-CAT (11Paré J.-F. Roy S. Galarneau L. Bélanger L. J. Biol. Chem. 2001; 276: 13136-13144Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Point mutations were introduced in the FTF DR4-like element using PCR (11Paré J.-F. Roy S. Galarneau L. Bélanger L. J. Biol. Chem. 2001; 276: 13136-13144Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar) and oligonucleotide primer GAAACTGGAGACATcaTTTAgAGCAttTCATACATGCTGGAAAAAGTGC; mutations (lower case letters) were confirmed by sequencing. Transient transfections followed a calcium phosphate procedure described before (5Bernier D. Thomassin H. Allard D. Guertin M. Hamel D. Blaquière M. Beauchemin M. LaRue H. Estable-Puig M. Bélanger L. Mol. Cell. Biol. 1993; 13: 1619-1633Crossref PubMed Google Scholar, 11Paré J.-F. Roy S. Galarneau L. Bélanger L. J. Biol. Chem. 2001; 276: 13136-13144Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar), and were conducted with HepG2 or Hep3B human hepatoma cells. Cells were cultured in DMEM containing 10% charcoal-stripped fetal bovine serum (Wisent) (DMEM/FBS). Cells (106, in DMEM/FBS) were plated in 6-cm dishes and transfected 24 h later with 5 μg of 4F-CAT reporter vector, 2–5 μg of transcription factor expression vector (pSG5-hRXRα, pCMX-hLXRα, pCMX-T3Rβ) (pSG5 or pCMX vectors were used for reference transfections), and 2.5 μg of pCMV-lacZ as an internal standard. Transfected cells were washed after 16 h with HEPES pH 7.3 and cultured in DMEM/FBS without or with ligands (9-cis-retinoic acid (1 μm), 22(R)-hydroxycholesterol (10 μm), or 3,3′,5-triiodothyronine (100 μm)) (Sigma). Cells were harvested 48 h after transfection, and CAT activity was measured by thin layer chromatography and phosphorimaging. Wild-type and mutant 4F-CAT constructs were also assayed as stable transfectants in Morris McA-RH7777 rat hepatoma cells (variant 7777.6) (4Guertin M. LaRue H. Bernier D. Wrange O. Chevrette M. Gingras M.-C. Bélanger L. Mol. Cell. Biol. 1988; 8: 1398-1407Crossref PubMed Scopus (79) Google Scholar), by cotransfection with CMV-neo, 10-day selection in G418, and measurement of CAT activity on pools of 200–300 clones per construct, as described before (4Guertin M. LaRue H. Bernier D. Wrange O. Chevrette M. Gingras M.-C. Bélanger L. Mol. Cell. Biol. 1988; 8: 1398-1407Crossref PubMed Scopus (79) Google Scholar, 5Bernier D. Thomassin H. Allard D. Guertin M. Hamel D. Blaquière M. Beauchemin M. LaRue H. Estable-Puig M. Bélanger L. Mol. Cell. Biol. 1993; 13: 1619-1633Crossref PubMed Google Scholar). Diets and Hormone Treatment—Serum cholesterol levels and liver gene expression profiles were analyzed in adult male FTF+/+ and FTF+/- mice (5 or more per group) fed for 5 days on 2% cholesterol diet Teklad TD86295 against control diet Teklad 7001, or fed for 5 days on 1% cholic acid diet Teklad TD00629 against control diet Teklad TD94045. Cholesterol was measured on a Beckman Coulter LX-20 analyzer with reagent 467825; group values were compared by Student's two-tailed unpaired t test. Changes in liver FTF levels were assessed in male Fisher rats (75–100 g, 5 per group) fed for 5 days on 2% cholesterol TD86295 diet versus control M/R7001 diet, and in male Sprague/Dawley rats (300 g, 5 per group, fed on regular Teklad chow TD97350) 5 or 24 h following intraperitoneal injection of 375 μg/kg triiodothyronine (Sigma) or saline vehicle. FTF Transgenic Mice—To assess FTF effect on CYP7A1 expression in vivo, we used a transgenic mouse line expressing FTF under the control of an inducible promoter. This system will be documented in detail elsewhere. Briefly, mFTF cDNA was ligated at its 5′-end with a hemagglutinin (HA) epitope sequence, and the HA-FTF cDNA was cloned in the NruI site of SK+-derived vector MT5′/3′ (30Palmiter R.D. Sandgren E.P. Koeller D.M. Brinster R.L. Mol. Cell. Biol. 1993; 13: 5266-5275Crossref PubMed Scopus (201) Google Scholar), placing the HA-FTF sequence under the control of the mouse metallothionein I (MTI) promoter. The MTI-HA-FTF recombinant vector, linearized with SalI, was microinjected into fe" @default.
• W2023306543 created "2016-06-24" @default.
• W2023306543 creator A5005765817 @default.
• W2023306543 creator A5025008213 @default.
• W2023306543 creator A5026360110 @default.
• W2023306543 creator A5052285140 @default.
• W2023306543 creator A5056081721 @default.
• W2023306543 creator A5077505878 @default.
• W2023306543 creator A5087067647 @default.
• W2023306543 date "2004-05-01" @default.
• W2023306543 modified "2023-09-28" @default.
• W2023306543 title "The Fetoprotein Transcription Factor (FTF) Gene Is Essential to Embryogenesis and Cholesterol Homeostasis and Is Regulated by a DR4 Element" @default.
• W2023306543 cites W1515234734 @default.
• W2023306543 cites W1549140967 @default.
• W2023306543 cites W1570388980 @default.
• W2023306543 cites W1571853300 @default.
• W2023306543 cites W1899233404 @default.
• W2023306543 cites W1965473282 @default.
• W2023306543 cites W1970383445 @default.
• W2023306543 cites W1974993651 @default.
• W2023306543 cites W1980110416 @default.
• W2023306543 cites W1989086831 @default.
• W2023306543 cites W1990819179 @default.
• W2023306543 cites W1999307950 @default.
• W2023306543 cites W2001090666 @default.
• W2023306543 cites W2003028861 @default.
• W2023306543 cites W2009624062 @default.
• W2023306543 cites W2012607246 @default.
• W2023306543 cites W2019826827 @default.
• W2023306543 cites W2027065906 @default.
• W2023306543 cites W2033708368 @default.
• W2023306543 cites W2045938951 @default.
• W2023306543 cites W2047116392 @default.
• W2023306543 cites W2050496471 @default.
• W2023306543 cites W2051040521 @default.
• W2023306543 cites W2055723072 @default.
• W2023306543 cites W2056647420 @default.
• W2023306543 cites W2058862223 @default.
• W2023306543 cites W2058877341 @default.
• W2023306543 cites W2059560408 @default.
• W2023306543 cites W2060333964 @default.
• W2023306543 cites W2060929301 @default.
• W2023306543 cites W2064586774 @default.
• W2023306543 cites W2064966728 @default.
• W2023306543 cites W2067123261 @default.
• W2023306543 cites W2068458442 @default.
• W2023306543 cites W2083119658 @default.
• W2023306543 cites W2083422904 @default.
• W2023306543 cites W2084307588 @default.
• W2023306543 cites W2086767004 @default.
• W2023306543 cites W2096294040 @default.
• W2023306543 cites W2096736856 @default.
• W2023306543 cites W2097418721 @default.
• W2023306543 cites W2111399322 @default.
• W2023306543 cites W2133201173 @default.
• W2023306543 cites W2135801344 @default.
• W2023306543 cites W2144668313 @default.
• W2023306543 cites W2146012023 @default.
• W2023306543 cites W2148354523 @default.
• W2023306543 cites W2166694150 @default.
• W2023306543 cites W2171474313 @default.
• W2023306543 cites W2605614532 @default.
• W2023306543 doi "https://doi.org/10.1074/jbc.m401523200" @default.
• W2023306543 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15014077" @default.
• W2023306543 hasPublicationYear "2004" @default.
• W2023306543 type Work @default.
• W2023306543 sameAs 2023306543 @default.
• W2023306543 citedByCount "139" @default.
• W2023306543 countsByYear W20233065432012 @default.
• W2023306543 countsByYear W20233065432013 @default.
• W2023306543 countsByYear W20233065432014 @default.
• W2023306543 countsByYear W20233065432015 @default.
• W2023306543 countsByYear W20233065432016 @default.
• W2023306543 countsByYear W20233065432017 @default.
• W2023306543 countsByYear W20233065432018 @default.
• W2023306543 countsByYear W20233065432019 @default.
• W2023306543 countsByYear W20233065432020 @default.
• W2023306543 countsByYear W20233065432021 @default.
• W2023306543 countsByYear W20233065432022 @default.
• W2023306543 countsByYear W20233065432023 @default.
• W2023306543 crossrefType "journal-article" @default.
• W2023306543 hasAuthorship W2023306543A5005765817 @default.
• W2023306543 hasAuthorship W2023306543A5025008213 @default.
• W2023306543 hasAuthorship W2023306543A5026360110 @default.
• W2023306543 hasAuthorship W2023306543A5052285140 @default.
• W2023306543 hasAuthorship W2023306543A5056081721 @default.
• W2023306543 hasAuthorship W2023306543A5077505878 @default.
• W2023306543 hasAuthorship W2023306543A5087067647 @default.
• W2023306543 hasBestOaLocation W20233065431 @default.
• W2023306543 hasConcept C104317684 @default.
• W2023306543 hasConcept C138885662 @default.
• W2023306543 hasConcept C179926584 @default.
• W2023306543 hasConcept C196843134 @default.
• W2023306543 hasConcept C41895202 @default.
• W2023306543 hasConcept C54355233 @default.
• W2023306543 hasConcept C63645605 @default.
• W2023306543 hasConcept C86339819 @default.
• W2023306543 hasConcept C86803240 @default.

• next