FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023336267> ?p ?o ?g. }

• W2023336267 endingPage "22914" @default.
• W2023336267 startingPage "22899" @default.
• W2023336267 abstract "The CXCR4 chemokine receptor promotes survival of many different cell types. Here, we describe a previously unsuspected role for CXCR4 as a potent inducer of apoptosis in acute myeloid leukemia (AML) cell lines and a subset of clinical AML samples. We show that SDF-1, the sole ligand for CXCR4, induces the expected migration and ERK activation in the KG1a AML cell line transiently overexpressing CXCR4, but ERK activation did not lead to survival. Instead, SDF-1 treatment led via a CXCR4-dependent mechanism to apoptosis, as evidenced by increased annexin V staining, condensation of chromatin, and cleavage of both procaspase-3 and PARP. This SDF-1-induced death pathway was partially inhibited by hypoxia, which is often found in the bone marrow of AML patients. SDF-1-induced apoptosis was inhibited by dominant negative procaspase-9 but not by inhibition of caspase-8 activation, implicating the intrinsic apoptotic pathway. Further analysis showed that this pathway was activated by multiple mechanisms, including up-regulation of Bak at the level of mRNA and protein, stabilization of the Bak activator Noxa, and down-regulation of antiapoptotic Bcl-XL. Furthermore, adjusting expression levels of Bak, Bcl-XL, or Noxa individually altered the level of apoptosis in AML cells, suggesting that the combined modulation of these family members by SDF-1 coordinates their interplay to produce apoptosis. Thus, rather than mediating survival, SDF-1 may be a means to induce apoptosis of CXCR4-expressing AML cells directly in the SDF-1-rich bone marrow microenvironment if the survival cues of the bone marrow are disrupted.Background: The chemokine receptor CXCR4 plays a role in AML.Results: SDF-1, the ligand of CXCR4, induces apoptosis in AML cell lines and patient samples via modulation of Bcl-2 family members.Conclusion: SDF-1 induces apoptosis of AML cells via up-regulation of Bak and Noxa and down-regulation of Bcl-XL.Significance: SDF-1/CXCR4 signaling could induce AML cell apoptosis if bone marrow survival cues can be disrupted. The CXCR4 chemokine receptor promotes survival of many different cell types. Here, we describe a previously unsuspected role for CXCR4 as a potent inducer of apoptosis in acute myeloid leukemia (AML) cell lines and a subset of clinical AML samples. We show that SDF-1, the sole ligand for CXCR4, induces the expected migration and ERK activation in the KG1a AML cell line transiently overexpressing CXCR4, but ERK activation did not lead to survival. Instead, SDF-1 treatment led via a CXCR4-dependent mechanism to apoptosis, as evidenced by increased annexin V staining, condensation of chromatin, and cleavage of both procaspase-3 and PARP. This SDF-1-induced death pathway was partially inhibited by hypoxia, which is often found in the bone marrow of AML patients. SDF-1-induced apoptosis was inhibited by dominant negative procaspase-9 but not by inhibition of caspase-8 activation, implicating the intrinsic apoptotic pathway. Further analysis showed that this pathway was activated by multiple mechanisms, including up-regulation of Bak at the level of mRNA and protein, stabilization of the Bak activator Noxa, and down-regulation of antiapoptotic Bcl-XL. Furthermore, adjusting expression levels of Bak, Bcl-XL, or Noxa individually altered the level of apoptosis in AML cells, suggesting that the combined modulation of these family members by SDF-1 coordinates their interplay to produce apoptosis. Thus, rather than mediating survival, SDF-1 may be a means to induce apoptosis of CXCR4-expressing AML cells directly in the SDF-1-rich bone marrow microenvironment if the survival cues of the bone marrow are disrupted. Background: The chemokine receptor CXCR4 plays a role in AML. Results: SDF-1, the ligand of CXCR4, induces apoptosis in AML cell lines and patient samples via modulation of Bcl-2 family members. Conclusion: SDF-1 induces apoptosis of AML cells via up-regulation of Bak and Noxa and down-regulation of Bcl-XL. Significance: SDF-1/CXCR4 signaling could induce AML cell apoptosis if bone marrow survival cues can be disrupted. The bone marrow microenvironment provides a variety of signals that promote the survival of acute myeloid leukemia (AML) 2The abbreviations used are: AML, acute myeloid leukemia; BMSC, bone marrow-derived stromal cells; PARP, poly(ADP-ribose) polymerase; PTX, pertussis toxin; Q-VD-OPh, (3S)-5-(2,6-Difluorophenoxy)-3-[[(2S)-3-methyl-1-oxo-2-[(2-quinolinylcarbonyl)amino]butyl]amino]-4-oxo-pentanoic acid; DN-Casp-9, dominant negative caspase-9; APC, allophycocyanin. cells. Both the endosteal and vascular niches provide an environment that supports normal hematopoietic stem cells as well as leukemic stem cells. A variety of cytokines, chemokines, and integrins present in these niches mediate both the homing and survival signals necessary to propagate leukemia. In addition, the expansion of hypoxic areas during the development of leukemia leads to additional signals that support the proliferation and survival of AML cells (1.Doan P.L. Chute J.P. The vascular niche. Home for normal and malignant hematopoietic stem cells.Leukemia. 2012; 26: 54-62Crossref PubMed Scopus (99) Google Scholar, 2.Konopleva M.Y. Jordan C.T. Leukemia stem cells and microenvironment. Biology and therapeutic targeting.J. Clin. Oncol. 2011; 29: 591-599Crossref PubMed Scopus (322) Google Scholar). Determining which of these signaling events are critical for the survival of AML cells will help to identify a strategy to disrupt the protection that the bone marrow microenvironment provides for AML cells. CXCR4 is a G-protein-coupled chemokine receptor that signals in response to its sole physiological ligand, SDF-1 (stromal cell-derived factor-1; also known as CXCL12). CXCR4 has been characterized as a key player in the development of AML due to the abundant expression of SDF-1 within the bone marrow microenvironment. CXCR4 expression is essential for enabling AML cells to home to the bone marrow (1.Doan P.L. Chute J.P. The vascular niche. Home for normal and malignant hematopoietic stem cells.Leukemia. 2012; 26: 54-62Crossref PubMed Scopus (99) Google Scholar, 2.Konopleva M.Y. Jordan C.T. Leukemia stem cells and microenvironment. Biology and therapeutic targeting.J. Clin. Oncol. 2011; 29: 591-599Crossref PubMed Scopus (322) Google Scholar, 3.Ceradini D.J. Kulkarni A.R. Callaghan M.J. Tepper O.M. Bastidas N. Kleinman M.E. Capla J.M. Galiano R.D. Levine J.P. Gurtner G.C. Progenitor cell trafficking is regulated by hypoxic gradients through HIF-1 induction of SDF-1.Nat. Med. 2004; 10: 858-864Crossref PubMed Scopus (2211) Google Scholar). Conversely, the CXCR4 antagonist AMD3100 causes mobilization of cells from the protective bone marrow microenvironment. This agent has been approved by the Food and Drug Administration for treatment of lymphoma and multiple myeloma in combination with chemotherapeutics to target the displaced cancer cells. In contrast, AMD3100 has not thus far been approved for treatment of AML (4.Pusic I. DiPersio J.F. Update on clinical experience with AMD3100, an SDF-1/CXCL12-CXCR4 inhibitor, in mobilization of hematopoietic stem and progenitor cells.Curr. Opin. Hematol. 2010; 17: 319-326Crossref PubMed Scopus (113) Google Scholar). Although AMD3100 does mobilize a majority of AML cells from the bone marrow, the leukemic stem cells appear to resist mobilization, remain in the bone marrow, and contribute to the relapse seen in the murine models (5.Clements D. Markwick L.J. Puri N. Johnson S.R. Role of the CXCR4/CXCL12 axis in lymphangioleiomyomatosis and angiomyolipoma.J. Immunol. 2010; 185: 1812-1821Crossref PubMed Scopus (16) Google Scholar, 6.Monaco G. Konopleva M. Munsell M. Leysath C. Wang R.Y. Jackson C.E. Korbling M. Estey E. Belmont J. Andreeff M. Engraftment of acute myeloid leukemia in NOD/SCID mice is independent of CXCR4 and predicts poor patient survival.Stem Cells. 2004; 22: 188-201Crossref PubMed Scopus (41) Google Scholar, 7.Stölzel F. Wermke M. Rollig C. Thiede C. Platzbecker U. Bornhauser M. Mobilization of PML/RARalpha negative peripheral blood stem cells with a combination of G-CSF and CXCR4 blockade in relapsed acute promyelocytic leukemia pre-treated with arsenic trioxide.Haematologica. 2010; 95: 171-172Crossref PubMed Scopus (7) Google Scholar, 8.Zeng Z. Shi Y.X. Samudio I.J. Wang R.Y. Ling X. Frolova O. Levis M. Rubin J.B. Negrin R.R. Estey E.H. Konoplev S. Andreeff M. Konopleva M. Targeting the leukemia microenvironment by CXCR4 inhibition overcomes resistance to kinase inhibitors and chemotherapy in AML.Blood. 2009; 113: 6215-6224Crossref PubMed Scopus (423) Google Scholar, 9.Tavor S. Petit I. Porozov S. Avigdor A. Dar A. Leider-Trejo L. Shemtov N. Deutsch V. Naparstek E. Nagler A. Lapidot T. CXCR4 regulates migration and development of human acute myelogenous leukemia stem cells in transplanted NOD/SCID mice.Cancer Res. 2004; 64: 2817-2824Crossref PubMed Scopus (290) Google Scholar). These unexpected effects indicate the need to better understand the role of CXCR4 in AML. In addition to initiating migration and ERK activation, CXCR4 has also been shown to contribute to apoptosis in a variety of cell types. In response to prolonged exposure to SDF-1, CXCR4 has been shown to induce apoptosis in T cells and colorectal carcinoma cells (10.Colamussi M.L. Secchiero P. Gonelli A. Marchisio M. Zauli G. Capitani S. Stromal derived factor-1 α (SDF-1 α) induces CD4+ T cell apoptosis via the functional up-regulation of the Fas (CD95)/Fas ligand (CD95L) pathway.J. Leukoc. Biol. 2001; 69: 263-270PubMed Google Scholar, 11.Herbein G. Mahlknecht U. Batliwalla F. Gregersen P. Pappas T. Butler J. O'Brien W.A. Verdin E. Apoptosis of CD8+ T cells is mediated by macrophages through interaction of HIV gp120 with chemokine receptor CXCR4.Nature. 1998; 395: 189-194Crossref PubMed Scopus (362) Google Scholar, 12.Drury L.J. Wendt M.K. Dwinell M.B. CXCL12 chemokine expression and secretion regulates colorectal carcinoma cell anoikis through Bim-mediated intrinsic apoptosis.PLoS One. 2010; 5: e12895Crossref PubMed Scopus (38) Google Scholar). Moreover, lymphocytes, neurons, breast cancer cells, endothelial cells, and cardiomyocytes all undergo apoptosis in response to CXCR4 binding to gp120, the envelope glycoprotein of HIV-1 (13.Castedo M. Perfettini J.L. Andreau K. Roumier T. Piacentini M. Kroemer G. Mitochondrial apoptosis induced by the HIV-1 envelope.Ann. N.Y. Acad. Sci. 2003; 1010: 19-28Crossref PubMed Scopus (41) Google Scholar, 14.Ullrich C.K. Groopman J.E. Ganju R.K. HIV-1 gp120- and gp160-induced apoptosis in cultured endothelial cells is mediated by caspases.Blood. 2000; 96: 1438-1442Crossref PubMed Google Scholar, 15.Endo M. Inatsu A. Hashimoto K. Takamune N. Shoji S. Misumi S. Human immunodeficiency virus-induced apoptosis of human breast cancer cells via CXCR4 is mediated by the viral envelope protein but does not require CD4.Curr. HIV Res. 2008; 6: 34-42Crossref PubMed Scopus (18) Google Scholar, 16.Lusso P. HIV and the chemokine system. 10 years later.EMBO J. 2006; 25: 447-456Crossref PubMed Scopus (173) Google Scholar). Previous studies have suggested that CXCR4 can activate death signaling via either the extrinsic or intrinsic pathway. The extrinsic pathway is triggered when ligands on initiator cells bind to death receptors on target cells, leading to caspase-8 activation and downstream apoptotic events in those target cells. The intrinsic apoptotic pathway is activated by changes that tip the balance between anti- and proapoptotic members of the Bcl-2 family. Upon activation, the effector members of this family, Bak and Bax, oligomerize and permeabilize the outer mitochondrial membrane, resulting in the release of cytochrome c, activation of procaspase-9, and subsequent caspase-mediated cleavages. The effectors are in turn regulated by the two other classes of Bcl-2 family members. The BH3-only-containing proapoptotic members, which include Bim, Puma, Bid, and Noxa, promote apoptosis by directly binding and inducing the oligomerizaton of Bak and/or Bax or by neutralizing the antiapoptotic members. The antiapoptotic family members directly bind and antagonize Bak and Bax or sequester the BH3-only family members to prevent interactions with the effectors (17.Kaufmann S.H. Earnshaw W.C. Induction of apoptosis by cancer chemotherapy.Exp. Cell Res. 2000; 256: 42-49Crossref PubMed Scopus (1067) Google Scholar, 18.Shamas-Din A. Brahmbhatt H. Leber B. Andrews D.W. BH3-only proteins. Orchestrators of apoptosis.Biochim. Biophys. Acta. 2011; 1813: 508-520Crossref PubMed Scopus (262) Google Scholar, 19.Opferman J.T. Apoptosis in the development of the immune system.Cell Death Differ. 2008; 15: 234-242Crossref PubMed Scopus (88) Google Scholar). In AML cells, various reagents have been described to induce apoptosis via altering levels of different Bcl-2 family members, suggesting that AML cells are sensitive to regulation of Bcl-2 family proteins (20.Rahmani M. Aust M.M. Attkisson E. Williams Jr., D.C. Ferreira-Gonzalez A. Grant S. Inhibition of Bcl-2 antiapoptotic members by obatoclax potently enhances sorafenib-induced apoptosis in human myeloid leukemia cells through a Bim-dependent process.Blood. 2012; 119: 6089-6098Crossref PubMed Scopus (86) Google Scholar, 21.Schimmer A.D. Novel therapies targeting the apoptosis pathway for the treatment of acute myeloid leukemia.Curr. Treat. Options Oncol. 2007; 8: 277-286Crossref PubMed Scopus (25) Google Scholar, 22.Fathi A.T. Grant S. Karp J.E. Exploiting cellular pathways to develop new treatment strategies for AML.Cancer Treat. Rev. 2010; 36: 142-150Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 23.Konopleva M. Milella M. Ruvolo P. Watts J.C. Ricciardi M.R. Korchin B. McQueen T. Bornmann W. Tsao T. Bergamo P. Mak D.H. Chen W. McCubrey J. Tafuri A. Andreeff M. MEK inhibition enhances ABT-737-induced leukemia cell apoptosis via prevention of ERK-activated MCL-1 induction and modulation of MCL-1/BIM complex.Leukemia. 2012; 26: 778-787Crossref PubMed Scopus (113) Google Scholar). Many studies analyzing the role of CXCR4 in AML have focused on inhibiting CXCR4 signaling by utilizing AMD3100 or other CXCR4 antagonists. Based on these prior studies, we set out to determine the signaling mechanisms involved in SDF-1-mediated survival of AML cells. However, we found that SDF-1 did not promote AML cell survival but instead induced apoptosis of AML cells expressing CXCR4. Here, we characterize a novel SDF-1-mediated apoptosis pathway in AML cells and provide evidence suggesting that this intrinsic apoptotic mechanism is normally suppressed within the bone marrow microenvironment. These results describe a new role for SDF-1/CXCR4 signaling in AML cells and indicate that SDF-1/CXCR4 functions in AML are more complex than previously appreciated. Reagents were obtained from the following suppliers: the broad spectrum caspase inhibitor Q-VD-OPh (SM Biochemicals, Anaheim, CA); Calcein-AM (Invitrogen); SDF-1 (R&D Systems, Minneapolis, MN); pertussis toxin and control toxin (pertussis toxin B-oligomer) (Millipore, Billerica, MA); and Hoechst 33258, cytarabine, cycloheximide, and AMD3100 (Sigma-Aldrich). CCX704 and CCX711 were kind gifts from ChemoCentryx (Mountain View, CA). PD325901 and CI-1040 (Parke Davis, Ann Arbor, MI) were kind gifts from Judith Siebolt. Antibodies for immunoblotting or flow cytometry were obtained from the following suppliers: rabbit anti-Bak (Millipore); rabbit polyclonal antibodies to Bax, Bim, Bcl-XL, Mcl-1, and procaspase-9 (Cell Signaling Technology, Danvers, MA); murine monoclonal anti-Bcl-2 (Dako, Carpenteria, CA); murine monoclonal anti-Noxa (Enzo Life Sciences, Farmingdale, NY); murine monoclonal anti-GFP (Clontech); murine monoclonal anti-actin (Novus Biologicals, Littleton, CO); rabbit anti-ERK (Santa Cruz Biotechnology, Inc., Dallas, TX); murine monoclonal antibodies to CXCR4, CXCR7, and EGFR (R&D Systems); and APC-conjugated annexin V, Alexafluor-647-conjugated antibody to cleaved PARP, and an active caspase-3 apoptosis kit (BD Biosciences). After informed consent was obtained, samples of bone marrow were harvested from AML patients prior to chemotherapy according to an institutional review board-approved protocol. Following sedimentation on a Ficoll-Paque (1.077 g/cm3) step gradient (24.English D. Andersen B.R. Single-step separation of red blood cells. Granulocytes and mononuclear leukocytes on discontinuous density gradients of Ficoll-Hypaque.J. Immunol. Methods. 1974; 5: 249-252Crossref PubMed Scopus (577) Google Scholar), mononuclear cells were recovered and cultured in Medium A (RPMI 1640 supplemented with 10% FCS, 2 mm l-glutamine, 1 mm sodium pyruvate, non-essential amino acids, and 5.5 μm β-mercaptoethanol) at a density of 1 million cells/ml. The AML cell lines, KG1a and U937, and the E6 Jurkat acute T cell leukemia line (ATCC, Manassas, VA) were cultured in RPMI supplemented with 10% FCS at a cell density of 0.6–1.0 million cells/ml. HeLa cells (ATCC) were cultured to confluence in RPMI supplemented with 10% FCS. To generate CXCR4-expressing KG1a, U937, and E6 Jurkat cells, we transiently transfected cells with a plasmid encoding a CXCR4-YFP fluorescent fusion protein (25.Kumar A. Humphreys T.D. Kremer K.N. Bramati P.S. Bradfield L. Edgar C.E. Hedin K.E. CXCR4 physically associates with the T cell receptor to signal in T cells.Immunity. 2006; 25: 213-224Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar) using a BTX 830 square wave electroporator at 240 V for 10 ms, incubated for 16–18 h to allow expression of the transgene, and treated as indicated in the various figures. The transfection efficiencies of KG1a and U937 with control YFP empty vector were typically 10–20% and 10–15%, respectively. The E6 Jurkat T cell line was transfected as described previously (25.Kumar A. Humphreys T.D. Kremer K.N. Bramati P.S. Bradfield L. Edgar C.E. Hedin K.E. CXCR4 physically associates with the T cell receptor to signal in T cells.Immunity. 2006; 25: 213-224Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar). Flow cytometric data were gated to compare cells expressing similar levels of YFP. To stably suppress either Bak or Bim protein expression, KG1a cells were transduced with lentiviral particles that target the sequence CCCATTCACTACAGGTGAA for Bak or GACCGAGAAGGTAGACAATTGC for Bim in pSIH-H1, respectively (26.Kepp O. Rajalingam K. Kimmig S. Rudel T. Bak and Bax are non-redundant during infection- and DNA damage-induced apoptosis.EMBO J. 2007; 26: 825-834Crossref PubMed Scopus (57) Google Scholar, 27.Huang S. Okumura K. Sinicrope F.A. BH3 mimetic obatoclax enhances TRAIL-mediated apoptosis in human pancreatic cancer cells.Clin. Cancer Res. 2009; 15: 150-159Crossref PubMed Scopus (81) Google Scholar). Following transfection of plasmids encoding shRNA or empty vector into HEK293 cells along with the packaging plasmids psPAX2 and pMD2.G, supernatants were collected and filtered through 0.45-μm filters. After viral infection on two successive days, KG1a cells were cultured in medium containing 2 μg/ml puromycin for a week. Bak- and Bim-specific antibodies were used to assay Bak and Bim expression via Western blot. To transiently suppress Noxa, Bak, or Bim protein expression, KG1a or Jurkat cells were transiently transfected as indicated above with the following siRNAs from Ambion (Austin, TX): Control siRNA (Silencer® Negative Control 1); Noxa siRNA (sense, 5′-GGAGAUUUGGAGACAAACUTT-3′; antisense, 5′-AGUUUGUCUCCAAAUCUCCTG-3′); Bak siRNA (sense, GUACGAAGAUUCUUCAAAUTT; antisense, AUUUGAAGAAUCUUCGUACCA); and Bim siRNA (sense, 5′-GACCGAGAAGGUAGACAAUTT-3′; antisense, 5′-AUUGUCUACCUUCUCGGUCTT-3′). The cells were cultured for 6–7 h prior to the addition of SDF-1. Depletion of Noxa, Bak, and Bim was confirmed by immunoblotting with specific antibodies using lysates prepared 24 h after transfection. Tert-immortalized bone marrow-derived stromal cells (BMSC) were a kind gift of Dario Campana (St. Jude Children's Research Hospital, Memphis, TN) (28.Iwamoto S. Mihara K. Downing J.R. Pui C.H. Campana D. Mesenchymal cells regulate the response of acute lymphoblastic leukemia cells to asparaginase.J. Clin. Invest. 2007; 117: 1049-1057Crossref PubMed Scopus (261) Google Scholar, 29.Mihara K. Imai C. Coustan-Smith E. Dome J.S. Dominici M. Vanin E. Campana D. Development and functional characterization of human bone marrow mesenchymal cells immortalized by enforced expression of telomerase.Br. J. Haematol. 2003; 120: 846-849Crossref PubMed Scopus (112) Google Scholar). BMSC were cultured in RPMI supplemented with 10% FCS, 2 mm l-glutamine, and 1 μm hydrocortisone prior to the addition of AML isolates, at which time the coculture was maintained in Medium A. Clinical AML isolates were cultured for 16–18 h in Medium A and then assayed for CXCR4 cell surface expression by flow cytometry (30.Kumar A. Kremer K.N. Dominguez D. Tadi M. Hedin K.E. Gα13 and Rho mediate endosomal trafficking of CXCR4 into Rab11+ vesicles upon stromal cell-derived factor-1 stimulation.J. Immunol. 2011; 186: 951-958Crossref PubMed Scopus (48) Google Scholar) after staining with a CXCR4 monoclonal antibody. For assaying total cellular CXCR4 levels, cells were incubated at 37 °C for 10 min in BD Phosflow Lyse/Fix buffer; sedimented; permeabilized on ice for 30 min with BD Perm Buffer III; washed with BD stain buffer (BD Biosciences); stained with either CXCR4 mAb or a control, anti-EGFR mAb, for 30 min at room temperature; and assayed by flow cytometry. Where indicated, the KG1a cells were treated with 5 × 10−8 m SDF-1 for 20 min prior to staining for CXCR4. KG1a cells were transfected with either CXCR4-YFP or YFP empty vector and cultured for 18 h prior to the migration assay or ERK activation assay. For the migration assay, the cells were stained with calcein-AM and assayed for migration as described (31.Kremer K.N. Clift I.C. Miamen A.G. Bamidele A.O. Qian N.X. Humphreys T.D. Hedin K.E. Stromal cell-derived factor-1 signaling via the CXCR4-TCR heterodimer requires phospholipase C-β3 and phospholipase C-γ1 for distinct cellular responses.J. Immunol. 2011; 187: 1440-1447Crossref PubMed Scopus (33) Google Scholar). Where indicated, either 10 μm PD325901, 10 μm CI-1040, or DMSO (vehicle) was added 16–18 h prior to the addition of SDF-1, or either 100 ng/ml pertussis toxin or its control toxin was added 4 h prior to the addition of SDF-1. For analysis of active phospho-ERK, cells were stimulated ± 5 × 10−8 m SDF-1 and assayed by flow cytometry (31.Kremer K.N. Clift I.C. Miamen A.G. Bamidele A.O. Qian N.X. Humphreys T.D. Hedin K.E. Stromal cell-derived factor-1 signaling via the CXCR4-TCR heterodimer requires phospholipase C-β3 and phospholipase C-γ1 for distinct cellular responses.J. Immunol. 2011; 187: 1440-1447Crossref PubMed Scopus (33) Google Scholar). Flow cytometric data were gated to compare ERK phosphorylation in cells expressing similar levels of YFP. For assays measuring apoptosis, the indicated cells were cultured at 0.25 × 106 cells/ml in the presence or absence of 1.3 × 10−8 m SDF-1 or 6 ng/ml CH.11 agonistic anti-Fas antibody (Millipore) for 16–18 h and then assayed for apoptosis using one of the techniques listed below. Where indicated, 30 μm AMD3100, 1 μm CCX704, 1 μm CCX771, 10 μm PD325901, 10 μm CI-1040 was added 1 h prior to the addition of SDF-1; 100 ng/ml pertussis toxin or its control toxin was added 4 h prior to the addition of SDF-1; cells were placed in a hypoxia chamber at 37 °C, 5% CO2, and 1% O2 for 16–18 h prior to the annexin V staining; cells were incubated for 2 h under hypoxic or normoxic conditions and then treated with 1 μm cytarabine for 16–18 h in the indicated oxygen conditions; cells were cotransfected with CXCR4-YFP and a plasmid encoding the viral c-FLIP homolog MC159 (a kind gift from Greg Gores, Mayo Clinic, Rochester, MN), a dominant-negative caspase-9/EGFP fusion protein (obtained from Emad Alnemri, Thomas Jefferson University, Philadelphia, PA), or human Noxa with L29A and D34A mutations (Noxa-2A) (32.Dai H. Smith A. Meng X.W. Schneider P.A. Pang Y.P. Kaufmann S.H. Transient binding of an activator BH3 domain to the Bak BH3-binding groove initiates Bak oligomerization.J. Cell Biol. 2011; 194: 39-48Crossref PubMed Scopus (119) Google Scholar) fused to EGFP or S-peptide-tagged-Bcl-XL; or cells were transfected with GFP-Bak or GFP-Noxa. MC159 expression was confirmed via semiquantitative RT-PCR with the following primers: MC159 Forward, ATGTCCGACTCCAAGGAGGTCCCTAG; MC159 Reverse, TCAAGTCGTTTGCTCGGGGCTGTCGCTG; GAPDH Forward, GGCAAATTCCATGGCACCGTCAGG; GAPDH Reverse, GGAGGCATTGCTGATGATCCTGAGG. For detecting cell surface phosphatidylserine, cells were stained with APC-conjugated annexin V as described (33.Lee S.H. Meng X.W. Flatten K.S. Loegering D.A. Kaufmann S.H. Phosphatidylserine exposure during apoptosis reflects bidirectional trafficking between plasma membrane and cytoplasm.Cell Death Differ. 2013; 20: 64-76Crossref PubMed Scopus (140) Google Scholar). To detect fragmented nuclei, cells were washed with PBS, resuspended in 3:1 methanol/acetic acid, incubated at room temperature for 1 h, centrifuged, and mounted in 50% glycerol, 50% 0.1 m Tris-HCl (pH 7.4) containing 1 μg/ml Hoechst 33258 (34.Meng X.W. Heldebrant M.P. Kaufmann S.H. Phorbol 12-myristate 13-acetate inhibits death receptor-mediated apoptosis in Jurkat cells by disrupting recruitment of Fas-associated polypeptide with death domain.J. Biol. Chem. 2002; 277: 3776-3783Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar). The cells were then visualized 16 h later with Hoechst/DAPI filters. Cleaved PARP and active caspase-3 were assayed by flow microfluorimetry in YFP-positive cells using an Alexafluor-647-conjugated antibody to cleaved PARP and an active caspase-3 apoptosis kit, respectively, according to the suppliers' instructions. AML isolates were cultured in Medium A for 1–2 h prior to plating on BMSC. The isolates were plated at a density of 0.25 × 106 cells/ml onto a confluent layer of BMSC for 1 h, and then 5 × 10−8 m SDF-1 was added for 16–18 h in Medium A. Annexin V staining was performed as described above. For the quantitative RT-PCR and the immunoblots of Bcl-2 family members, KG1a cells were transfected with CXCR4-YFP, treated with 5 μm Q-VD-OPh, cultured for 16–18 h ± SDF-1, and then sorted for the brightest 12% of YFP-expressing cells. The quantitative RT-PCR was performed in triplicate using 100 ng of RNA and TaqMan One-Step RT-PCR Master Mix (Applied Biosystems) per the supplier's instructions. Using GAPDH (4352934E), Bak (Hs00832876_g1), Bax (Hs00180269_m1), Bcl-2 (Hs00608023_m1), Bcl2A1 (Hs00187845_m1), Bcl-XL (Hs00236329_m1), Bim (Hs00197982_m1), Mcl-1 (Hs03043898_m1), Noxa (Hs00560402_m1), Bmf (Hs00372937_m1), and BNIP3 (Hs00969291_m1) probe sets, the PCR was performed as described previously (35.Gupta M. Hendrickson A.E. Yun S.S. Han J.J. Schneider P.A. Koh B.D. Stenson M.J. Wellik L.E. Shing J.C. Peterson K.L. Flatten K.S. Hess A.D. Smith B.D. Karp J.E. Barr S. Witzig T.E. Kaufmann S.H. Dual mTORC1/mTORC2 inhibition diminishes Akt activation and induces Puma-dependent apoptosis in lymphoid malignancies.Blood. 2012; 119: 476-487Crossref PubMed Scopus (84) Google Scholar). For detection of protein levels of the Bcl-2 family members by Western blot, the sorted cells were sedimented at 200 × g for 10 min, washed once with ice-cold RPMI 1640 medium containing 10 mm HEPES (pH 7.4 at 4 °C), and prepared for electrophoresis as described (36.Kaufmann S.H. Okret S. Wikström A.C. Gustafsson J.A. Shaper J.H. Binding of the glucocorticoid receptor to the rat liver nuclear matrix. The role of disulfide bond formation.J. Biol. Chem. 1986; 261: 11962-11967Abstract Full Text PDF PubMed Google Scholar). KG1a cells were cotransfected with CXCR4-YFP and Noxa2A-GFP; cultured for 16 h with the caspase inhibitor Q-VD-OPh in the presence or absence of SDF-1; and then treated with 25 μg/ml cycloheximide for the indicated time, fixed with paraformaldehyde, and analyzed via flow microfluorimetry for Noxa2A-GFP expression in gated CXCR4-YFP-positive cells. The amount of Noxa2A-GFP remaining after the indicated cycloheximide treatment was determined as a percentage of the Noxa2A-GFP present at the 0 h time point. In initial experiments, we observed that CXCR4 is expressed at varying levels on the cell surface of primary AML cells from patient bone marrow (Fig. 1A). We also confirmed that CXCR4 is expressed intracellularly in patient samples, as indicated by the increased signal observed upon permeabilizing the plasma membrane prior to CXCR4 staining (Fig. 1B). Patient data shown in Fig. 1, A and B, are representative of all patients analyzed during the study period (supplemental Table 1). These results confirm previous findings that CXCR4 is expressed variably on the cell surface of AML isolates and that CXCR4 is maintained intracellularly at high levels in most AML isolates (9.Tavor S. Petit I. Porozov S. Avigdor A. Dar A. Leider-Trejo L. Shemtov N. Deutsch V. Naparstek E. Nagler A. Lapidot T. CXCR4 regulates migration and development of human acute myelogenous leukemia stem cells in transplanted NOD/SCID mice.Cancer Res. 2004; 64: 2817-2824Crossref PubMed Scopus (290) Google Scholar, 37.Mohle R. Bautz F. Rafii S. Moore M.A. Brugger W. Kanz L. The chemokine receptor CXCR-4 is expressed on CD34+ hematopoietic progenitors and leukemic cells and mediates transendothelial migration induced by stromal cell-derived factor-1.Blood. 1998; 91: 4523-4530Crossref PubMed Google Scholar, 38.Spinello I. Quaranta M.T. Riccioni R. Riti V. Pasquini L. Boe A. Pelosi E. Vitale A. Foa R. Testa U. Labbaye C. MicroRNA-146a and AMD3100, two ways to control CXCR4 expression in acute myeloid leukemias.Blood Cancer J. 2011; 1: e26Crossref PubMed Scopus (" @default.
• W2023336267 created "2016-06-24" @default.
• W2023336267 creator A5023565676 @default.
• W2023336267 creator A5025014929 @default.
• W2023336267 creator A5028758614 @default.
• W2023336267 creator A5034624171 @default.
• W2023336267 creator A5040758762 @default.
• W2023336267 creator A5054370710 @default.
• W2023336267 creator A5056800810 @default.
• W2023336267 creator A5059680271 @default.
• W2023336267 creator A5065784561 @default.
• W2023336267 creator A5073731572 @default.
• W2023336267 creator A5088162141 @default.
• W2023336267 date "2013-08-01" @default.
• W2023336267 modified "2023-10-10" @default.
• W2023336267 title "CXCR4 Chemokine Receptor Signaling Induces Apoptosis in Acute Myeloid Leukemia Cells via Regulation of the Bcl-2 Family Members Bcl-XL, Noxa, and Bak" @default.
• W2023336267 cites W1515004242 @default.
• W2023336267 cites W1521411817 @default.
• W2023336267 cites W1587229711 @default.
• W2023336267 cites W1626485058 @default.
• W2023336267 cites W1634845388 @default.
• W2023336267 cites W1934070816 @default.
• W2023336267 cites W1964625584 @default.
• W2023336267 cites W1967320533 @default.
• W2023336267 cites W1971967721 @default.
• W2023336267 cites W1974302097 @default.
• W2023336267 cites W1979421565 @default.
• W2023336267 cites W1981857209 @default.
• W2023336267 cites W1982432532 @default.
• W2023336267 cites W1982861439 @default.
• W2023336267 cites W1983601044 @default.
• W2023336267 cites W1984127634 @default.
• W2023336267 cites W1994174062 @default.
• W2023336267 cites W1994292332 @default.
• W2023336267 cites W1998203489 @default.
• W2023336267 cites W1998973639 @default.
• W2023336267 cites W2015973524 @default.
• W2023336267 cites W2022451432 @default.
• W2023336267 cites W2024968355 @default.
• W2023336267 cites W2025335702 @default.
• W2023336267 cites W2027364921 @default.
• W2023336267 cites W2030406672 @default.
• W2023336267 cites W2032738143 @default.
• W2023336267 cites W2035614371 @default.
• W2023336267 cites W2037751912 @default.
• W2023336267 cites W2038069692 @default.
• W2023336267 cites W2038814077 @default.
• W2023336267 cites W2040331428 @default.
• W2023336267 cites W2040693497 @default.
• W2023336267 cites W2041125575 @default.
• W2023336267 cites W2044942890 @default.
• W2023336267 cites W2046416127 @default.
• W2023336267 cites W2047132514 @default.
• W2023336267 cites W2051973695 @default.
• W2023336267 cites W2053413169 @default.
• W2023336267 cites W2053480920 @default.
• W2023336267 cites W2068180652 @default.
• W2023336267 cites W2073020845 @default.
• W2023336267 cites W2078662610 @default.
• W2023336267 cites W2081116633 @default.
• W2023336267 cites W2082445382 @default.
• W2023336267 cites W2088371348 @default.
• W2023336267 cites W2098510636 @default.
• W2023336267 cites W2098643088 @default.
• W2023336267 cites W2108972249 @default.
• W2023336267 cites W2113472355 @default.
• W2023336267 cites W2115899473 @default.
• W2023336267 cites W2123792735 @default.
• W2023336267 cites W2129003172 @default.
• W2023336267 cites W2136932131 @default.
• W2023336267 cites W2137979644 @default.
• W2023336267 cites W2142899629 @default.
• W2023336267 cites W2143604929 @default.
• W2023336267 cites W2144201805 @default.
• W2023336267 cites W2150043459 @default.
• W2023336267 cites W2151632284 @default.
• W2023336267 cites W2152080775 @default.
• W2023336267 cites W2154492083 @default.
• W2023336267 cites W2162995424 @default.
• W2023336267 cites W2166467949 @default.
• W2023336267 cites W2169438624 @default.
• W2023336267 cites W4247268236 @default.
• W2023336267 doi "https://doi.org/10.1074/jbc.m113.449926" @default.
• W2023336267 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3743469" @default.
• W2023336267 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/23798675" @default.
• W2023336267 hasPublicationYear "2013" @default.
• W2023336267 type Work @default.
• W2023336267 sameAs 2023336267 @default.
• W2023336267 citedByCount "54" @default.
• W2023336267 countsByYear W20233362672013 @default.
• W2023336267 countsByYear W20233362672014 @default.
• W2023336267 countsByYear W20233362672015 @default.
• W2023336267 countsByYear W20233362672016 @default.
• W2023336267 countsByYear W20233362672017 @default.
• W2023336267 countsByYear W20233362672018 @default.
• W2023336267 countsByYear W20233362672019 @default.
• W2023336267 countsByYear W20233362672020 @default.
• W2023336267 countsByYear W20233362672021 @default.

• next