FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023361821> ?p ?o ?g. }

• W2023361821 endingPage "11919" @default.
• W2023361821 startingPage "11911" @default.
• W2023361821 abstract "We report the first nonmammalian inducible nitric-oxide synthase (NOS) cDNA obtained from chicken macrophages. It exhibits an open reading frame encoding 1,136 amino acid residues, predicting a protein of 129,648-Da molecular mass. The deduced NOS protein sequence showed 66.6%, 70.4%, 54.2%, and 48.7% sequence identity to mouse and human inducible NOS and to two constitutive NOSs from rat brain and bovine endothelium. Overall, NOS appears to be a moderately conserved protein. Northern analysis showed that chicken iNOS mRNA is approximately 4.5 kilobases (kb), a size similar to mammalian inducible NOS. Analysis of 3.2 kb of 5′-flanking sequence of the chicken iNOS gene showed a putative TATA box at 30 base pairs (bp) upstream of the transcription initiation site. The functional importance of the upstream region was determined by transient expression of deletion constructs. An endotoxin regulatory region was located exclusively within 300 bp upstream of the transcription initiation site. This is in contrast to the two distinct sites identified in the mouse macrophage NOS promoter. Transcription factor binding sites such as NF-κB, PEA1, PEA3, and C/EBP were identified. Using a NF-κB inhibitor, we showed that NF-κB is indeed involved in the induction of chicken iNOS gene by lipopolysaccharide. Our results suggest that NF-κB is a common regulatory component in the expression of both mammalian and nonmammalian iNOS genes. We report the first nonmammalian inducible nitric-oxide synthase (NOS) cDNA obtained from chicken macrophages. It exhibits an open reading frame encoding 1,136 amino acid residues, predicting a protein of 129,648-Da molecular mass. The deduced NOS protein sequence showed 66.6%, 70.4%, 54.2%, and 48.7% sequence identity to mouse and human inducible NOS and to two constitutive NOSs from rat brain and bovine endothelium. Overall, NOS appears to be a moderately conserved protein. Northern analysis showed that chicken iNOS mRNA is approximately 4.5 kilobases (kb), a size similar to mammalian inducible NOS. Analysis of 3.2 kb of 5′-flanking sequence of the chicken iNOS gene showed a putative TATA box at 30 base pairs (bp) upstream of the transcription initiation site. The functional importance of the upstream region was determined by transient expression of deletion constructs. An endotoxin regulatory region was located exclusively within 300 bp upstream of the transcription initiation site. This is in contrast to the two distinct sites identified in the mouse macrophage NOS promoter. Transcription factor binding sites such as NF-κB, PEA1, PEA3, and C/EBP were identified. Using a NF-κB inhibitor, we showed that NF-κB is indeed involved in the induction of chicken iNOS gene by lipopolysaccharide. Our results suggest that NF-κB is a common regulatory component in the expression of both mammalian and nonmammalian iNOS genes. INTRODUCTIONThe oxidation of L-arginine (1.Moncada S. Acta Physiol. Scand. 1992; 145: 201-227Crossref PubMed Scopus (678) Google Scholar, 2.Hibbs J.B. Res. Immunol. 1991; 142: 565-569Crossref PubMed Scopus (137) Google Scholar, 3.Marletta M.A. J. Biol. Chem. 1993; 268: 12231-12234Abstract Full Text PDF PubMed Google Scholar) is now recognized to be an important biochemical pathway in many organisms. One of the products of this reaction, nitric oxide (NO), 1The abbreviations used are: NOnitric oxideNOSnitric-oxide synthaseeNOSendothelial nitric-oxide synthaseiNOSinducible nitric-oxide synthasenNOSneuronal nitric-oxide synthaseC/EBPCCAAT/enhancer-binding proteinL-NMMANG-monomethylarginineLPSlipopolysaccharidePDTCpyrrolidine dithiocarbamatePEA1 and PEA3polyomavirus enhancer activator 1 and 3DMEMDulbecco's modified Eagle's mediumPCRpolymerase chain reactionkbkilobase(s)bpbase pair(s)PIPES1,4-piperazinediethanesulfonic acid. performs many diverse and significant biological functions(4.Snyder S.H. Bredt D.S. Sci. Am. 1992; 266: 68-77Crossref PubMed Scopus (550) Google Scholar, 5.Nathan C. FASEB J. 1992; 6: 3051-3064Crossref PubMed Scopus (4132) Google Scholar, 6.Feldman P.L. Griffith O.W. Stuehr D.J. Chem. Eng. News. 1993; 20: 26-38Google Scholar, 7.Gibaldi M. J. Clin. Pharmacol. 1993; 33: 488-496Crossref PubMed Scopus (35) Google Scholar, 8.Knowles R.G. Moncada S. Biochem. J. 1994; 298: 249-258Crossref PubMed Scopus (2485) Google Scholar). In the nervous system, NO is a novel neurotransmitter (9.Bredt D.S. Snyder S.H. Neuron. 1992; 8: 3-11Abstract Full Text PDF PubMed Scopus (1833) Google Scholar, 10.Snyder S.H. Science. 1992; 257: 494-496Crossref PubMed Scopus (946) Google Scholar, 11.Hoffman M. Science. 1991; 252: 1788Crossref PubMed Scopus (43) Google Scholar) which is synthesized as needed and not stored in synaptic vesicles. Importantly, nitric oxide does not interact with receptors on the surface of neurons but targets redox centers within neighboring neurons. In the vascular system, NO acts as the endothelium-derived relaxing factor (12.Ignarro L.J. Annu. Rev. Pharmacol. Toxicol. 1990; 30: 535-560Crossref PubMed Scopus (1218) Google Scholar, 13.Ignarro L.J. Buga G.M. Wood K.S. Byrns R.E. Chaudhuri G. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 9265-9269Crossref PubMed Scopus (4297) Google Scholar) which is a mediator of blood vessel relaxation and blood pressure. It can also inhibit platelet aggregation (14.Radomski M.W. Moncada S. Adv. Exp. Med. Biol. 1993; 344: 251-264Crossref PubMed Scopus (118) Google Scholar) and adhesion. In the immune system, NO is synthesized by activated macrophages and acts as a cytotoxic and tumoricidal agent(1.Moncada S. Acta Physiol. Scand. 1992; 145: 201-227Crossref PubMed Scopus (678) Google Scholar, 2.Hibbs J.B. Res. Immunol. 1991; 142: 565-569Crossref PubMed Scopus (137) Google Scholar, 5.Nathan C. FASEB J. 1992; 6: 3051-3064Crossref PubMed Scopus (4132) Google Scholar). NO also mediates important functions in other tissues and organs such as the gastrointestinal tract(15.Stark M.E. Szurszewski J.H. Gastroenterology. 1992; 103: 1928-1949Abstract Full Text PDF PubMed Google Scholar), liver (16.Billiar T.R. Hoffman R.A. Curran R.D. Langrehr J.M. Simmons R.L. J. Lab. Clin. Med. 1992; 120: 192-197PubMed Google Scholar), pancreas(17.Corbett J.A. Sweetland M.A. Wang J.L. Lancaster Jr., J.R. McDaniel M.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1731-1735Crossref PubMed Scopus (401) Google Scholar), kidney(18.Cattell V. Cook H.T. Exp. Nephrol. 1993; 1: 265-280PubMed Google Scholar), and the reproductive system(19.Schmidt H.H.H.W. Walter U. Cell. 1994; 78: 919-925Abstract Full Text PDF PubMed Scopus (1495) Google Scholar).The enzyme, nitric-oxide synthase (NOS), which catalyzes the biosynthesis of NO has been purified(20.Bredt D.S. Snyder S.H. Proc. Natl. Acad. Sci. 1990; 87: 682-685Crossref PubMed Scopus (3114) Google Scholar, 21.Schmidt H.H.H.W. Pollock J.S. Nakane M. Gorsky L.D. Förstermann U. Murad F. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 365-369Crossref PubMed Scopus (378) Google Scholar, 22.Stuehr D.J. Cho H.J. Kwon N.S. Weise M.F. Nathan C.F. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 7773-7777Crossref PubMed Scopus (727) Google Scholar, 23.Evans T. Carpenter A. Cohen J. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5361-5365Crossref PubMed Scopus (82) Google Scholar), and its cDNA cloned in mammals from the brain(24.Bredt D.S. Hwang P.M. Glatt C.E. Lowenstein C. Reed R.R. Snyder S.H. Nature. 1991; 351: 714-718Crossref PubMed Scopus (2163) Google Scholar, 25.Nakane M. Schmidt H.H.H.W. Pollock J.S. Förstermann U. Murad F. FEBS Lett. 1993; 316: 175-180Crossref PubMed Scopus (474) Google Scholar), endothelium(26.Ischiropoulos H. Zhu L. Beckman J.S. Arch. Biochem. Biophys. 1992; 298: 446-451Crossref PubMed Scopus (1086) Google Scholar, 27.Janssens S.P. Shimouchi A. Quertermous T. Bloch D.B. Bloch K.D. J. Biol. Chem. 1992; 267: 14519-14522Abstract Full Text PDF PubMed Google Scholar, 28.Sessa W.C. Harrison J.K. Barber C.M. Zeng D. Durieux M.E. D'Angelo D.D. Lynch K.R. Peach M.J. J. Biol. Chem. 1992; 267: 15274-15276Abstract Full Text PDF PubMed Google Scholar, 29.Nishida K. Harrison D.G. Navas J.P. Fisher A.A. Dockery S.P. Uematsu M. Nerem R.M. Alexander R.W. Murphy T.J. J. Clin. Invest. 1992; 90: 2092-2096Crossref PubMed Scopus (611) Google Scholar, 30.Lamas S. Marsden P.A. Li G.K. Tempst P. Michel T. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6348-6352Crossref PubMed Scopus (915) Google Scholar), macrophage (31.Lyons C.R. Orloff G.J. Cunningham J.M. J. Biol. Chem. 1992; 267: 6370-6374Abstract Full Text PDF PubMed Google Scholar, 32.Xie Q.W. Cho H.J. Calaycay J. Mumford R.A. Swiderek K.M. Lee T.D. Ding A.H. Troso T. Nathan C. Science. 1992; 256: 225-228Crossref PubMed Scopus (1732) Google Scholar), and hepatocyte(33.Geller D.A. Lowenstein C.J. Shapiro R.A. Nussler A.K. Di Silvio M. Wang S.C. Nakayama D.K. Simmons R.L. Snyder S.H. Billiar T.R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3491-3495Crossref PubMed Scopus (807) Google Scholar). There are, at least, three genetically distinct types of NOS: type 1 (nNOS), a constitutive form which was initially identified in neurons; type 2 (iNOS), an inducible form from macrophages, and type 3 (eNOS), a constitutive form which was initially identified in endothelium. All isoforms utilize the amino acid arginine, molecular oxygen, and NADPH as substrates and require tetrahydrobiopterin, FAD, and FMN as cofactors(3.Marletta M.A. J. Biol. Chem. 1993; 268: 12231-12234Abstract Full Text PDF PubMed Google Scholar). The two constitutive forms are activated by and dependent on changes in intracellular calcium(5.Nathan C. FASEB J. 1992; 6: 3051-3064Crossref PubMed Scopus (4132) Google Scholar), whereas the inducible isoform is calcium independent apparently because calmodulin is a tightly bound subunit of the iNOS(34.Cho H.J. Xie Q.W. Calaycay J. Mumford R.A. Swiderek K.M. Lee T.D. Nathan C. J. Exp. Med. 1992; 176: 599-604Crossref PubMed Scopus (556) Google Scholar).Although there has been considerable research on the biological functions of NO and the regulation of NOS in humans and rodents(35.Nathan C. Xie Q. J. Biol. Chem. 1994; 269: 13725-13728Abstract Full Text PDF PubMed Google Scholar), little is known of NOS in any nonmammalian system. It has been reported that other species are capable of producing NO, such as Limulus polyphemus(35.Nathan C. Xie Q. J. Biol. Chem. 1994; 269: 13725-13728Abstract Full Text PDF PubMed Google Scholar), hematophagous insects(36.Ribeiro J.M.C. Hazzard J.M.H. Nussenzveig R.H. Champagne D.E. Walker F.A. Science. 1993; 260: 539-541Crossref PubMed Scopus (285) Google Scholar), fish(37.Holmqvist B.I. Östholm T. Alm P. Ekström P. Neurosci. Lett. 1994; 171: 205-208Crossref PubMed Scopus (100) Google Scholar), and chickens(38.Sung Y.J. Hotchkiss J.H. Austic R.E. Dieter R.R. J. Leukocyte Biol. 1991; 50: 49-56Crossref PubMed Scopus (100) Google Scholar). In addition, there is a single report of a primary structure of the constitutive NOS from Drosophila(39.Regulski M. Tully T. Proc. Natl. Acad. Sci. U. S. A. 1996; 92: 9072-9076Crossref Scopus (214) Google Scholar) but there are no known NOS sequences from other nonmammalian species. This has not only impeded the understanding the evolution of NOS protein but also made the study of the regulation of NOS at the molecular level in other species impossible. Since chickens do not possess the urea cycle (40.Tamir H. Ratner S. Arch. Biochem. Biophys. 1963; 102: 249-258Crossref PubMed Scopus (127) Google Scholar) and thus can not synthesize the substrate of NOS (arginine) directly, the chick represents a unique and potentially important model to study NOS gene expression. In an effort to study NOS regulation and to evaluate the evolution of NOS, we have cloned the first nonmammalian inducible NOS cDNA from a chicken macrophage cell line. In addition, we report the cloning and analysis of chicken iNOS 5′-flanking region. We have identified an upstream region of chicken iNOS gene responsible for LPS stimulation. In this LPS-responsive region, several transcription factor binding elements were identified, but NF-κB was shown to be involved in the induction of chicken iNOS gene expression.MATERIALS AND METHODSCell CultureThe chicken macrophage cell line, HD11(41.Beug H. von Krichbach A. Doderlein G. Conscience J. Graf T. Cell. 1979; 18: 375-390Abstract Full Text PDF PubMed Scopus (558) Google Scholar), was kindly provided by Dr. Dietert (Cornell University, Ithaca). Cells were maintained at 37°C, 5% CO2 in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) supplemented with 10% low endotoxin fetal bovine serum (Hyclone Laboratories, Logan, UT), penicillin, and streptomycin. LPS (Escherichia coli, serotype 0128:B12) was purchased from Sigma, prepared in DMEM medium at 1 mg/ml, and stored at −80°C prior to use. All other reagents were purchased from Sigma unless otherwise indicated.Reverse Transcription-PCR to Generate a Probe for cDNA Library ScreeningHighly degenerate oligonucleotides were deduced from conserved amino acid residues between rat neuronal NOS (24.Bredt D.S. Hwang P.M. Glatt C.E. Lowenstein C. Reed R.R. Snyder S.H. Nature. 1991; 351: 714-718Crossref PubMed Scopus (2163) Google Scholar) and mouse macrophage NOS (31.Lyons C.R. Orloff G.J. Cunningham J.M. J. Biol. Chem. 1992; 267: 6370-6374Abstract Full Text PDF PubMed Google Scholar, 32.Xie Q.W. Cho H.J. Calaycay J. Mumford R.A. Swiderek K.M. Lee T.D. Ding A.H. Troso T. Nathan C. Science. 1992; 256: 225-228Crossref PubMed Scopus (1732) Google Scholar) sequences for polymerase chain reaction. The reaction was performed by using total RNA from LPS-induced chicken macrophages, HD11. The two degenerate primers were: the sense strand, ITPVFHQEM (ATIACICCIGTITTICAICAIGAIATG), corresponding to amino acids 466-474 in mouse iNOS; the antisense strand, ATETGKS (CGITGICTITGICCITTIAG), corresponding to amino acids 538-544 in mouse iNOS. Restriction enzymes, EcoRI and HindIII, recognition sequences were flanked at the 5′ end of the primer sequences for subcloning purpose. A reverse transcription-PCR kit (Perkin-Elmer) was used with the renature temperature 50°C for 40 cycles. The PCR product was further subcloned in Bluescript plasmids (Stratagene), sequenced, and used as a probe for cDNA library screening.cDNA Library ScreeningThe cDNA library was made commercially (Stratagene) by using 500 μg of total RNA isolated from chicken macrophages stimulated with LPS (100 ng/ml) for 12 h. The cDNA library was constructed in λ ZAPII phages by using random priming and poly(A) priming on chicken macrophage mRNA. Phages were plated on E. coli strain MRF- and further transferred onto Dulose membranes (Stratagene). The membranes were hybridized in 2 × PIPES, 50% deionized formamide, 0.5% SDS, 100 μg/ml denatured, sonicated salmon sperm DNA, and random priming [32P]CTP-labeled PCR product (1 million cpm/ml) at 42°C for at least 18 h. Membranes were washed in 0.5 × SSC and 0.1% SDS at 60°C until radioactivity on membranes was below 1,000 cpm and then exposed to x-ray films for at least 8 h before developing. Approximately 1 million independent clones were screened and several dozen positive clones identified. Positive clones were successively spread and screened until pure clones were obtained. Twenty-four positive clones were further rescued to Bluescript plasmids as described by the manufacturer's procedures (Stratagene) for restriction enzyme digestion and DNA sequencing. Manual DNA sequencing was done using Sequenase 2.0 kits. (U. S. Biochemical Corp.) and verified using the automated sequencing facility at Cornell University (Applied Biosystems).Northern Blot AnalysisTotal RNA was isolated using guanidine thiocyanate in a single step method(42.Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (62982) Google Scholar), fractionated on a denaturing, 1% agarose gel, and transferred onto a GeneScreen Plus membrane (DuPont NEN). The blot was hybridized at 42°C in 5 × SSPE, 5 × Denhardt's solution, 0.1% SDS, 100 μg/ml salmon sperm DNA, 50% deionized formamide, and probed with [32P]CTP-labeled chicken iNOS cDNA (1 million cpm/ml). The probe was labeled by random priming. Membranes were washed at high stringency: 0.1 × SSPE, 0.1% SDS at 45°C. The blot was exposed to x-ray films at −80°C for at least 24 h before developing.Transient ExpressionThe chick iNOS cDNA which contained a full open reading frame obtained from cDNA library screening was excised at the EcoRI restriction enzyme site and subcloned into an eukaryotic expression vector, pcDNA3 (Invitrogen). The expression vector containing chick iNOS cDNA was transiently transfected into COS-1 cells by lipofection (LipofectAMINE, Life Technologies, Inc.). COS-1 cells, 1-1.2 × 105 cells, were seeded in each well on a 6-well plate 1 6 to 24 h prior to transfection. Cells were incubated at 37°C (5% CO2) until 50-60% confluence. Prior to transfection, cells were washed with DMEM without serum at least three times, and 2.4 μg of DNA and 12 μl of LipofectAMINE were added into culture dishes with DMEM alone. Five h later, an equal amount of DMEM plus 20% fetal calf serum with no antibiotics was added to each well. After 12 to 24 h, the medium was changed back to DMEM plus 10% fetal calf serum plus antibiotics with or without inhibitor (100 μML-NMMA or aminoguanidine) and with or without L- or D-arginine (1 mM). Two to three days after transfection, the cell culture supernatant was taken for nitrite analysis.Nitrite DeterminationNitrite was measured as described by Green et al.(43.Green L.C. Wagner D.A. Glogowski J. Skipper P.L. Wishnok J.S. Tannenbaum S.R. Anal. Biochem. 1982; 126: 131-138Crossref PubMed Scopus (10664) Google Scholar). 100 μl of cell culture supernatant was added to 100 μl of Griess reagent (1;1, v/v, 0.1% N-(1-naphthyl)ethylenediamine and 1% sulfanilamide in 5% H3PO4) in a 96-well flat-bottomed plate. The reading of absorbance at 550 nm was taken using medium as blank. Nitrite concentration was obtained by comparison with NaNO2 standard curve.Genomic Library ScreeningAn amplified genomic library derived from an adult Leghorn male chicken was purchased from Clontech (La Jolla, CA). The iNOS cDNA containing a full open reading frame was used as a probe and labeled by random priming. Screening procedures were followed according to the λ library protocol handbook from Clontech with minor modifications. Briefly, 30,000 to 40,000 plaques were seeded in each 150-mm Petri dish. Two million clones were screened, and duplicate membranes were used through screenings. Membranes were hybridized in 2 × PIPES, 50% deionized formamide, 0.5% SDS, and 100 μg/ml denatured, sheared salmon sperm DNA at 42°C for at least 16 h. Membranes were washed using the following conditions: twice (15 min each) at room temperature in 2 × SSC, 0.1% SDS; twice (15 min each) at 42°C in 2 × SSC, 0.1% SDS; twice (15 min each) at 65°C in 2 × SSC, 0.1% SDS. After membranes were washed, a Geiger counter was used to estimate the intensity of the signal and the background. If the background radioactivity was over 2,000 cpm, then the membranes would be washed another 3 times (15 min each) at 65°C at 2 × SSC, 0.1% SDS. Membranes were then exposed to x-ray films (X-Omar film, Kodak) at −70°C for at least 16 h. Positive plaques were rescreened by the same procedures until pure clones were obtained. Eight positive clones were obtained, and DNA from positive clones was purified. Restriction enzyme analyses (data not shown) indicated that these eight positive clones belonged to four independent clones.Cloning the 5′-Flanking Region of iNOS GeneDNA from the four independent genomic clones was subject to PCR reaction to identify the clones containing 5′-flanking sequence of chicken iNOS gene. A pair of primers were synthesized corresponding to the 5′ end sequences of iNOS cDNA with sense strand, TTCAAACCTCATGCTGTTAA (corresponding to most of amino acid residues 8-15); antisense strand, GATTATAGGTGACATCTTCA (corresponding to most of amino acid residues 52-58). The PCR reaction was set at an annealing temperature of 60°C for 25 cycles. After PCR reactions, 10 μl of PCR product was analyzed on an agarose gel (1%) along with DNA molecular weight markers. Among these four positive clones, only one clone possessed the 5′-flanking sequence of chicken iNOS gene (data not shown). λ phage DNA from this positive clone was digested by four different restriction enzymes, BamHI, EcoRI, XbaI, and SacI, and subcloned into Bluescript plasmid at the respective restriction enzyme sites. After subcloning, plasmids were transformed into E. coli cells (DH5α) and spread on ampicillin agar plates. Twelve colonies were randomly picked from each subcloning group, and their plasmids were isolated. PCR was used again to identify the colonies containing the 5′-flanking sequences of iNOS gene. Two colonies, one in the XbaI group and one in the SacI group, were identified to contain the 5′-flanking region of iNOS gene. The 5′-flanking region of iNOS was sequenced on both strands by a Sequenase 2.0 kit (U.S. Biochemical Corp.). The sequences were confirmed by the automated sequencing facility at Cornell University (Applied Biosystems). DNA sequence analysis identified that the one in the SacI group possessed the longer 5′-flanking sequence of iNOS gene than that of the XbaI group.Mapping the Transcriptional Start Site of the Chick iNOSThe primer extension analysis was applied to map the transcriptional initiation site of the chick iNOS gene. The avian myeloblastosis virus reverse transcriptase primer extension system from Promega was used with minor modifications. Total RNA was isolated from chicken macrophages, HD11 cells, stimulated with 100 ng/ml LPS or unstimulated. An oligonucleotide, GTTGTTCCCAAATCTGCTAG (see Fig. 4), complementary to the 5′ end sequence of the chicken iNOS was end-labeled with 32P, and it was used as the primer. The primer annealing temperature was 50°C for 1 h using 5 μg of total RNA. The reverse transcription was performed in using avian myeloblastosis virus reverse transcriptase at 41°C for 1 h. The same primer was used in DNA sequencing on a plasmid containing the 5′-flanking region of chick iNOS gene. The sequencing product was run side by side as a molecular weight marker with the primer extension product in a 6% sequencing gel. The gel was dried, transferred to chromatography paper, and exposed overnight to an x-ray film. The transcription initiation site of the chick iNOS gene was obtained by aligning the size of the reverse transcription product with the DNA sequencing result.Figure 4:Nucleotide sequence of the chicken iNOS 5′-flanking region. The mRNA initiation site is denoted as nucleotide position +1 which is bold. Intron 1 is enclosed with parentheses located from +86 to +182 (97 nucleotides). The complementary sequence of nucleotides, +52 to +71, was made as a primer (underlined arrow), 20 nucleotides long, for the primer extension experiment. A putative TATA box is located at nucleotide −30 (boxed). The region associated with LPS response was labeled with a vertical line. Potential transcription factor binding sites are underlined and labeled. All the transcription factor binding sites shown are perfect matches with reported consensus sequences.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Construction of a Reporter Gene with the Upstream Sequence of iNOS GeneA 3.2-kb fragment of iNOS upstream sequence was cloned into a luciferase reporter gene, pGL2 Basic (Promega). The iNOS 5′-flanking sequence was excised from the plasmid by PvuII and SacI restriction enzymes. The excised fragment was incubated with Klenow enzyme to generate blunt ends for ligation into a luciferase reporter gene. A pGL2 luciferase reporter plasmid was linearized by the XhoI restriction enzyme and incubated with Klenow enzyme to generate blunt ends. The linearized and blunt end insert (iNOS 5′ end fragment) and vector (pGL2) were incubated together in the presence of the ligation buffer and 1 μl of high concentration T4 ligase (15 units/μl) at 18°C overnight. The ligation mixture was transformed into DH5α E. coli cells and spread on ampicillin agar plates. Six colonies were randomly picked from the plates, and their plasmids were isolated. The isolated plasmids were digested individually with restriction enzymes (HindIII and KpnI) to screen the clone containing the iNOS upstream fragment insert. The positive clones were sequenced to determine the orientation of the insert. The clone containing the correct orientation was used to generate deletion clones.Construction of Deletion ClonesA series of deletion constructs were made from a chimeric plasmid containing the 3.2-kb 5′ upstream region of the iNOS gene ligated in front of a luciferase gene by using a kit, Erase-a-Base system (Promega). The plasmid (20 μg) was digested with MluI and KpnI restriction enzymes to generate 5′- and 3′-protruding ends, respectively. Exonuclease III was used to digest the 5′-protruding end of DNA at 25°C which would digest approximately 90 base pairs per min. An aliquot of DNA was taken every minute to obtain a spectrum of deletion clones. The partial digested DNA was then treated with S1 nuclease and Klenow enzyme to generate blunt ends. The DNA with two blunt ends were ligated together by T4 DNA ligase at room temperature for 1 h. The ligation mixture was transformed into E. coli DH5α competent cells. Plasmid was isolated from randomly picked colonies, and the size of deletion clones was estimated by PCR reaction by using the primers generated from pGL2 vector close to the polycloning sites. DNA sequencing was used to identify the exact size of the deletion clones.Transient Expression of Deletion ClonesHD11 cells (1.8 × 106 cells/dish) were seeded in a 100-mm culture dish 24 h before transfection. Cells were kept in DMEM plus 10% fetal bovine serum and antibiotics at 37°C in a 5% CO2 incubator until cells were approximately 60% confluent. HD11 cells were then washed with DMEM buffer without serum and antibiotics three times prior to transfection. For every two 100-mm culture dishes, 4 μg of reporter DNA containing galactosidase gene as a control for transfection efficiency and 4 μg of reporter DNA containing various sizes of iNOS upstream sequence were used in transfection experiments. The two kinds of DNA were mixed well before being distributed into two tubes for transfection. Therefore, each tube contains 4 μg of DNA. LipofectAMINE (30 μl/tube) was then added to each tube. DNA and LipofectAMINE were mixed thoroughly and incubated at room temperature for at least 30 min prior to adding to cell culture dishes. HD11 cells were then incubated with DNA and LipofectAMINE mixture in DMEM without serum and antibiotics. Five hours after transfection, HD11 cells were harvested by scraping with a rubber policeman and pooled from two dishes. Transfected cells were washed twice with DMEM without serum and then reseeded into a 6-well culture dish in the presence or absence of 100 ng/ml LPS. 15 h after LPS treatment, cellular extract was isolated and luciferase and β-galactosidase activities were measured.RESULTSChicken Macrophage NOS SequenceOligonucleotide primers (see “Materials and Methods”) designed from the conserved sequences between mouse macrophage NOS (31.Lyons C.R. Orloff G.J. Cunningham J.M. J. Biol. Chem. 1992; 267: 6370-6374Abstract Full Text PDF PubMed Google Scholar, 32.Xie Q.W. Cho H.J. Calaycay J. Mumford R.A. Swiderek K.M. Lee T.D. Ding A.H. Troso T. Nathan C. Science. 1992; 256: 225-228Crossref PubMed Scopus (1732) Google Scholar) and rat brain NOS (24.Bredt D.S. Hwang P.M. Glatt C.E. Lowenstein C. Reed R.R. Snyder S.H. Nature. 1991; 351: 714-718Crossref PubMed Scopus (2163) Google Scholar) were used to amplify by reverse transcription-PCR on total RNA from chicken macrophages stimulated with LPS (100 ng/ml). A partial chick type II NOS (iNOS) cDNA was obtained which was approximately 220 bp and showed 68% sequence identity with mouse iNOS cDNA and no sequence similarity to any other existing proteins in GenBank™ (data not shown). Thus, the PCR product was used as a probe to screen a chicken macrophage cDNA library. Approximately 1 million independent clones from an unamplified library were screened, and hundreds of positive clones were identified. After secondary and tertiary screening, 24 independent clones were isolated. A clone containing the longest insert was fully sequenced on both strands. It possessed an open reading frame which encoded 1,136 amino acid residues, predicting a protein of 129,648 Da molecular mass. The deduced amino acid sequence of chicken macrophage NOS was aligned with published NOS sequence by using MEGALIGN in DNA STAR, Lasergene (Fig. 1). There were conserved regions in deduced amino acid sequences of chicken iNOS for the binding of iNOS cofactors: heme, calmodulin, FMN, FAD, and NADPH.Figure 1:The deduced amino acid sequence of chicken macrophage iNOS (CKiNOS) aligned with the amino acid sequences of murine macrophage iNOS (MUiNOS)(31.Lyons C.R. Orloff G.J. Cunningham J.M. J. Biol. Chem. 1992; 267: 6370-6374Abstract Full Text PDF PubMed Google Scholar, 32.Xie Q.W. Cho H.J. Calaycay J. Mumford R.A. Swiderek K.M. Lee T.D. Ding A.H. Troso T. Nathan C. Science. 1992; 256: 225-228Crossref PubMed Scopus (1732) Google Scholar), human chondrocyte iNOS (HUiNOS)(44.Charles I.G. Palmer R.M.J. Hickery M.S. Bayliss M.T. Chubb A.P. Hall V.S. Moss D.W. Moncada S. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11419-11423Crossref PubMed Scopus (279) Google Scholar), bovine endothelial cNOS (BOeNOS)(28.Sessa W.C. Harrison J.K. Barber C.M. Zeng D. Durieux M.E. D'Angelo D.D. Lynch K.R. Peach M.J. J. Biol. Chem. 1992; 267: 15274-" @default.
• W2023361821 created "2016-06-24" @default.
• W2023361821 creator A5025676014 @default.
• W2023361821 creator A5030863863 @default.
• W2023361821 creator A5085102985 @default.
• W2023361821 date "1996-05-01" @default.
• W2023361821 modified "2023-10-03" @default.
• W2023361821 title "Molecular Cloning and Expression of an Avian Macrophage Nitric-oxide Synthase cDNA and the Analysis of the Genomic 5′-Flanking Region" @default.
• W2023361821 cites W1481149004 @default.
• W2023361821 cites W1481797092 @default.
• W2023361821 cites W1496457337 @default.
• W2023361821 cites W150631554 @default.
• W2023361821 cites W1511098597 @default.
• W2023361821 cites W1519147845 @default.
• W2023361821 cites W1591881963 @default.
• W2023361821 cites W1599900714 @default.
• W2023361821 cites W1764308599 @default.
• W2023361821 cites W1834041853 @default.
• W2023361821 cites W1872515919 @default.
• W2023361821 cites W1908877967 @default.
• W2023361821 cites W1945050693 @default.
• W2023361821 cites W1965077361 @default.
• W2023361821 cites W1965341406 @default.
• W2023361821 cites W1966964245 @default.
• W2023361821 cites W1968902673 @default.
• W2023361821 cites W1972272933 @default.
• W2023361821 cites W1978470067 @default.
• W2023361821 cites W1987149804 @default.
• W2023361821 cites W1988251156 @default.
• W2023361821 cites W1990802251 @default.
• W2023361821 cites W1993353847 @default.
• W2023361821 cites W1995170726 @default.
• W2023361821 cites W1995418515 @default.
• W2023361821 cites W1997526564 @default.
• W2023361821 cites W2005484362 @default.
• W2023361821 cites W2006369456 @default.
• W2023361821 cites W2009013636 @default.
• W2023361821 cites W2012970516 @default.
• W2023361821 cites W2013023382 @default.
• W2023361821 cites W2014450630 @default.
• W2023361821 cites W2015230796 @default.
• W2023361821 cites W2016470389 @default.
• W2023361821 cites W2016687652 @default.
• W2023361821 cites W2020530535 @default.
• W2023361821 cites W2021334430 @default.
• W2023361821 cites W2023170094 @default.
• W2023361821 cites W2034623336 @default.
• W2023361821 cites W2044918962 @default.
• W2023361821 cites W2050283646 @default.
• W2023361821 cites W2050526040 @default.
• W2023361821 cites W2051764123 @default.
• W2023361821 cites W2059379142 @default.
• W2023361821 cites W2059432819 @default.
• W2023361821 cites W2062083637 @default.
• W2023361821 cites W2069123025 @default.
• W2023361821 cites W2073141866 @default.
• W2023361821 cites W2086823174 @default.
• W2023361821 cites W2092145002 @default.
• W2023361821 cites W2092496846 @default.
• W2023361821 cites W2093195099 @default.
• W2023361821 cites W2094038408 @default.
• W2023361821 cites W2094745968 @default.
• W2023361821 cites W2129250847 @default.
• W2023361821 cites W213143266 @default.
• W2023361821 cites W2134785329 @default.
• W2023361821 cites W2152098493 @default.
• W2023361821 cites W2153491246 @default.
• W2023361821 cites W2161945201 @default.
• W2023361821 cites W4232581823 @default.
• W2023361821 cites W4294216491 @default.
• W2023361821 doi "https://doi.org/10.1074/jbc.271.20.11911" @default.
• W2023361821 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/8662618" @default.
• W2023361821 hasPublicationYear "1996" @default.
• W2023361821 type Work @default.
• W2023361821 sameAs 2023361821 @default.
• W2023361821 citedByCount "128" @default.
• W2023361821 countsByYear W20233618212012 @default.
• W2023361821 countsByYear W20233618212013 @default.
• W2023361821 countsByYear W20233618212014 @default.
• W2023361821 countsByYear W20233618212015 @default.
• W2023361821 countsByYear W20233618212016 @default.
• W2023361821 countsByYear W20233618212017 @default.
• W2023361821 countsByYear W20233618212018 @default.
• W2023361821 countsByYear W20233618212019 @default.
• W2023361821 countsByYear W20233618212020 @default.
• W2023361821 countsByYear W20233618212021 @default.
• W2023361821 countsByYear W20233618212022 @default.
• W2023361821 countsByYear W20233618212023 @default.
• W2023361821 crossrefType "journal-article" @default.
• W2023361821 hasAuthorship W2023361821A5025676014 @default.
• W2023361821 hasAuthorship W2023361821A5030863863 @default.
• W2023361821 hasAuthorship W2023361821A5085102985 @default.
• W2023361821 hasBestOaLocation W20233618211 @default.
• W2023361821 hasConcept C104317684 @default.
• W2023361821 hasConcept C121050878 @default.
• W2023361821 hasConcept C153911025 @default.
• W2023361821 hasConcept C17757408 @default.
• W2023361821 hasConcept C181199279 @default.

• next