FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023525078> ?p ?o ?g. }

• W2023525078 endingPage "4303" @default.
• W2023525078 startingPage "4300" @default.
• W2023525078 abstract "Known RGS proteins stimulate GTPase activity of Gi and Gq family members, but do not interact with Gsα and G12α. To determine the role of specific Gα residues for RGS protein recognition, six RGS contact residues of chimeric transducin α-subunit (Gtα) corresponding to the residues that differ between Giα and Gsα have been replaced by Gsα residues. The ability of human retinal RGS (hRGSr) to bind mutant Gtα subunits and accelerate their GTPase activity was investigated. Substitutions Thr178 → Ser, Ile181 → Phe, and Lys205 → Arg of Gtα did not alter its interaction with hRGSr. The Lys176 → Leu mutant had the same affinity for hRGSr as Gtα, but the maximal GTPase stimulation by hRGSr was reduced by ∼2.5-fold. The substitution His209 → Gln led to a 3-fold decrease in the affinity of hRGSr for the Gtα mutant without significantly affecting the maximal GTPase enhancement. The Ser202 → Asp mutation abolished Gtα recognition by hRGSr. A counteracting replacement of Glu129 by Ala in hRGSr did not restore the interaction of hRGSr with the Gtα Ser202 → Asp mutant. Our data suggest that the Ser residue at position 202 of Gtα is critical for the specificity of RGS proteins toward Gi and Gq families of G-proteins. Consequently, the corresponding residue, Asp229 of Gsα, is likely responsible for the inability of RGS proteins to interact with Gsα. Known RGS proteins stimulate GTPase activity of Gi and Gq family members, but do not interact with Gsα and G12α. To determine the role of specific Gα residues for RGS protein recognition, six RGS contact residues of chimeric transducin α-subunit (Gtα) corresponding to the residues that differ between Giα and Gsα have been replaced by Gsα residues. The ability of human retinal RGS (hRGSr) to bind mutant Gtα subunits and accelerate their GTPase activity was investigated. Substitutions Thr178 → Ser, Ile181 → Phe, and Lys205 → Arg of Gtα did not alter its interaction with hRGSr. The Lys176 → Leu mutant had the same affinity for hRGSr as Gtα, but the maximal GTPase stimulation by hRGSr was reduced by ∼2.5-fold. The substitution His209 → Gln led to a 3-fold decrease in the affinity of hRGSr for the Gtα mutant without significantly affecting the maximal GTPase enhancement. The Ser202 → Asp mutation abolished Gtα recognition by hRGSr. A counteracting replacement of Glu129 by Ala in hRGSr did not restore the interaction of hRGSr with the Gtα Ser202 → Asp mutant. Our data suggest that the Ser residue at position 202 of Gtα is critical for the specificity of RGS proteins toward Gi and Gq families of G-proteins. Consequently, the corresponding residue, Asp229 of Gsα, is likely responsible for the inability of RGS proteins to interact with Gsα. Heterotrimeric GTP-binding proteins (G-proteins) are components of many major signaling systems that are used by cells to transduce a variety of signals from specific cell surface receptors to intracellular effector proteins. Regulation of G-protein GTPase activity represents an important mechanism for establishing proper signal duration. A novel class of proteins called RGS 1The abbreviations used are: RGS proteins, regulators of G-protein signaling; hRGSr, human retinal RGS protein; ROS, rod outer segment(s); uROS, urea-washed ROS membranes; GAP, GTPase-activating protein; Gtα, rod G-protein (transducin) α-subunit; Giα, Gsα, Gqα, and Gzα, α-subunits of G-proteins; GST, glutathione S-transferase; Chi8, chimera 8; PCR, polymerase chain reaction. forregulators of G-protein signaling has been identified (1Koelle M.R. Horvitz H.R. Cell. 1996; 84: 115-125Abstract Full Text Full Text PDF PubMed Scopus (480) Google Scholar, 2De Vries L. Mousli M. Wurmser A. Farquhar M.G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11916-11920Crossref PubMed Scopus (266) Google Scholar, 3Druey K.M. Blumer K.J. Kang V.H. Kehrl J.H. Nature. 1996; 379: 742-746Crossref PubMed Scopus (407) Google Scholar, 4Dohlman H.G. Thorner J. J. Biol. Chem. 1997; 272: 3871-3874Abstract Full Text Full Text PDF PubMed Scopus (450) Google Scholar, 5Koelle M.R. Curr. Opin. Cell Biol. 1997; 9: 143-147Crossref PubMed Scopus (175) Google Scholar). Evidence has been accumulated that members of this family negatively regulate signaling via Gi and Gq-like G-proteins by stimulating their GTPase activity (6Berman D.M. Wilkie T.M. Gilman A.G. Cell. 1996; 86: 445-452Abstract Full Text Full Text PDF PubMed Scopus (652) Google Scholar, 7Watson N. Linder M.E. Druey K.M. Kehrl J.H. Blumer K.J. Nature. 1996; 383: 172-175Crossref PubMed Scopus (476) Google Scholar, 8Hunt T.W. Fields T.A. Casey P.J. Peralta E.G. Nature. 1996; 383: 175-177Crossref PubMed Scopus (310) Google Scholar, 9Berman D.M. Kozasa T. Gilman A.G. J. Biol. Chem. 1996; 271: 27209-27212Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar, 10Huang C. Hepler J.R. Gilman A.G. Mumby S.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6159-6163Crossref PubMed Scopus (151) Google Scholar). Identification of RGS proteins has helped to solve a long standing discrepancy between the fast signal termination in vivo and relatively slow intrinsic GTPase rates typically observed under in vitro conditions (6Berman D.M. Wilkie T.M. Gilman A.G. Cell. 1996; 86: 445-452Abstract Full Text Full Text PDF PubMed Scopus (652) Google Scholar, 11Gilman A.G. Annu. Rev. Biochem. 1987; 56: 615-649Crossref PubMed Scopus (4714) Google Scholar). However, no RGS protein or other GTPase-activating protein (GAP) specific toward Gsα has been described to date (9Berman D.M. Kozasa T. Gilman A.G. J. Biol. Chem. 1996; 271: 27209-27212Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar, 10Huang C. Hepler J.R. Gilman A.G. Mumby S.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6159-6163Crossref PubMed Scopus (151) Google Scholar). The recently solved crystal structure of RGS4 bound to Giα1·AlF4−provides the first structural insights into the mechanism of RGS protein GAP function and offers a starting point for studying the structural basis of the specificity of known RGS proteins (12Tesmer J.J.G. Berman D.M. Gilman A.G. Sprang S.R. Cell. 1997; 89: 251-261Abstract Full Text Full Text PDF PubMed Scopus (687) Google Scholar). RGS4 interacts with the switch regions of Giα1that are likely to have a similar general conformation with the corresponding regions of Gsα (12Tesmer J.J.G. Berman D.M. Gilman A.G. Sprang S.R. Cell. 1997; 89: 251-261Abstract Full Text Full Text PDF PubMed Scopus (687) Google Scholar). The incompetence of RGS proteins to bind and stimulate the GTPase activity of Gsα therefore originates from the differences between amino acid residues of Giα1 contacting RGS4 and corresponding residues of Gsα. In this study we investigate molecular determinants of the specificity of RGS/G-protein interaction using transducin α-subunit (Gtα) as a prototypical member of the Gifamily and a human homologue (hRGSr) of mouse retinal mRGSr (13Chen C.K. Wieland T. Simon M.I. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12885-12889Crossref PubMed Scopus (124) Google Scholar, 14Natochin M. Granovsky A.E. Artemyev N.O. J. Biol. Chem. 1997; 272: 17444-17449Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). We have carried out mutational analysis of specific amino acid residues of chimeric Gtα corresponding to the RGS contact residues that are different between Giα and Gsα to determine their specific role for RGS protein recognition. GTP was a product of Boehringer Mannheim. [γ-32P]GTP (>5000 Ci/mmol) was purchased from Amersham Corp. All other chemicals were acquired from Sigma. Bovine ROS membranes were prepared as described previously (15Papermaster D.S. Dreyer W.J. Biochemistry. 1974; 13: 2438-2444Crossref PubMed Scopus (579) Google Scholar). Urea-washed ROS membranes (uROS) were prepared according to protocol in Ref. 16Yamanaka G. Eckstein F. Stryer L. Biochemistry. 1985; 24: 8094-8101Crossref PubMed Scopus (80) Google Scholar. Gtβγ was prepared by the procedure described in Ref. 17Kleuss C. Pallast M. Brendel S. Rosenthal W. Scultz G. J. Chromatogr. 1987; 407: 281-289Crossref PubMed Scopus (43) Google Scholar. GST-hRGSr and hRGSr were prepared and purified as described previously (14Natochin M. Granovsky A.E. Artemyev N.O. J. Biol. Chem. 1997; 272: 17444-17449Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). The purified proteins were stored in 40% glycerol at −20 °C or without glycerol at −80 °C. Mutagenesis of Gtα residues was performed using the vector for expression of His6-tagged Gtα/Giα1 chimera 8 (Chi8) as a template for PCR amplifications (18Skiba N.P. Bae H. Hamm H.E. J. Biol. Chem. 1996; 271: 413-424Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar). The Gtα Lys176 → Leu and Thr178 → Ser substitutions were introduced using 5′-primer 1 and 3′-primers 2 and 3, respectively, for PCR amplification (see below). The PCR products were digested withBsmBI and subcloned into the BsmBI-digested pHis6Chi8. Primer 3 also contained silent mutations creating the unique XbaI site that was used to make the Ile181 → Phe mutant. The 5′-primer 4 and 3′-primer 5 were used to obtain the PCR product carrying the Ile181 → Phe mutation. The product was cut with XbaI and HindIII and subcloned into theXbaI/HindIII-digested pHis6Chi8 Thr178 → Ser. The Ser202 → Asp and Lys205 → Arg substitutions were introduced by PCR-directed mutagenesis using 5′-primer 6 and 3′-primers 7 and 8, respectively, followed by insertion of theNcoI/BamHI-digested PCR products into pHis6Chi8. Mutation His209 → Gln was generated using 5′-primer 9 and 3′-primer 5 and subcloning of the PCR product into the BamHI and HindIII sites of pHis6Chi8. The sequences of all mutants were verified by automated DNA sequencing at the University of Iowa DNA Core Facility. Chi8 and all mutants were expressed and purified as described previously (18Skiba N.P. Bae H. Hamm H.E. J. Biol. Chem. 1996; 271: 413-424Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar). The purified proteins were tested in the trypsin protection assay as described (19Kleuss C. Raw A.S. Lee E. Sprang S.R. Gilman A.G. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9828-9831Crossref PubMed Scopus (94) Google Scholar). The following primers were used to generate mutant Chi8 (the restriction sites are underlined and mutated codons are in bold): Primer 1, TGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGG; Primer 2, GAACTGCGTCTC AAT GAT ACC CGT GGT CAG GAC ACG GG; Primer 3, GAACTG CGTCTC AAT GAT ACC CGA GGT CTT GAC TCT AGA GCG C; Primer 4, GCGC TCT AGA GTC AAG ACC ACG GGT ATC TTT GAG; Primer 5, TCGTCTTCAAGAATCGATAAGCTT; Primer 6, ATC ACG CC ATG GGG GCT GGG GCC AGC; Primer 7, A GCA GTG GAT CCA CTT CTT GCG CTC ATC GCG CTG CC; Primer 8, A GCA GTG GAT CCA CTT GCG GCG CTC TGA GC; Primer 9, AAG TGG ATCC AG TGC TTT GAA GGC. A substitution Glu129 → Ala of hRGSr was performed using PCR amplifications from the pGEX-KG-hRGSr template (14Natochin M. Granovsky A.E. Artemyev N.O. J. Biol. Chem. 1997; 272: 17444-17449Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar) similarly as described (20Natochin M. McEntaffer R.L. Artemyev N.O. J. Biol. Chem. 1998; 273 (in press)Google Scholar). GST-hRGSr and the mutant were expressed in DH5αEscherichia coli cells, and the GST portion was removed as described earlier (14Natochin M. Granovsky A.E. Artemyev N.O. J. Biol. Chem. 1997; 272: 17444-17449Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Chi8 or its mutants (1 μm final concentration) were mixed with glutathione-agarose retaining ∼10 μg of GST-hRGSr in 200 μl of 20 mm HEPES buffer (pH 7.6) containing 100 mm NaCl, 2 mm MgCl2, 30 μm AlCl3, and 10 mm NaF (buffer A). After incubation for 20 min at 25 °C, the agarose beads were spun down, washed three times with 1 ml of buffer A, and the bound proteins were eluted with a sample buffer for SDS-polyacrylamide gel electrophoresis. Single turnover GTPase activity measurements were carried out in suspensions of uROS membranes (5 μm rhodopsin) reconstituted with chimeric Gtα or its mutants (2 μm) and Gtβγ (1 μm) essentially as described in Refs. 14Natochin M. Granovsky A.E. Artemyev N.O. J. Biol. Chem. 1997; 272: 17444-17449Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar and 21Arshavsky V.Y. Gray-Keller M.P. Bownds M.D. J. Biol. Chem. 1991; 266: 18530-18537Abstract Full Text PDF PubMed Google Scholar. Bleached uROS membranes were mixed with different concentrations of hRGSr or hRGSrGlu129 → Ala and preincubated for 5 min at 25 °C. The GTPase reaction was initiated by addition of 100 nm [γ-32P]GTP (∼4 × 105 dpm/pmol). The GTPase rate constants were calculated by fitting the experimental data to an exponential function: % GTP hydrolyzed = 100(1 − e −kt), where k is a rate constant for GTP hydrolysis. Protein concentrations were determined by the method of Bradford (22Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (216334) Google Scholar) using IgG as a standard or using calculated extinction coefficients at 280 nm. SDS-polyacrylamide gel electrophoresis was performed by the method of Laemmli (23Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207192) Google Scholar) in 12% acrylamide gels. Rhodopsin concentrations were measured using the difference in absorbance at 500 nm between “dark” and bleached ROS preparations. Fitting of the experimental data was performed with nonlinear least squares criteria using GraphPad Prizm (version 2) software. The results are expressed as the mean ± S.E. of triplicate measurements. Six residues directly interacting with RGS4 are different in Giα1 and Gsα (12Tesmer J.J.G. Berman D.M. Gilman A.G. Sprang S.R. Cell. 1997; 89: 251-261Abstract Full Text Full Text PDF PubMed Scopus (687) Google Scholar). These residues correspond to Lys176, Thr178, Ile181, Ser202, Lys205, and His209 of Gtα. Except for a conservative substitution, Gtα Ile181/Giα1 Val185, these residues are identical in Gtα and Giα1. To analyze functional consequences of the replacement of these Gtα residues by corresponding Gsα residues we took advantage of the efficient expression of functional Gtα/Giα1 chimeras in E. coli (18Skiba N.P. Bae H. Hamm H.E. J. Biol. Chem. 1996; 271: 413-424Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar). All the Gtα mutants were made based on Chi8 that contains 80% of Gtα amino acid sequence, including all three Gtα switch regions (18Skiba N.P. Bae H. Hamm H.E. J. Biol. Chem. 1996; 271: 413-424Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar). Analysis of Chi8 GTPase activity showed properties similar to native Gtα. The GTP hydrolysis by Chi8 alone or in the presence of uROS was negligible (not shown). In the presence of both, uROS and Gtβγ, the basal GTPase activity of Chi8 was 0.016 ± 0.002 s−1 (Fig. 1). A similar rate of GTP hydrolysis (0.019 s−1) was observed earlier for holotransducin, Gtαβγ, reconstituted with uROS under similar conditions (14Natochin M. Granovsky A.E. Artemyev N.O. J. Biol. Chem. 1997; 272: 17444-17449Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). This suggests that despite a lack of myristoylation and the His6-tag attached to the N terminus, Chi8 was competent to interact with Gtβγ and light-activated rhodopsin. The GTPase activity of Chi8 was substantially enhanced in the presence of hRGSr. Addition of 1 μm hRGSr led to acceleration of the GTPase activity by almost 8-fold (k = 0.126 ± 0.018 s−1) (Fig. 1). Stimulation of GTPase activity of transducin by hRGSr under similar conditions was ∼10-fold (14Natochin M. Granovsky A.E. Artemyev N.O. J. Biol. Chem. 1997; 272: 17444-17449Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Furthermore, the dose dependence of the stimulation of Chi8 GTPase activity by hRGSr yielded an EC50 value of 109 ± 15 nm (Fig. 2 A), which correlates well with the EC50 value of 85 nm for the effect of hRGSr on transducin (24Natochin M. Lipkin V.M. Artemyev N.O. FEBS Lett. 1997; 411: 179-182Crossref PubMed Scopus (12) Google Scholar). Effects of hRGSr on the GTPase activity of Chi8 suggest that this chimeric G-protein was an appropriate target for the site-directed mutagenesis.Figure 2Dose dependence of GTPase activity stimulation of Gtα mutants by hRGSr. The GTPase rate constants for Gtα mutants in suspensions of urea-washed ROS membranes (5 μm rhodopsin, 2 μmGtα mutant, 1 μm Gtβγ) were determined in the presence of increasing concentrations of hRGSr. Symbols indicate EC50 values as follows: □, 109 ± 15 nm (Chi8); ⋄, 103 ± 17 nm (T178S); ▿, 186 ± 24 nm (I181F); ▵, 147 ± 13 nm (K205R); ▪, 337 ± 25 nm (H209Q); ▴, 129 ± 21 nm (K176L); ♦, S202D.View Large Image Figure ViewerDownload (PPT) Expression of Chi8 and all six Gtα mutants, Lys176 → Leu, Thr178 → Ser, Ile181 → Phe, Ser202 → Asp, Lys205 → Arg, and His209 → Gln produced comparable amounts of fully soluble proteins (∼5–7 mg/liter of culture). Mutants Lys176 → Leu, Ile181 → Phe, Lys205 → Arg, and His209 → Gln, similarly to Chi8 and transducin, had basal GTPase activities in the range of 0.014–0.023 s−1 (Fig. 1). The Ser202→ Asp mutation led to a small reduction in the basal GTPase rate (k = 0.012 ± 0.001 s−1). Interestingly, Gtα Thr178 → Ser had an elevated basal GTPase activity (k = 0.032 ± 0.003 s−1) (Fig. 1). The maximal stimulation of GTPase activity of Thr178 → Ser, Ile181 → Phe, Lys205 → Arg and His209 → Gln mutants by hRGSr was 5.0–7.5-fold, comparable with the effects of hRGSr on Chi8 (Fig. 2 A). A lower, only ∼3-fold, maximal GTPase rate enhancement resulted from addition of hRGSr to Gtα Lys176 → Leu (Fig. 2 B). hRGSr failed to elicit any notable stimulation of GTPase activity of Gtα Ser202 → Asp (Fig. 2 B). The concentration dependence curves for stimulation of GTPase activity of different mutants by hRGSr revealed modest variations in the EC50values. Mutants Lys176 → Leu, Thr178 → Ser, Ile181 → Phe, and Lys205 → Arg had the EC50 values comparable with the EC50 value for Chi8 and transducin, suggesting that these mutations did not alter affinity of the G-protein-RGS interaction (Fig. 2, A and B). A 3-fold increase in the EC50 value was observed for the His209 → Gln mutant (EC50337 ± 25 nm) (Fig. 2 A). Binding between the Gtα mutants and hRGSr was examined using precipitation of mutants by glutathione-agarose beads containing immobilized GST-hRGSr. hRGSr, as many other RGS proteins, binds with high affinity to the AlF4− conformation of G-protein α-subunits (7Watson N. Linder M.E. Druey K.M. Kehrl J.H. Blumer K.J. Nature. 1996; 383: 172-175Crossref PubMed Scopus (476) Google Scholar, 9Berman D.M. Kozasa T. Gilman A.G. J. Biol. Chem. 1996; 271: 27209-27212Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar, 14Natochin M. Granovsky A.E. Artemyev N.O. J. Biol. Chem. 1997; 272: 17444-17449Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). The binding assay demonstrated that GST-hRGSr in the presence of AlF4−was able to precipitate nearly stoichiometric amounts of Chi8, and all of the Gtα mutants, except Gtα Ser202 → Asp (Fig. 3 A). The competence of hRGSr to efficiently precipitate the mutant Lys176 → Leu is consistent with the EC50 value of 129 nm for the stimulation of its GTPase activity, even though the maximal GTPase enhancement by hRGSr for this mutant was substantially decreased. Gtα Ser202 → Asp failed to bind GST-hRGSr using this assay (Fig. 3 A). The failure of Gtα Ser202 → Asp to bind GST-hRGSr is not caused by its inability to bind AlF4− and assume an active conformation. Chi8 and the Ser202 → Asp mutant demonstrated equivalent degrees of protection of their switch II region from tryptic cleavage upon binding of AlF4− (Fig. 3 B). The binding data indicate correlation between the stimulatory effects of hRGSr on the Gtα mutants in the GTPase assay and ability of hRGRr to bind these mutants. The deficiency of hRGSr to stimulate GTPase activity of Gtα Ser202 → Asp has resulted from the loss of the affinity of this interaction. However, the Lys176 → Leu substitution appeared to produce a different result. The reduction in the maximal GTPase acceleration of Gtα Lys176 → Leu occurred without a concurrent decrease in affinity of the G-protein/RGS interaction. Based on the crystal structure of RGS4 bound to Giα1·AlF4−(12Tesmer J.J.G. Berman D.M. Gilman A.G. Sprang S.R. Cell. 1997; 89: 251-261Abstract Full Text Full Text PDF PubMed Scopus (687) Google Scholar), a residue Ser202 makes a contact with hRGSr residue Glu129. We have tested the possibility that a complementary replacement of hRGSr residue Glu129 by Ala would restore the ability of hRGSr to interact and stimulate GTPase activity of Gtα Ser202 → Asp. hRGSr Glu129→ Ala was fully active toward Chi8 and five of its mutants, but deficient of any GAP activity toward Gtα Ser202 → Asp (not shown). Similarly, to the wild type hRGSr, the Glu129 → Ala mutant failed to bind Gtα Ser202 → Asp, whereas its binding to Chi8 was intact (Fig. 3 C). Since its recent discovery, the family of RGS proteins has been rapidly growing. Those RGS proteins that have already been extensively characterized share a common specificity pattern. These RGS proteins interact with G-protein α-subunits from Gi and Gq families but have no activity toward Gs(6Berman D.M. Wilkie T.M. Gilman A.G. Cell. 1996; 86: 445-452Abstract Full Text Full Text PDF PubMed Scopus (652) Google Scholar, 7Watson N. Linder M.E. Druey K.M. Kehrl J.H. Blumer K.J. Nature. 1996; 383: 172-175Crossref PubMed Scopus (476) Google Scholar, 8Hunt T.W. Fields T.A. Casey P.J. Peralta E.G. Nature. 1996; 383: 175-177Crossref PubMed Scopus (310) Google Scholar, 10Huang C. Hepler J.R. Gilman A.G. Mumby S.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6159-6163Crossref PubMed Scopus (151) Google Scholar) and G12 (9Berman D.M. Kozasa T. Gilman A.G. J. Biol. Chem. 1996; 271: 27209-27212Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar). Both possibilities remain open: a member(s) of the RGS family capable of interaction with Gsα (G12α) has not been yet identified or characterized, or none of the RGS proteins would be a GAP for Gsα (G12α). The answer to this question lies in understanding the structural details and requirements for RGS/G-protein interaction. The crystal structure of the complex of RGS4 with Giα1·AlF4−has revealed a structural basis for the inability of RGS4 to interact with Gsα. Six amino acid residues from the RGS/G-protein interface are different between Giα and Gsα (12Tesmer J.J.G. Berman D.M. Gilman A.G. Sprang S.R. Cell. 1997; 89: 251-261Abstract Full Text Full Text PDF PubMed Scopus (687) Google Scholar). Three of these residues, corresponding to Thr178, Ser202, and His209 in Gtα are conserved among the Giα, Gtα, Gqα, and Gzα subunits that are known to interact with RGS. Another two Gtα residues, Ile181 and Lys205, have homologous substitutions. Ile181 is substituted by Val in Giα and Gzα, and Lys205 is replaced by Arg in Gqα. To identify the residue(s) critical for the failure of Gsα to interact with RGS proteins, we replaced the RGS contact residues in Gtα by corresponding residues in Gsα and examined the ability (EC50 and Vmax) of hRGSr to stimulate GTPase activity of these mutants. hRGSr is a human homologue (hRGSr) of mouse retinal mRGS, which was originally thought to be a retina-specific RGS protein, but later it was found in other tissues as well (13Chen C.K. Wieland T. Simon M.I. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12885-12889Crossref PubMed Scopus (124) Google Scholar, 25Buckbinder L. Velasco-Miguel S. Chen Y. Xu N. Talbott R. Gelbert L. Gao J. Seizinger B.R. Gutkind J.S. Kley N. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7868-7872Crossref PubMed Scopus (84) Google Scholar). Like other characterized RGS proteins, hRGSr interacts with Gi- and Gq-like α-subunits, but does not bind Gsα (24Natochin M. Lipkin V.M. Artemyev N.O. FEBS Lett. 1997; 411: 179-182Crossref PubMed Scopus (12) Google Scholar). Substitutions Thr178 → Ser, Ile181 → Phe, and Lys205 → Arg did not significantly alter the activity of hRGSr toward these mutants. While this was not unexpected for the conservative replacement Lys205 → Arg, it was rather surprising for the Thr178 → Ser mutant. The corresponding Giα1 Thr182 residue interacts with seven invariant or highly conserved residues of RGS4 and, thus, even homologous substitution by Ser could have had a major impact on the Gα/RGS interaction (12Tesmer J.J.G. Berman D.M. Gilman A.G. Sprang S.R. Cell. 1997; 89: 251-261Abstract Full Text Full Text PDF PubMed Scopus (687) Google Scholar). It appears that Ser may substitute Thr178 suitably in most of the RGS contacts. Another substitution that did not interfere with the affinity of Gtα binding to hRGSr is Lys176 → Leu. This is consistent with the lack of conservation at this position between Gtα, Gqα, and Gzα. Interestingly, however, this mutation led to a substantial reduction in the GTPase Vmax value elicited by hRGSr. Perhaps the lower stimulated GTPase activity of the Lys176 → Leu mutant reflects an intrinsic partial impairment of the catalytic site not evident from the basal GTPase activity. The adjacent Gtα Thr177 residue is intimately involved in the GTP hydrolysis (26Sondek J. Lambright D.G. Noel J.P. Hamm H.E. Sigler P.B. Nature. 1994; 372: 276-279Crossref PubMed Scopus (534) Google Scholar) and may not be fully stabilized in the RGS/Gtα Lys176 → Leu complex. The Lys176 → Leu mutation highlights the possibility that Gsα may have a limited ability for stimulation by RGS proteins assuming there is one that binds Gsα. A modest decrease in the affinity for hRGSr without significantly affecting the maximal degree of the GTPase rate acceleration was observed for Gtα His209 → Gln. The most severe outcome for the Gtα/hRGSr interaction was caused by the Ser202 → Asp mutation. This mutation resulted in the loss of hRGSr binding. The crystal structure of Giα1 with RGS4 provides a rationale for such an outcome (12Tesmer J.J.G. Berman D.M. Gilman A.G. Sprang S.R. Cell. 1997; 89: 251-261Abstract Full Text Full Text PDF PubMed Scopus (687) Google Scholar). A negative charge introduced by the Asp residue might be repelled by the negative charge of the counteracting Glu129 residue of hRGSr, which corresponds to the Glu126 residue of RGS4. However, the Glu residue is not absolutely conserved in RGS proteins. A number of RGS proteins, RGS1, RGS6, and RGS7, have residues other than Glu at this position. Small uncharged residues such as the Ala residue in RGS7 might be the most accommodating residue for Asp. We found that the Glu129 → Ala substitution in hRGSr cannot rescue the ability of hRGSr to interact with Gtα Ser202 → Asp. Perhaps, additional residue(s) such as Asn131 of hRGSr (Asn128 of RGS4) also interferes with the Asp side chain. RGS4 Asn128 makes a contact with Giα1 Ser206 (Ser202of Gtα). The RGS Asn residue is critical for the RGS/Gα interaction (12Tesmer J.J.G. Berman D.M. Gilman A.G. Sprang S.R. Cell. 1997; 89: 251-261Abstract Full Text Full Text PDF PubMed Scopus (687) Google Scholar), and may only be substituted by Ser, though with a notable loss of the RGS affinity for Gtα (20Natochin M. McEntaffer R.L. Artemyev N.O. J. Biol. Chem. 1998; 273 (in press)Google Scholar). Quite possibly, an interference of the Gα Asp residue with the network of interactions involving the hRGSr Asn131 residue is also responsible for the lack of interaction between hRGSr and Gtα Ser202 → Asp. The degree of impairment of the RGS/Gα interaction in the Ser202 → Asp mutant allows us to speculate that the corresponding Asp229 of Gsα is mainly responsible for the inability of Gsα to interact with characterized RGS proteins. Other differences in RGS contact residues between Gsα and the Gi-like α-subunits could be more easily accommodated by limited variability of different RGS domains. Our results do not support a likelihood that one of the currently identified RGS proteins may serve as a GAP for Gsα. Nevertheless, they provide a direction toward identification of potential candidates for interaction with Gsα among yet undiscovered RGS proteins. We thank R. McEntaffer for technical assistance and Drs. H. Hamm and N. Skiba for providing us with the Gtα/Giα expression vector." @default.
• W2023525078 created "2016-06-24" @default.
• W2023525078 creator A5007719364 @default.
• W2023525078 creator A5066682124 @default.
• W2023525078 date "1998-02-01" @default.
• W2023525078 modified "2023-09-27" @default.
• W2023525078 title "Substitution of Transducin Ser202 by Asp Abolishes G-protein/RGS Interaction" @default.
• W2023525078 cites W1589816259 @default.
• W2023525078 cites W1628126976 @default.
• W2023525078 cites W1989817592 @default.
• W2023525078 cites W1993466966 @default.
• W2023525078 cites W1993485378 @default.
• W2023525078 cites W2010358621 @default.
• W2023525078 cites W2025130024 @default.
• W2023525078 cites W2027587334 @default.
• W2023525078 cites W2029445497 @default.
• W2023525078 cites W2034762105 @default.
• W2023525078 cites W2040217609 @default.
• W2023525078 cites W2058148583 @default.
• W2023525078 cites W2065002573 @default.
• W2023525078 cites W2071242185 @default.
• W2023525078 cites W2073223681 @default.
• W2023525078 cites W2079046307 @default.
• W2023525078 cites W2080875376 @default.
• W2023525078 cites W2090636422 @default.
• W2023525078 cites W2095013577 @default.
• W2023525078 cites W2100837269 @default.
• W2023525078 cites W2110458673 @default.
• W2023525078 cites W2140909611 @default.
• W2023525078 cites W2146386420 @default.
• W2023525078 cites W2150947139 @default.
• W2023525078 cites W4293247451 @default.
• W2023525078 doi "https://doi.org/10.1074/jbc.273.8.4300" @default.
• W2023525078 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9468476" @default.
• W2023525078 hasPublicationYear "1998" @default.
• W2023525078 type Work @default.
• W2023525078 sameAs 2023525078 @default.
• W2023525078 citedByCount "27" @default.
• W2023525078 countsByYear W20235250782016 @default.
• W2023525078 countsByYear W20235250782018 @default.
• W2023525078 countsByYear W20235250782021 @default.
• W2023525078 crossrefType "journal-article" @default.
• W2023525078 hasAuthorship W2023525078A5007719364 @default.
• W2023525078 hasAuthorship W2023525078A5066682124 @default.
• W2023525078 hasBestOaLocation W20235250781 @default.
• W2023525078 hasConcept C149574991 @default.
• W2023525078 hasConcept C170493617 @default.
• W2023525078 hasConcept C185592680 @default.
• W2023525078 hasConcept C55493867 @default.
• W2023525078 hasConcept C80631254 @default.
• W2023525078 hasConcept C86803240 @default.
• W2023525078 hasConceptScore W2023525078C149574991 @default.
• W2023525078 hasConceptScore W2023525078C170493617 @default.
• W2023525078 hasConceptScore W2023525078C185592680 @default.
• W2023525078 hasConceptScore W2023525078C55493867 @default.
• W2023525078 hasConceptScore W2023525078C80631254 @default.
• W2023525078 hasConceptScore W2023525078C86803240 @default.
• W2023525078 hasIssue "8" @default.
• W2023525078 hasLocation W20235250781 @default.
• W2023525078 hasOpenAccess W2023525078 @default.
• W2023525078 hasPrimaryLocation W20235250781 @default.
• W2023525078 hasRelatedWork W1600414952 @default.
• W2023525078 hasRelatedWork W1906994181 @default.
• W2023525078 hasRelatedWork W1965275686 @default.
• W2023525078 hasRelatedWork W2066231863 @default.
• W2023525078 hasRelatedWork W2097948220 @default.
• W2023525078 hasRelatedWork W2133652823 @default.
• W2023525078 hasRelatedWork W2146699663 @default.
• W2023525078 hasRelatedWork W2320278647 @default.
• W2023525078 hasRelatedWork W2958485150 @default.
• W2023525078 hasRelatedWork W4323874394 @default.
• W2023525078 hasVolume "273" @default.
• W2023525078 isParatext "false" @default.
• W2023525078 isRetracted "false" @default.
• W2023525078 magId "2023525078" @default.
• W2023525078 workType "article" @default.