FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023340785> ?p ?o ?g. }

• W2023340785 endingPage "44048" @default.
• W2023340785 startingPage "44041" @default.
• W2023340785 abstract "The expression of the cytochrome P450 1A1 gene (cyp1a1) is regulated by the aryl hydrocarbon receptor (AhR), which is a ligand-activated transcription factor that mediates most toxic responses induced by 2,3,7,8tetrachlorodibenzo-p-dioxin (TCDD). In the nucleus, ligand-activated AhR binds to the xenobiotic response elements, initiating chromatin remodeling and recruitment of coregulators, leading to the formation of preinitiation complex followed by elongation. Here, we report that ligand-activated AhR recruits the positive transcription elongation factor (P-TEFb) and RNA polymerase II (RNA PII) to the cyp1a1 promoter with concomitant phosphorylation of the RNA PII carboxyl domain (CTD). Interestingly, the serine 2 and serine 5 of the heptapeptide repeats (YSPTSPS) were sequentially phosphorylated upon TCDD treatment. Inhibition of P-TEFb kinase activity by 5,6-dichloro-1-β-d-ribofuranosyl-benzimidazole (DRB) suppressed CTD phosphorylation (especially serine 2 phosphorylation) and abolished processive elongation without disrupting the assembly of the preinitiation complex at the cyp1a1 promoter. Remarkably, we found that activation of NF-κB by TNF-α selectively inhibited TCDD-induced serine 2 phosphorylation in mouse liver cells, suggesting that residue-specific phosphorylation of RNA PII CTD at the cyp1a1 promoter is an important regulatory point upon which signal “cross-talk” converges. Finally, we show that ligand-activated AhR associated with P-TEFb through the C terminus of cyclin T1, suggesting that AhR recruit the P-TEFb to the cyp1a1 promoter whereupon its kinase subunit phosphorylates the RNA PII CTD. The expression of the cytochrome P450 1A1 gene (cyp1a1) is regulated by the aryl hydrocarbon receptor (AhR), which is a ligand-activated transcription factor that mediates most toxic responses induced by 2,3,7,8tetrachlorodibenzo-p-dioxin (TCDD). In the nucleus, ligand-activated AhR binds to the xenobiotic response elements, initiating chromatin remodeling and recruitment of coregulators, leading to the formation of preinitiation complex followed by elongation. Here, we report that ligand-activated AhR recruits the positive transcription elongation factor (P-TEFb) and RNA polymerase II (RNA PII) to the cyp1a1 promoter with concomitant phosphorylation of the RNA PII carboxyl domain (CTD). Interestingly, the serine 2 and serine 5 of the heptapeptide repeats (YSPTSPS) were sequentially phosphorylated upon TCDD treatment. Inhibition of P-TEFb kinase activity by 5,6-dichloro-1-β-d-ribofuranosyl-benzimidazole (DRB) suppressed CTD phosphorylation (especially serine 2 phosphorylation) and abolished processive elongation without disrupting the assembly of the preinitiation complex at the cyp1a1 promoter. Remarkably, we found that activation of NF-κB by TNF-α selectively inhibited TCDD-induced serine 2 phosphorylation in mouse liver cells, suggesting that residue-specific phosphorylation of RNA PII CTD at the cyp1a1 promoter is an important regulatory point upon which signal “cross-talk” converges. Finally, we show that ligand-activated AhR associated with P-TEFb through the C terminus of cyclin T1, suggesting that AhR recruit the P-TEFb to the cyp1a1 promoter whereupon its kinase subunit phosphorylates the RNA PII CTD. The aryl hydrocarbon receptor (AhR) 1The abbreviations used are: AhR, aryl hydrocarbon receptor; ARNT, aryl hydrocarbon receptor nucleus translocator; TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin; cyp1a1, gene of cytochrome P450 1A1; XRE, xenobiotic response element; P-TEFb, positive transcription elongation factor b; DRB, 5,6-dichloro-1-d-ribofuranosylbenzamidazole; GST, glutathione S-transferase; RNA PII, RNA polymerase II; CTD, C-terminal domain; PIPES, 1,4-piperazinediethanesulfonic acid; DTT, dithiothreitol; PMSF, phenylmethylsulfonyl fluoride; CHiP, chromatin immunoprecipitation assay; XRE, xenobiotic response elements.1The abbreviations used are: AhR, aryl hydrocarbon receptor; ARNT, aryl hydrocarbon receptor nucleus translocator; TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin; cyp1a1, gene of cytochrome P450 1A1; XRE, xenobiotic response element; P-TEFb, positive transcription elongation factor b; DRB, 5,6-dichloro-1-d-ribofuranosylbenzamidazole; GST, glutathione S-transferase; RNA PII, RNA polymerase II; CTD, C-terminal domain; PIPES, 1,4-piperazinediethanesulfonic acid; DTT, dithiothreitol; PMSF, phenylmethylsulfonyl fluoride; CHiP, chromatin immunoprecipitation assay; XRE, xenobiotic response elements. is a ligand-activated transcription factor that belongs to the basic helix-loop-helix/ Per-ARNT-Sim (bHLH-PAS) family and mediates most TCDD-induced toxic responses. The AhR is at the high echelon of transcriptional regulatory circuitry regulating many aspects of physiological processes in addition to the xenobiotic metabolism (1Whitlock Jr., J.P. Annu. Rev. Pharmacol. Toxicol. 1999; 39: 103-125Crossref PubMed Scopus (990) Google Scholar, 2Gu Y.Z. Hogenesch J.B. Bradfield C.A. Annu. Rev. Pharmacol. Toxicol. 2000; 40: 519-561Crossref PubMed Scopus (843) Google Scholar).It has been shown that, in mouse hepatoma cells, the AhR resides in the cytoplasm in association with heat shock protein 90 (hsp90) (3Denis M. Cuthill S. Wikstrom A.C. Poellinger L. Gustafsson J.A. Biochem. Biophys. Res. Commun. 1988; 155: 801-807Crossref PubMed Scopus (169) Google Scholar, 4Perdew G.H. J. Biol. Chem. 1988; 263: 13802-13805Abstract Full Text PDF PubMed Google Scholar) and an immunophilin protein (5Ma Q. Whitlock Jr., J.P. J. Biol. Chem. 1997; 272: 8878-8884Abstract Full Text Full Text PDF PubMed Scopus (361) Google Scholar, 6Carver L.A. LaPres J.J. Jain S. Dunham E.E. Bradfield C.A. J. Biol. Chem. 1998; 273: 33580-33587Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar, 7Meyer B.K. Pray-Grant M.G. Vanden Heuvel J.P. Perdew G.H. Mol. Cell. Biol. 1998; 18: 978-988Crossref PubMed Scopus (305) Google Scholar). Upon activation by ligand, the AhR translocates into the nucleus and binds to another bHLH-PAS protein called the AhR nuclear translocator (ARNT) (8Hoffman E.C. Reyes H. Chu F.F. Sander F. Conley L.H. Brooks B.A. Hankinson O. Science. 1991; 252: 954-958Crossref PubMed Scopus (831) Google Scholar). The heterodimeric protein complex then binds to the xenobiotic response elements (XREs) (9Reyes H. Reisz-Porszasz S. Hankinson O. Science. 1992; 256: 1193-1195Crossref PubMed Scopus (683) Google Scholar), which are enhancer sequences located in the regulatory regions of AhR-controlled genes such as the gene from cytochrome P450 1A1 (cyp1a1), and activates gene expression. Cyp1a1 is a member of the cytochromes P450 monooxygenase superfamily, which plays an important role in xenobiotic metabolism as well as in carcinogenesis. Historically, many important mechanistic aspects of AhR-regulated gene expression have been investigated utilizing transcriptional regulation of mouse cyp1a1 as a model system (1Whitlock Jr., J.P. Annu. Rev. Pharmacol. Toxicol. 1999; 39: 103-125Crossref PubMed Scopus (990) Google Scholar).The ligand-dependent cyp1a1 transcriptional regulation is a dynamic process involving AhR binding to the XRE, controlled recruitment of coregulators as well as general transcription factors, chromatin remodeling and histone modifications (10Okino S.T. Whitlock Jr., J.P. Mol. Cell. Biol. 1995; 15: 3714-3721Crossref PubMed Scopus (79) Google Scholar, 11Beischlag T.V. Wang S. Rose D.W. Torchia J. Reisz-Porszasz S. Muhammad K. Nelson W.E. Probst M.R. Rosenfeld M.G. Hankinson O. Mol. Cell. Biol. 2002; 22: 4319-4333Crossref PubMed Scopus (171) Google Scholar, 12Wang S. Hankinson O. J. Biol. Chem. 2002; 277: 11821-11827Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 13Swanson H.I. Yang J.H. Mol. Pharmacol. 1998; 54: 671-677PubMed Google Scholar, 14Ke S. Rabson A.B. Germino J.F. Gallo M.A. Tian Y. J. Biol. Chem. 2001; 276: 39638-39644Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar). These processes lead to the assembly of the preinitiation complex at the cyp1a1 promoter, which is followed by transcription elongation. Actinomycin D treatment, which blocks the nucleosomal changes downstream from the transcription start site has no effect on chromatin remodeling around the promoter region upstream from the transcription start site, suggesting that assembly of the preinitiation complex and elongation are distinct processes (15Morgan J.E. Whitlock Jr., J.P. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 11622-11626Crossref PubMed Scopus (64) Google Scholar).Transcription elongation by RNA PII is a highly regulated process and its complexity has only recently been appreciated. The largest subunit of mammalian RNA PII possesses 52 repeats of heptapeptide with consensus YSPTSPS motif (16Dahmus M.E. J. Biol. Chem. 1996; 271: 19009-19012Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar). Hyperphosphorylated CTD is associated with active elongating RNA PII, while inactive RNA PII is hypophosphorylated. It is recognized that after formation of the preinitiation complex, RNA PII is subjected to negative regulation by the negative transcription elongation factor (N-TEF) (17Yamaguchi Y. Wada T. Watanabe D. Takagi T. Hasegawa J. Handa H. J. Biol. Chem. 1999; 274: 8085-8092Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar, 18Price D.H. Mol. Cell. Biol. 2000; 20: 2629-2634Crossref PubMed Scopus (565) Google Scholar). The N-TEF is composed of the DRB sensitivity-inducing factor (DSIF) and the negative elongation factor (NELF). NELF is a transcription factor complex that cooperates with DSIF/hSpt4-hSpt5 to repress elongation by RNA PII (19Yamaguchi Y. Takagi T. Wada T. Yano K. Furuya A. Sugimoto S. Hasegawa J. Handa H. Cell. 1999; 97: 41-51Abstract Full Text Full Text PDF PubMed Scopus (606) Google Scholar). In order for RNA PII to overcome the negative regulation and engage in processive transcription, P-TEFb is required. P-TEFb consists of a regulatory subunit (either cyclin T1, T2, or K) and an enzymatic subunit (CDK9) (18Price D.H. Mol. Cell. Biol. 2000; 20: 2629-2634Crossref PubMed Scopus (565) Google Scholar). CDK9 phosphorylates the C-terminal domain (CTD) of the largest subunit of RNA PII (20Schroeder S.C. Schwer B. Shuman S. Bentley D. Genes Dev. 2000; 14: 2435-2440Crossref PubMed Scopus (298) Google Scholar). Hypophosphorylated CTD is associated with RNA PII paused at the initiation stage and is inactive in transcript elongation. P-TEFb phosphorylates CTD to release RNA PII from the arrested state. Thus, CTD-specific kinases and phosphatases can function as transcriptional activators or repressors regulating the activity of RNA Pol II at different stages of transcription.Phosphorylation status of specific serine residues, especially serine 2 and serine 5, are associated with different isoforms of RNA PII engaging at different stages of transcription cycle (20Schroeder S.C. Schwer B. Shuman S. Bentley D. Genes Dev. 2000; 14: 2435-2440Crossref PubMed Scopus (298) Google Scholar, 21Rodriguez C.R. Cho E.J. Keogh M.C. Moore C.L. Greenleaf A.L. Buratowski S. Mol. Cell. Biol. 2000; 20: 104-112Crossref PubMed Scopus (161) Google Scholar, 22Komarnitsky P. Cho E.J. Buratowski S. Genes Dev. 2000; 14: 2452-2460Crossref PubMed Scopus (795) Google Scholar). Serine 2 has been shown to be phosphorylated by P-TEFb (23Zhou M. Halanski M.A. Radonovich M.F. Kashanchi F. Peng J. Price D.H. Brady J.N. Mol. Cell. Biol. 2000; 20: 5077-5086Crossref PubMed Scopus (219) Google Scholar) and is associated with RNA PII engaging in transcript elongation (22Komarnitsky P. Cho E.J. Buratowski S. Genes Dev. 2000; 14: 2452-2460Crossref PubMed Scopus (795) Google Scholar), while serine 5 phosphorylation is involved in recruitment and activation of the mammalian capping enzyme (24McCracken S. Fong N. Rosonina E. Yankulov K. Brothers G. Siderovski D. Hessel A. Foster S. Shuman S. Bentley D.L. Genes Dev. 1997; 11: 3306-3318Crossref PubMed Scopus (428) Google Scholar, 25Ho C.K. Shuman S. Mol. Cell. 1999; 3: 405-411Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar) and involved in the processing of primary RNA transcript.In this study, we show for the first time, that activation of AhR leads to recruitment of P-TEFb to the cyp1a1 promoter followed by differential phosphorylation of the RNA PII CTD. NF-κB activation antagonizes TCDD-induced serine 2 phosphorylation. Futhermore, we demonstrated that cyclinT1 directly interacts with AhR in vitro as well as in vivo. Our results suggest that elongation control is an important point of regulation of cyp1a1 expression.MATERIALS AND METHODSPlasmid Constructs and Vectors—pCyclin T1 and pCDK9 were kindly provided by D. Price (University of Iowa). For yeast two hybrid and glutathione S-transferase (GST) pull-down assays, Cyclin T1 expression plasmids were made by inserting the PCR-generated cyclin T1 fragments into the pGAD424 (Clontech) and pGEX-5X-3 (Amersham Biosciences). The PCR primers used are: fragment 1–726: OL1, GCGGATCCCCACCATGGAGGGAGAGAGGAAG and OL726, ACGCGTCGACTTACTTAGGAAGGGGTGGAAG; for fragment 1–250: OL 1 and OL250, ACGCGTCGACTTAGTTGGGAGTTTTCTCCAAAA; for fragment 233–726: OL233, GCGGATCCCCACCATGTTTAGATGAACTGACACATG and OL726. The PCR products were modified with restriction enzymes BamH1 and SalI for insertion into the plasmid vectors. Plasmid pGL3-CYP1A1-Luc was created by inserting the PCR product of the mouse cyp1a1 upstream regulatory region (–1395 to + 1) into the pGL3 basic vector (Promega). PCR primers used were: TTGAGTTAGACACGCCAAGTTCAG and AGTGAAGGAAGAGGGTTAGGGTGAAGGCACCACCAC. In the PCR reaction, mouse genomic DNA was used as the template. The PCR product was cloned into the TA cloning vector (pCR2.1, Invitrogen) and restricted with HindIII and XhoI and then inserted into pGL3 basic vector. Plasmid DNAs used for transfection were purified using the Qiagen Maxi-Prep DNA Isolation system (Qiagen).Antibodies—Antibodies against cyclin T1 (sc-10750), CDK9 (sc-8338) and RNA PII (sc-899) were from Santa Cruz Biotechnologies Inc. Antibodies against phosphoserine 5 of CTD (H14) and phosphoserine 2 of CTD (H5) were from BabCO (Berkeley, CA). Anti-AhR antibody (SA-210) was from Biomol (Plymouth Meeting, PA). Antibody against ARNT was kindly provided by R. Pollenz (University of South Florida).Cell Culture and Transient Transfection—Cells were maintained in αMEM supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, and 250 ng/ml amphotericin B (Invitrogen), 5% CO2 and 37 °C. For transient transfection, Hepa1c1c7 cells were seeded in 12-well plates on day –1 and transfection performed using LipofectAMINE (Invitrogen) when cell density reached 70% confluence. pSV-β-galactosidase control plasmid (Promega) was used for normalization of transfection efficiency. Six hours after transfection, cells were treated with TCDD or Me2SO (solvent control) for 18 h before harvest for determination of luciferase activity.RNA Isolation and Ribonuclease Protection Assay for Determination of cyp1a1 Transcripts—Hepa1c1c7 cells were seeded into 100-mm in diameter Petri dishes. When growth reached 80% confluence, cells were treated with TCDD (10 nm), DRB (30 μm) + TCDD (10 nm) for 2 h. Total cellular RNA was isolated using TRIzol reagent (Invitrogen) according to manufacturer's instructions.The proximal promoter probe was generated by PCR amplification of mouse genomic DNA with PCR primers: TTGAGTTAGACACGCCAAGTTCAG and GAAGTGAAGAGTGTTCTCTAGGAC. PCR products were cloned into a TA cloning vector (pCR2.1, Invitrogen). The DNA template was linearized with Msc1 and used as the template for generation of riboprobe corresponding to the proximal promoter region (–52 to +65). The riboprobe for the cyp1a1 distal region was generated by PCR using plasmid DNA containing cloned distal region of mouse cyp1a1. The PCR primers used were: CAGAAACACAGATCCTGG and TATTTAGGTGACACTATAGAATCAAAGTAACCAGACACATCC, which contains the Sp6 promoter. Antisense probes were prepared using MAXIscript In Vitro Transcription Kit (Ambion) according to the manufacturer's instructions. The ribonuclease protection assays were performed on 20 μg of total RNA and 20,000 cpm of antisense probes using RPA III Ribonuclease Protection Assay Kit (Ambion) according to manufacturer's recommendations.Northern Blot—Total RNA from Hepa1c1c7 cells was isolated using TRIzol reagent. Twenty micrograms of total RNA from each sample were separated on a 1% agarose/formaldehyde gel and transferred overnight onto a nylon membrane. After UV-cross-linking, membrane was prehybridized for 4 h at 42 °C in prehybridization buffer (6× SSC, 5× Denhardt's reagent, 0.5% SDS, 100 μg/ml denatured salmon sperm DNA), and then probed overnight at 42 °C with cyp1a1 cDNA probe labeled with [α-32P]dCTP using Radprime labeling systems (Invitrogen) at 1 × 106 cpm/ml hybridization buffer (6× SSC, 0.5% SDS, 100 μg/ml denatured fragmented salmon sperm DNA, 50% formamide). After hybridization, the membrane was washed 3 × 5 min in buffer I (2× SSC, 0.5% SDS), 1 × 15 min in buffer II (2× SSC, 0.1% SDS), and then washed with buffer III (0.1% SSC, 0.1% SDS) at 65 °C until the background is low. The wet membrane was exposed at –80 °C overnight using Kodak film. As a control, the blot was stripped and re-probed with α-32P-labeled cDNA for rat GAPDH. Plasmid that contained rat GAPDH cDNA (pBSSKII+) was obtained from Binas (Texas A&M University). Mouse cyp1a1 cDNA was obtained using RT-PCR using total RNA from Hepa1c1c7 cells. The PCR primers were: CCCACAGCACCACAAGAGATA and AAGTAGGAGGCAGGCACAATGTC. The PCR product was inserted to pGEM-T easy vector (Promega). The BamH1- HindIII fragment of GAPDH and PstI fragment of cyp1a1 were used as templates for labeling, respectively.In Vivo Coimmunoprecipitation Assay—The coimmunoprecipitation assays were based on a published procedure with modifications (26Andrews N.C. Faller D.V. Nucleic Acids Res. 1991; 19: 2499Crossref PubMed Scopus (2209) Google Scholar, 27Tian Y. Ke S. Denison M.S. Rabson A.B. Gallo M.A. J. Biol. Chem. 1999; 274: 510-515Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar). Hepa1c1c7 cells were maintained in 100-mm cell culture plates and when growth reached 80% confluence, the cells were treated with TCDD (10 nm) or Me2SO (vehicle control) for 60 min. Before harvest, the cells were washed twice with ice-cold phosphate-buffered saline, harvested by scraping, and collected by centrifugation at 600 × g. Nuclei of the cells (two plates from each treatment) were isolated based on a published procedure (26Andrews N.C. Faller D.V. Nucleic Acids Res. 1991; 19: 2499Crossref PubMed Scopus (2209) Google Scholar). The isolated nuclei were lysed in buffer (20 mm Hepes, pH 7.4, 125 mm NaCl, 1% Triton X-100, 10 mm EDTA, 2 mm EGTA, 2 mm Na3VO4, 50 mm NaF, 20 mm ZnCl2, 10 mm sodium pyrophosphate, 1 mm PMSF, 1 mm DTT, 5 μg/ml leupeptin) and centrifuged for 15 min at 12,000 × g, and supernatant fractions were collected. For coimmunoprecipitation assays, the antisera were added to the lysate, and the binding reactions were performed at 4 °C for 2 h on a rotary shaker. 30 μl of GammaBind Plus Sepharose slurry (50% beads) (Amersham Biosciences) were added to precipitate the antibody-antigen complexes. The beads were washed three times in lysis buffer and then boiled in 2× SDS sample buffer. The proteins were separated by 8% SDS-polyacrylamide gel. Proteins on the gel were transferred to nitrocellulose membranes (BioRad) and the membranes were blocked with 5% bovine serum albumin in TBST buffer (20 mm Tris-HCL, pH 7.6, 137 mm NaCl, 2.68 mm KCl, 0.05% Tween 20), and incubated with appropriate primary antibodies at 37 °C for 60 min. Blots were washed three times with TBST, then incubated with a 1:2000 dilution of immunoaffinity-purified goat anti-rabbit IgG linked to alkaline phosphatase. Blots were washed three times with TBST and subsequently developed using NBT/BCIP (Sigma) as the substrate.Yeast Two-hybrid Interaction Assays—Yeast two-hybrid assays were performed according to the Match Maker Gal4 two-hybrid user manual (Clontech). Human AhR cDNA was obtained by PCR amplification of pSport huAhR and the product was cloned into the trp + yeast expression vector pGBT9 (Clontech) in-frame with the DNA binding domain of GAL4, resulting in the pGBT9AhR plasmid. Similarly, cyclin T1 cDNA fragments were cloned into the leu + yeast vector pGAD424 (Clontech) in-frame with the GAL4 transactivation domain, resulting in plasmid pGAD424CycT1 (1–726), pGAD424CycT1 (1–250), and pGAD424CycT1 (233–726). As a positive control the human ARNT cDNA without the activation domain was also cloned into pGAD424 to yield pGAD424 ARNT. The primers used for generation of the cDNA fragment were: GGGCGGATCCCCATGGCGGCGACTACTGCCAAC and GGGCGTCGACGGGAAATCTGGGCCAACATC. Assays for the interactions between AhR and cyclin T1 were performed as follow: Saccharomyces cerevisiae strain SFY526 was grown in YPD medium and transformed by electroporation with pGBT9AhR and pGAD424Cyc T1 plasmids. The transformation mixtures were plated on synthetic drop-out medium minus leucine and tryptophan. For β-galactosidase assays, minimal medium minus leucine and tryptophan was inoculated with single yeast colonies and grown overnight at 30 °C to saturation. To activate the Ah receptor, β-naphthoflavone was added to fresh medium to a final concentration of 5 μm, and the medium was inoculated with an aliquot of the saturated yeast cultures to an OD600 around 0.2. Control cultures were treated with an equivalent amount of dimethyl sulfoxide. All cultures were grown 8–12 h and harvested by centrifugation when OD600 reached 1.0–1.3. The cells were washed in Z buffer and after centrifugation, cells were resuspended in 300 μl of Z buffer and lysed by freezing in liquid nitrogen and thawing at 37 °C. Z buffer (0.7 ml) and β-mercaptoethanol (0.27 ml) were added to the cells. β-Galactosidase activity was determined by adding 0.16 ml o-nitrophenyl-β-d-galactopyranoside (4 mg/ml in Z buffer), and reaction mixtures were incubated at 30 °C. Cellular debris was pelleted by centrifugation, and the absorbance of supernatants was measured at 420 nm. Each determination was performed in triplicate.GST Pull-down Analysis—[35S]methionine-labeled full-length AhR protein was generated with a TnT-coupled Reticulocyte Lysate System (Promega) using the SP6 promoter-driven cDNA plasmid (phuAhR) as the template. PCR-generated cDNA fragments of cyclin T1 corresponding to amino acids 1–726, 1–250, and 233–726 were inserted in-frame into pGEX-5X-3 (Amersham Biosciences), yielding the expression plasmids for GST-cyclin T1 fusion proteins. The plasmids were expressed in E. coli (BL21), and fusion polypeptides were purified with the Bulk GST Purification Module (Amersham Biosciences) according to the manufacturer's instruction. Twenty micrograms of each fusion polypeptides (estimated by comparison with bovine serum albumin in an SDS-PAGE gel with Coomassie staining) was incubated with 10 μl of radiolabeled AhR in a total of 100 μl binding reaction buffer (20 mm Hepes (pH 7.9), 1% Triton X-100, 20 mm DTT, 0.5% bovine serum albumin, and 100 mm KCl) for 3 h at 4 °C. After incubation, glutathione-Sepharose 4B beads were added and washed with the same buffer without bovine serum albumin three times. The bound proteins were eluted by boiling in the SDS-PAGE sample buffer, and resolved by 8% SDS-PAGE gel electrophoresis. The signals were detected by autoradiography.Luciferase Reporter Gene Activity Assay—Luciferase assays were performed using the Luciferase Assay System (Promega). Briefly, the transfected cells were lysed in the culture plates with Reporter Lysis Buffer and the lysates centrifuged at maximum speed for 10 min in an Eppendorf microfuge. 10 μl of the supernatant fraction were incubated with 50 μl of luciferase substrate and relative luciferase activity determined with a luminometer (Turner Designs).Chromatin Immunoprecipitation (ChIP) Assay—ChIP assay was performed based on published protocols (14Ke S. Rabson A.B. Germino J.F. Gallo M.A. Tian Y. J. Biol. Chem. 2001; 276: 39638-39644Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar, 34Nissen R.M. Yamamoto K.R. Genes Dev. 2000; 14: 2314-2329Crossref PubMed Scopus (456) Google Scholar) with modifications. Hepa1c1c7 cells were maintained in 10-cm plates under standard cell culture conditions. At 80% confluence, formaldehyde was added directed to the media to a final concentration of 1.0% for cross-linking, and the plates were incubated for 15 min at room temperature with gentle rocking. The cross-linking reaction was stopped by adding glycine to a final concentration of 0.125 m. The plates were then rinsed twice with ice-cold phosphate-buffered saline. Cells were scraped off the plates and collected into 50-ml conical tubes by centrifugation (600 × g for 10 min at 4 °C). Pellets were washed once with 1× phosphate-buffered saline containing 1 mm PMSF, resuspended in 2 ml of cell lysis buffer (5 mm PIPES, (pH 8), 1 mm EDTA, 0.5 mm EGTA, 85 mm KCl, 0.5% Nonidet P-40, 1 mm PMSF, 1 mm DTT, and 5 μg/ml each of leupeptin and aprotinin), and incubated for on ice for 10 min. Cells were homogenized on ice using an A type Dounce homogenizer several times to aid the release of nuclei. The crude nuclei were collected by centrifugation (600 × g for 10 min at 4 °C) and then resuspended in nuclei lysis buffer (50 mm Tris-HCl, pH 8.1, 10 mm EDTA, 0.5 mm EGTA, 1% SDS, 1 mm PMSF, 1 mm DTT, 5 μg/ml each of leupeptin and aprotinin) and incubated again on ice for 10 min. The samples were then sonicated into DNA fragments of 0.5–1.5 kb and microcentrifuged at 14,000 rpm for 10 min at 4 °C. The supernatant was precleared by incubation with Staph A cells (2.5 μg/per sample, Roche Applied Science) for 15 min at 4 °C on a rotating platform and after centrifugation at 12,000 × g for 5 min the supernatant was transferred to a clean tube. Appropriate antibodies (1 μg) were added to the supernatant and then 25 μl of precleared 50% protein A/G beads (Amersham Biosciences) were added to each tube. Final volume of each sample was adjusted to 400 μl with IP dilution buffer (0.01% SDS, 1.1% Trition X-100, 1.2 mm EDTA, 16.7 mm Tris-Cl, pH 8.1, 167 mm NaCl, 100 μg/ml sonicated salmon sperm DNA). The mixtures were incubated on the rotating platform at 4 °C overnight. After incubation, the beads were collected by centrifugation at 5000 rpm for 1 min in a microcentrifuge, and pellets were washed three times with 1 ml of 1× Dialysis buffer (2 mm EDTA; 50 mm Tris-Cl, pH 8.0; 100 μg/ml sonicated salmon sperm DNA) and 5 times with 1 ml of IP Wash buffer (100 mm Tris-Cl, pH 9.0, 500 mm LiCl, 1% Nonidet P-40, 1% deoxycholic acid) for 10 min with rotation. After the wash, 200 μl of digestion buffer (50 mm Tris, pH 8, 1 mm EDTA, 100 mm NaCl, 0.5% SDS, 100 μg/ml proteinase K) was added to each tube, and tubes were incubated at 55 °C for 3 h and followed by 6 h at 65 °C to reverse the cross-linking. The samples were extracted once with phenol-chloroform-isoamyl alcohol and once with chloroform and then ethanol-precipitated in the presence of 20 μg of glycogen overnight. The precipitated pellets were collected by centrifugation at top speed and the pellets were resuspended in 20 μl of TE buffer. Aliquots from each tube were used for PCR amplification. The PCR products were either separated on 1.2% agarose gels and visualized by ethidium bromide staining or separated by 6% polyacrylamide gel electrophoresis. In later cases, one of the PCR primers was end-labeled by 32P, and signals of the PCR products were visualized by autoradiography. The primer pairs for PCR of the cyp1a1 promoter region were: –1100 to –770, TTAAGAGCCTCACCCACGG and GCGGGTGCAGAGCTATCTAAG; –285 to +66, TTTCCTCAAACCCCTCCCTC and GAAGTGAAGAGTGTTCTCTAGGAC.RESULTSLigand-activated AhR Recruits Cyclin T1, CDK9, and RNA Pol II to the cyp1a1 Promoter with Concomitant Phosphorylation of RNA PII CTD—To investigate the elongation control of cyp1a1 transcription, we used in vivo chromatin immunoprecipitation assay to analyze the recruitment of the cyclin T1, CDK9, and RNA PII to the cyp1a1 promoter and the residue-specific phosphorylation of the C-terminal domain (CTD) of the RNA PII in response to AhR activation. In Hepa1c1c7 cells, 30 min after TCDD treatment, AhR and ARNT began to associate with the cyp1a1 regulatory region followed by the recruitment of RNA PII at the promoter region (30–60 min after TCDD treatment) (Fig. 1). P-TEFb complex was recruited to the promoter region at 60 min and coincided with strong phosphorylation of serine 2 of the CTD. Interestingly, although the strongest phosphorylation of serine 2 of RNA PII CTD was detectable at 60 min, strongest phosphorylation of serine 5 was detected after serine 2 phosphorylation. In addition, the increases of serine 5 phosphorylation correlated with decreases of serine 2 phosphorylation, suggesting that phosphorylations of serine 2 and serine 5 are controlled by separate mechanisms (Fig. 1).Inhibition of Kinase Activity of P-TEFb Selectively Blocks cyp1a1 Transcript Elongation by RNA Pol II but Not the Assembly of the Preinitiation Complex—Phosphorylation of the CTD of RNA PII is associated with transition from the initiation to elongation stage of transcription (16Dahmus M.E. J. Biol. Chem. 1996; 271: 19009-19012Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar). To further investigate the role of P-TEFb in cyp1a1 elongation control, we used the specific P-TEFb inhibitor DRB, to test the involvement of P-TEFb in cyp1a1 elongation. DRB treatment (30 μm, 2 h) inhibited phosphorylation of serine 2 and reduced serine 5 phosphorylation of CTD and prevented the RNA Pol II from transcribing the cyp1a1 distal region as determined by ChIP assay (compare lanes 5 and 6 in Fig. 2A). It appeared" @default.
• W2023340785 created "2016-06-24" @default.
• W2023340785 creator A5051624631 @default.
• W2023340785 creator A5054451453 @default.
• W2023340785 creator A5056213564 @default.
• W2023340785 creator A5082178035 @default.
• W2023340785 date "2003-11-01" @default.
• W2023340785 modified "2023-10-15" @default.
• W2023340785 title "Interactions between the Aryl Hydrocarbon Receptor and P-TEFb" @default.
• W2023340785 cites W1505278126 @default.
• W2023340785 cites W1826000501 @default.
• W2023340785 cites W1973000551 @default.
• W2023340785 cites W1977121504 @default.
• W2023340785 cites W1980214543 @default.
• W2023340785 cites W1982265633 @default.
• W2023340785 cites W1993583152 @default.
• W2023340785 cites W1998573431 @default.
• W2023340785 cites W2005233776 @default.
• W2023340785 cites W2007441206 @default.
• W2023340785 cites W2012475101 @default.
• W2023340785 cites W2051598492 @default.
• W2023340785 cites W2060554618 @default.
• W2023340785 cites W2062818823 @default.
• W2023340785 cites W2067627058 @default.
• W2023340785 cites W2072836045 @default.
• W2023340785 cites W2081322742 @default.
• W2023340785 cites W2088913708 @default.
• W2023340785 cites W2093460761 @default.
• W2023340785 cites W2094646101 @default.
• W2023340785 cites W2097621806 @default.
• W2023340785 cites W2100649212 @default.
• W2023340785 cites W2114629114 @default.
• W2023340785 cites W2121649903 @default.
• W2023340785 cites W2126730534 @default.
• W2023340785 cites W2128431731 @default.
• W2023340785 cites W2128583496 @default.
• W2023340785 cites W2134055375 @default.
• W2023340785 cites W2141306531 @default.
• W2023340785 cites W2142013281 @default.
• W2023340785 cites W2144062280 @default.
• W2023340785 cites W2147347134 @default.
• W2023340785 cites W2162082053 @default.
• W2023340785 cites W2162914583 @default.
• W2023340785 cites W2163230887 @default.
• W2023340785 cites W2169963834 @default.
• W2023340785 doi "https://doi.org/10.1074/jbc.m306443200" @default.
• W2023340785 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12917420" @default.
• W2023340785 hasPublicationYear "2003" @default.
• W2023340785 type Work @default.
• W2023340785 sameAs 2023340785 @default.
• W2023340785 citedByCount "81" @default.
• W2023340785 countsByYear W20233407852012 @default.
• W2023340785 countsByYear W20233407852013 @default.
• W2023340785 countsByYear W20233407852014 @default.
• W2023340785 countsByYear W20233407852015 @default.
• W2023340785 countsByYear W20233407852016 @default.
• W2023340785 countsByYear W20233407852017 @default.
• W2023340785 countsByYear W20233407852019 @default.
• W2023340785 countsByYear W20233407852020 @default.
• W2023340785 countsByYear W20233407852021 @default.
• W2023340785 countsByYear W20233407852023 @default.
• W2023340785 crossrefType "journal-article" @default.
• W2023340785 hasAuthorship W2023340785A5051624631 @default.
• W2023340785 hasAuthorship W2023340785A5054451453 @default.
• W2023340785 hasAuthorship W2023340785A5056213564 @default.
• W2023340785 hasAuthorship W2023340785A5082178035 @default.
• W2023340785 hasBestOaLocation W20233407851 @default.
• W2023340785 hasConcept C104317684 @default.
• W2023340785 hasConcept C178790620 @default.
• W2023340785 hasConcept C185592680 @default.
• W2023340785 hasConcept C2777207669 @default.
• W2023340785 hasConcept C2780263894 @default.
• W2023340785 hasConcept C2781076698 @default.
• W2023340785 hasConcept C33594762 @default.
• W2023340785 hasConcept C55493867 @default.
• W2023340785 hasConcept C71240020 @default.
• W2023340785 hasConcept C86339819 @default.
• W2023340785 hasConceptScore W2023340785C104317684 @default.
• W2023340785 hasConceptScore W2023340785C178790620 @default.
• W2023340785 hasConceptScore W2023340785C185592680 @default.
• W2023340785 hasConceptScore W2023340785C2777207669 @default.
• W2023340785 hasConceptScore W2023340785C2780263894 @default.
• W2023340785 hasConceptScore W2023340785C2781076698 @default.
• W2023340785 hasConceptScore W2023340785C33594762 @default.
• W2023340785 hasConceptScore W2023340785C55493867 @default.
• W2023340785 hasConceptScore W2023340785C71240020 @default.
• W2023340785 hasConceptScore W2023340785C86339819 @default.
• W2023340785 hasIssue "45" @default.
• W2023340785 hasLocation W20233407851 @default.
• W2023340785 hasOpenAccess W2023340785 @default.
• W2023340785 hasPrimaryLocation W20233407851 @default.
• W2023340785 hasRelatedWork W1531601525 @default.
• W2023340785 hasRelatedWork W2319480705 @default.
• W2023340785 hasRelatedWork W2384464875 @default.
• W2023340785 hasRelatedWork W2606230654 @default.
• W2023340785 hasRelatedWork W2607424097 @default.
• W2023340785 hasRelatedWork W2748952813 @default.
• W2023340785 hasRelatedWork W2899084033 @default.

• next