FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023551301> ?p ?o ?g. }

• W2023551301 endingPage "18753" @default.
• W2023551301 startingPage "18744" @default.
• W2023551301 abstract "The phosphorylation of glucose by different sugar kinases plays an essential role in Archaea because of the absence of a phosphoenolpyruvate-dependent transferase system characteristic for Bacteria. In the genome of the hyperthermophilic Archaeon Thermoproteus tenax a gene was identified with sequence similarity to glucokinases of the so-called ROK family (repressor protein, open reading frame, sugar kinase). The T. tenax enzyme, like the recently described ATP-dependent “glucokinase” from Aeropyrum pernix, shows the typical broad substrate specificity of hexokinases catalyzing not only phosphorylation of glucose but also of other hexoses such as fructose, mannose, or 2-deoxyglucose, and thus both enzymes represent true hexokinases. The T. tenax hexokinase shows strikingly low if at all any regulatory properties and thus fulfills no important control function at the beginning of the variant of the Embden-Meyerhof-Parnas pathway in T. tenax. Transcript analyses reveal that the hxk gene of T. tenax is cotranscribed with an upstream located orfX, which codes for an 11-kDa protein of unknown function. Growth-dependent studies and promoter analyses suggest that post-transcriptional RNA processing might be involved in the generation of the monocistronic hxk message, which is observed only under heterotrophic growth conditions. Data base searches revealed T. tenax hexokinase homologs in some archaeal, few eukaryal, and many bacterial genomes. Phylogenetic analyses confirm that the archaeal hexokinase is a member of the so-called ROK family, which, however, should be referred to as ROK group because it represents a group within the bacterial glucokinase fructokinase subfamily II of the hexokinase family. Thus, archaeal hexokinases represent a second major group of glucose-phosphorylating enzymes in Archaea beside the recently described archaeal ADP-dependent glucokinases, which were recognized as members of the ribokinase family. The distribution of the two types of sugar kinases, differing in their cosubstrate as well as substrate specificity, within Archaea is discussed on the basis of physiological constraints of the respective organisms. The phosphorylation of glucose by different sugar kinases plays an essential role in Archaea because of the absence of a phosphoenolpyruvate-dependent transferase system characteristic for Bacteria. In the genome of the hyperthermophilic Archaeon Thermoproteus tenax a gene was identified with sequence similarity to glucokinases of the so-called ROK family (repressor protein, open reading frame, sugar kinase). The T. tenax enzyme, like the recently described ATP-dependent “glucokinase” from Aeropyrum pernix, shows the typical broad substrate specificity of hexokinases catalyzing not only phosphorylation of glucose but also of other hexoses such as fructose, mannose, or 2-deoxyglucose, and thus both enzymes represent true hexokinases. The T. tenax hexokinase shows strikingly low if at all any regulatory properties and thus fulfills no important control function at the beginning of the variant of the Embden-Meyerhof-Parnas pathway in T. tenax. Transcript analyses reveal that the hxk gene of T. tenax is cotranscribed with an upstream located orfX, which codes for an 11-kDa protein of unknown function. Growth-dependent studies and promoter analyses suggest that post-transcriptional RNA processing might be involved in the generation of the monocistronic hxk message, which is observed only under heterotrophic growth conditions. Data base searches revealed T. tenax hexokinase homologs in some archaeal, few eukaryal, and many bacterial genomes. Phylogenetic analyses confirm that the archaeal hexokinase is a member of the so-called ROK family, which, however, should be referred to as ROK group because it represents a group within the bacterial glucokinase fructokinase subfamily II of the hexokinase family. Thus, archaeal hexokinases represent a second major group of glucose-phosphorylating enzymes in Archaea beside the recently described archaeal ADP-dependent glucokinases, which were recognized as members of the ribokinase family. The distribution of the two types of sugar kinases, differing in their cosubstrate as well as substrate specificity, within Archaea is discussed on the basis of physiological constraints of the respective organisms. Phosphorylation of sugars is of high significance for the carbohydrate metabolism of the cell, particularly for preparing carbohydrates for degradation and transfer reactions but also, as known for several bacteria, as a means of uptake. Among various enzymes engaged in these reactions, especially nucleotide-dependent sugar kinases with various specificities, are important for sugar phosphorylation. In the domain of Archaea, these enzymes play even a more central role for the carbohydrate metabolism than in Bacteria because Archaea in general do not seem to possess a phosphoenolpyruvate-dependent transferase system, which delivers the cell with sugar phosphates. To the best of our knowledge the only characterized nucleotide-dependent sugar kinases in Archaea described so far are enzymes that phosphorylate glucose (1Kengen S.W. Tuininga J.E. de Bok F.A.M. Stams A.J.M. de Vos W.M. J. Biol. Chem. 1995; 270: 30453-30457Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 2Koga S. Yoshioka I. Sakuraba H. Takahashi M. Sakasegawa S. Sakayu S. Ohshima T. J. Biochem. 2000; 128: 1079-1085Crossref PubMed Scopus (74) Google Scholar, 3Sakuraba H. Yoshioka I. Koga S. Takahashi M. Kitahama M. Satomura T. Kawakami R. Ohshima T. J. Biol. Chem. 2002; 277: 12495-12498Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 4Hansen T. Reichstein B. Schmid R. Schönheit P. J. Bacteriol. 2002; 184: 5955-5965Crossref PubMed Scopus (74) Google Scholar), fructose 6-phosphate (3Sakuraba H. Yoshioka I. Koga S. Takahashi M. Kitahama M. Satomura T. Kawakami R. Ohshima T. J. Biol. Chem. 2002; 277: 12495-12498Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 5Siebers B. Klenk H.P. Hensel R. J. Bacteriol. 1998; 180: 2137-2143Crossref PubMed Google Scholar, 6Tuininga J.E. Verhees C.H. van der Oost J. Kengen S.W.M. Stams A.J.M. De Vos W.M. J. Biol. Chem. 1999; 274: 21023-21028Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, 7Ronimus R.S. Koning J. Morgan H.W. Extremophiles. 1999; 3: 121-129Crossref PubMed Scopus (32) Google Scholar, 8Hansen T. Schönheit P. Arch. Microbiol. 2000; 173: 103-109Crossref PubMed Scopus (49) Google Scholar, 9Ronimus R.S. De Heus E. Morgan H.W. Biochim. Biophys. Acta. 2001; 1527: 384-391Crossref Scopus (20) Google Scholar, 10Ronimus R.S. Kawarabayasi Y. Kikuchi H. Morgan H.W. FEMS Microbiol. Lett. 2001; 202: 85-90Crossref PubMed Google Scholar, 11Verhees C.H. Tuininga J.E. Kengen S.W. Stams A.J.M. van der Oost J. De Vos W. J. Bacteriol. 2001; 183: 7145-7153Crossref PubMed Scopus (44) Google Scholar), fructose 1-phosphate (12Rangaswamy V. Altekar W. Biochim. Biophys. Acta. 1994; 28: 106-112Crossref Scopus (9) Google Scholar), fructose (13Rangaswamy V. Altekar W. J. Bacteriol. 1994; 176: 5505-5512Crossref PubMed Google Scholar), and galactose (14Verhees C.H. Koot D.G.M. Ettema T.J.G. Kijkema C. De Vos W.M. van der Oost J. Biochem. J. 2002; 366: 121-127Crossref PubMed Google Scholar). Surprisingly, a striking variety of glucose-phosphorylating enzymes occurs in Archaea: (i) the ADP-dependent glucokinases of Pyrococcus furiosus (1Kengen S.W. Tuininga J.E. de Bok F.A.M. Stams A.J.M. de Vos W.M. J. Biol. Chem. 1995; 270: 30453-30457Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 2Koga S. Yoshioka I. Sakuraba H. Takahashi M. Sakasegawa S. Sakayu S. Ohshima T. J. Biochem. 2000; 128: 1079-1085Crossref PubMed Scopus (74) Google Scholar, 15Kengen S.W. de Bok F.A.M. van Loo N.-D. Dijkema C. Stams A.J.M. de Vos W.M. J. Biol. Chem. 1994; 269: 17537-17541Abstract Full Text PDF PubMed Google Scholar) and Thermococcus litoralis (2Koga S. Yoshioka I. Sakuraba H. Takahashi M. Sakasegawa S. Sakayu S. Ohshima T. J. Biochem. 2000; 128: 1079-1085Crossref PubMed Scopus (74) Google Scholar); (ii) the bifunctional ADP-dependent glucokinase/phosphofructokinase of Methanococcus jannaschii (3Sakuraba H. Yoshioka I. Koga S. Takahashi M. Kitahama M. Satomura T. Kawakami R. Ohshima T. J. Biol. Chem. 2002; 277: 12495-12498Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 11Verhees C.H. Tuininga J.E. Kengen S.W. Stams A.J.M. van der Oost J. De Vos W. J. Bacteriol. 2001; 183: 7145-7153Crossref PubMed Scopus (44) Google Scholar); and (iii) the ATP-dependent “glucokinase” of Aeropyrum pernix (4Hansen T. Reichstein B. Schmid R. Schönheit P. J. Bacteriol. 2002; 184: 5955-5965Crossref PubMed Scopus (74) Google Scholar), which is, however, because of its rather broad substrate specificity, in reality a hexokinase (ATP:d-hexose-6-phosphotransferase, EC 2.7.1.1). True ATP-dependent glucokinases (ATP:d-glucose 6-phosphotransferase, EC 2.7.1.2), which differ from hexokinases by their high substrate specificity for glucose (as shown for several members of Bacteria and Eukarya) have not been found yet in Archaea. The distribution of glucokinases and hexokinases during evolution is complex and still puzzling. ADP-dependent sugar kinases (glucokinases and phosphofructokinases) are specific for a few Euryarchaea (11Verhees C.H. Tuininga J.E. Kengen S.W. Stams A.J.M. van der Oost J. De Vos W. J. Bacteriol. 2001; 183: 7145-7153Crossref PubMed Scopus (44) Google Scholar, 16Labes A. Schönheit P. Arch. Microbiol. 2001; 176: 329-338Crossref PubMed Scopus (45) Google Scholar), and gene homologs encoding proteins of unknown function were identified in some Eukarya (11Verhees C.H. Tuininga J.E. Kengen S.W. Stams A.J.M. van der Oost J. De Vos W. J. Bacteriol. 2001; 183: 7145-7153Crossref PubMed Scopus (44) Google Scholar). Whereas highly specific ATP-dependent glucokinases, often together with other specific sugar kinases (e.g. fructokinases, mannokinases), are found in Bacteria and unicellular Eukarya, the nonspecific hexokinases seem to be characteristic of higher Eukarya, which, however, possess several hexokinase isoenzymes (for review, see Ref. 17Cárdenas M.L. Cornish-Bowden A. Ureta T. Biochim. Biophys. Acta. 1998; 1401: 242-264Crossref PubMed Scopus (229) Google Scholar). Most eukaryal ATP-dependent hexokinases represent monomers with subunit molecular masses of 50 (fungi) or 100 kDa (vertebrates, plants). The major allosteric regulator of mammalian hexokinase isoenzymes I, II, and III is glucose 6-phosphate, which inhibits the enzyme. In addition, hexokinase I is activated by citrate and phosphate. Mammalian hexokinase isoenzyme IV is controlled mainly by a regulatory protein. Yeast hexokinases (PI, PII) are active as either monomer or dimer. In the presence of ATP and glucose the formation of the more active dimer is favored, and activation is observed by various metabolites (17Cárdenas M.L. Cornish-Bowden A. Ureta T. Biochim. Biophys. Acta. 1998; 1401: 242-264Crossref PubMed Scopus (229) Google Scholar, 18Fothergill-Gilmore L.A. Michels P.A.M. Biophys. Mol. Biol. 1993; 59: 105-235Crossref PubMed Scopus (390) Google Scholar). The bacterial ATP-dependent glucokinases are generally homodimers composed of 24–34-kDa subunits, and for Zymomonas mobilis glucokinase an inhibition by glucose 6-phosphate and ADP is described (17Cárdenas M.L. Cornish-Bowden A. Ureta T. Biochim. Biophys. Acta. 1998; 1401: 242-264Crossref PubMed Scopus (229) Google Scholar, 18Fothergill-Gilmore L.A. Michels P.A.M. Biophys. Mol. Biol. 1993; 59: 105-235Crossref PubMed Scopus (390) Google Scholar). The characterized archaeal ADP-dependent glucokinases represent homodimeric (P. furiosus, 47-kDa subunit (1Kengen S.W. Tuininga J.E. de Bok F.A.M. Stams A.J.M. de Vos W.M. J. Biol. Chem. 1995; 270: 30453-30457Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 2Koga S. Yoshioka I. Sakuraba H. Takahashi M. Sakasegawa S. Sakayu S. Ohshima T. J. Biochem. 2000; 128: 1079-1085Crossref PubMed Scopus (74) Google Scholar)) or monomeric (T. litoralis, 52 kDa (2Koga S. Yoshioka I. Sakuraba H. Takahashi M. Sakasegawa S. Sakayu S. Ohshima T. J. Biochem. 2000; 128: 1079-1085Crossref PubMed Scopus (74) Google Scholar); M. jannaschii, 53 kDa (3Sakuraba H. Yoshioka I. Koga S. Takahashi M. Kitahama M. Satomura T. Kawakami R. Ohshima T. J. Biol. Chem. 2002; 277: 12495-12498Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar)) proteins and seem to exhibit no obvious regulatory potential, although inhibition by the reaction product AMP (Ki = 0.06 mm (14Verhees C.H. Koot D.G.M. Ettema T.J.G. Kijkema C. De Vos W.M. van der Oost J. Biochem. J. 2002; 366: 121-127Crossref PubMed Google Scholar)) is described for the P. furiosus enzyme. Analyses combining sequence, structure, and functional information of 60 different sugar kinases (20 different sugar binding activities) indicate the presence of three distinct sugar kinase families (the hexokinase, ribokinase, and galactokinase families) which exhibit different three-dimensional structures and show no significant similarity (19Bork P. Sander C. Valencia A. Protein Sci. 1993; 2: 31-40Crossref PubMed Scopus (348) Google Scholar). In addition, the authors provide evidence of convergent evolution of similar specificity in different structural families as well as in different branches of the same structural family. Recently, the crystal structure of the ADP-dependent glucokinase from T. litoralis was solved characterizing the enzyme as a member of the ATP-dependent ribokinase family (19Bork P. Sander C. Valencia A. Protein Sci. 1993; 2: 31-40Crossref PubMed Scopus (348) Google Scholar, 20Ito S. Fushinobu S. Yoshioka I. Koga S. Matsuzawa H. Wakagi T. Structure. 2001; 9: 205-214Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar). Despite the striking differences observed between ATP-dependent hexokinases and glucokinases regarding their enzymatic properties and oligomeric state, structural comparisons reveal that they share a common three-dimensional fold and conserved sequence signatures characterizing them as members of the hexokinase family (19Bork P. Sander C. Valencia A. Protein Sci. 1993; 2: 31-40Crossref PubMed Scopus (348) Google Scholar). The hexokinase family is subdivided into three subfamilies: (i) sub-family I, eukaryal hexokinases and glucokinases (yeast); (ii) subfamily II, bacterial glucokinases and fructokinases; and (iii) subfamily III, bacterial sugar kinases with diverse specificities (e.g. fucokinase, ribulokinase, gluconokinase). More recent phylogenetic studies of the two glucokinases from the eukaryal parabasalid Trichomonas vaginalis indicate that they, as well as the enzyme of the diplomonad Giardia intestinalis, are members of the bacterial glucokinase, fructokinase subfamily (subfamily II) and only distantly related to eukaryal hexokinases (21Wu G. Henze K. Müller M. Gene (Amst.). 2001; 264: 265-271Crossref PubMed Scopus (22) Google Scholar). Thus, this former exclusively bacterial subfamily was shown to comprise a mixture of eukaryal as well as bacterial glucokinases (group A), bacterial glucokinases (group B), and fructokinases (group C) (21Wu G. Henze K. Müller M. Gene (Amst.). 2001; 264: 265-271Crossref PubMed Scopus (22) Google Scholar). A close phylogenetic relationship of sugar kinases to proteins with different function was shown by Titgemeyer and co-workers (22Titgemeyer F. Reizer J. Reizer A. Saier Jr., M.H. Microbiology. 1994; 140: 2349-2354Crossref PubMed Scopus (151) Google Scholar). Based on sequence similarity they proposed a novel family of proteins, the “ROK family” (bacterial repressor protein, open reading frames of unknown function, and sugar kinases). So far, several glucokinases of the so-called ROK family have been characterized, and surprisingly the bacterial homologs seem to be involved in carbon catabolite (glucose) repression in addition to their metabolic activity as reported for the enzymes of Streptomyces coelicolor (23Kwakman J.H. Postma P.W. J. Bacteriol. 1997; 176: 2694-2698Crossref Google Scholar), Bacillus megaterium (24Späth C. Kraus A. Hillen W. J. Bacteriol. 1997; 179: 7603-7605Crossref PubMed Google Scholar), Bacillus subtilis (25Rosana-Ani I. Skarlatos P. Dahl M.K. FEMS Microbiol. Lett. 1999; 171: 89-96Crossref Google Scholar), Staphylococcus xylosus (26Wagner E. Marcandier S. Egeter O. Deutscher J. Götz F. Brückner R. J. Bacteriol. 1995; 177: 6144-6152Crossref PubMed Google Scholar) and Corynebacterium glutamicum (27Park S.-Y. Kim H.-K. Yoo S.-K. Oh T.-K. Lee J.-K. FEMS Microbiol. Lett. 2000; 188: 209-215Crossref PubMed Google Scholar). Phylogenetic analyses identified also the recently described archaeal hexokinase of A. pernix, which was, however, designated by the authors as glucokinase, and other archaeal homologs as members of the ROK family (4Hansen T. Reichstein B. Schmid R. Schönheit P. J. Bacteriol. 2002; 184: 5955-5965Crossref PubMed Scopus (74) Google Scholar). Unfortunately, available phylogenetic studies do not address the relationship between the so-called ROK family and the hexokinase family, thus leaving some confusion about the evolutionary relationship between these phylogenetic entities. In Archaea ATP-dependent hexokinase activity has been reported recently for the A. pernix enzyme (glucokinase according to Ref. 4Hansen T. Reichstein B. Schmid R. Schönheit P. J. Bacteriol. 2002; 184: 5955-5965Crossref PubMed Scopus (74) Google Scholar), and respective activities have been proposed for gene homologs identified in the genomes of Halobacterium sp. strain NRC-1, Thermoplasma acidophilum, T. volcanium, and Pyrobaculum aerophilum (4Hansen T. Reichstein B. Schmid R. Schönheit P. J. Bacteriol. 2002; 184: 5955-5965Crossref PubMed Scopus (74) Google Scholar, 11Verhees C.H. Tuininga J.E. Kengen S.W. Stams A.J.M. van der Oost J. De Vos W. J. Bacteriol. 2001; 183: 7145-7153Crossref PubMed Scopus (44) Google Scholar). In addition the ATP-dependent phosphorylation of glucose has been shown in crude extracts of Thermoproteus tenax (28Siebers B. Hensel R. FEMS Microbiol. Lett. 1993; 111: 1-8Crossref Scopus (65) Google Scholar) and Desulfurococcus amylolyticus (29Selig M. Xavier K.B. Santos H. Schönheit P. Arch. Microbiol. 1997; 167: 217-232Crossref PubMed Scopus (174) Google Scholar). Thus the scarce knowledge about archaeal sugar kinases, especially hexokinases and glucokinases, motivates intense studies to get more insight into the evolution of these enzymes, their diversification with respect to substrate specificity, the physiological background of cosubstrate specificity (ATP versus ADP), and their regulatory potential for directing the carbon flux through the various pathways. To address the questions about the dominant phenotype(s) of nucleotide-dependent glucose-phosphorylating enzymes and their metabolic function in Archaea we focused on the ATP-dependent hexokinase of the hyperthermophilic Archaeon T. tenax. T. tenax is a facultative chemoorganotroph (30Zillig W. Stetter K.O. Schäfer W. Janekovic D. Wunderl S. Holz I. Palm P. Zentralbl. Bakteriol. Abt 1 Orig. Hyg. C. 1981; 2: 205-227Google Scholar, 31Fischer F. Zillig W. Stetter K.O. Schreiber G. Nature. 1983; 301: 511-513Crossref PubMed Scopus (164) Google Scholar) that uses a modified nonphosphorylative Entner-Doudoroff (ED) 1The abbreviations used are: ED, Entner-Doudoroff; EMP, Embden-Meyerhof-Parnas. pathway and a variant of the Embden-Meyerhof-Parnas (EMP) pathway for carbohydrate catabolism (28Siebers B. Hensel R. FEMS Microbiol. Lett. 1993; 111: 1-8Crossref Scopus (65) Google Scholar, 32Siebers B. Wendisch V.F. Hensel R. Arch. Microbiol. 1997; 168: 120-127Crossref PubMed Scopus (49) Google Scholar). The EMP pathway is characterized by several unique features: (i) a reversible, nonallosteric PPi-dependent phosphofructokinase (5Siebers B. Klenk H.P. Hensel R. J. Bacteriol. 1998; 180: 2137-2143Crossref PubMed Google Scholar); (ii) two different glyceraldehyde-3-phosphate dehydrogenases (33Brunner N.A. Brinkmann H. Siebers B. Hensel R. Biochemistry. 1998; 273: 6149-6156Google Scholar, 34Brunner N.A. Siebers B. Hensel R. Extremophiles. 2001; 5: 101-109Crossref PubMed Scopus (40) Google Scholar, 35Pohl E. Brunner N. Wilmanns M. Hensel R. J. Biol. Chem. 2002; 277: 19938-19945Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar); and (iii) a pyruvate kinase with reduced allosteric potential (36Schramm A. Siebers B. Tjaden B. Brinkmann H. Hensel R. J. Bacteriol. 2000; 182: 2001-2009Crossref PubMed Scopus (60) Google Scholar). Thus, deviating from the classical version of the pathway with control points at the beginning (ATP-dependent hexokinase and phosphofructokinase) and at the end of the pathway (pyruvate kinase) regulation was shown to take place at the level of glyceraldehyde 3-phosphate (33Brunner N.A. Brinkmann H. Siebers B. Hensel R. Biochemistry. 1998; 273: 6149-6156Google Scholar, 34Brunner N.A. Siebers B. Hensel R. Extremophiles. 2001; 5: 101-109Crossref PubMed Scopus (40) Google Scholar). Although ATP-dependent phosphorylation of glucose was demonstrated in T. tenax (28Siebers B. Hensel R. FEMS Microbiol. Lett. 1993; 111: 1-8Crossref Scopus (65) Google Scholar), so far no information was available about the enzyme, which catalyzes the first committed step of the pathway and represents an important control point in many organisms. Chemicals and Plasmids—All chemicals and enzymes were purchased from Sigma, Merck, or Roche Diagnostics in analytical grade. For heterologous expression of hexokinase the vector pET-11c (Novagen) and for generating antisense mRNA the vector pSPT 19 (Roche Diagnostics) were used. Strains and Growth Conditions—Mass cultures of T. tenax Kra1 (DSM 2078 (30Zillig W. Stetter K.O. Schäfer W. Janekovic D. Wunderl S. Holz I. Palm P. Zentralbl. Bakteriol. Abt 1 Orig. Hyg. C. 1981; 2: 205-227Google Scholar, 31Fischer F. Zillig W. Stetter K.O. Schreiber G. Nature. 1983; 301: 511-513Crossref PubMed Scopus (164) Google Scholar)) were grown under autotrophic and heterotrophic conditions as described previously (34Brunner N.A. Siebers B. Hensel R. Extremophiles. 2001; 5: 101-109Crossref PubMed Scopus (40) Google Scholar). Escherichia coli strains DH5α (Invitrogen), BL21(DE3), and BL21-CodonPlus(DE3)-RIL (Stratagene) for cloning and expression studies were cultured under standard conditions (37Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) following the instructions of the manufacturer. Enzyme Assay—The hexokinase activity was determined at 50 °C using two different coupled assays. The phosphorylation of glucose was measured by coupling the reaction to the reduction of NADP+ using glucose-6-phosphate dehydrogenase (bakers' yeast, EC 1.1.1.49) as auxiliary enzyme. The standard assay (1 ml total volume) was performed in 100 mm Tris/HCl (pH 7.5, 50 °C) in the presence of hexokinase (10–20 μg of protein), 4 mm ATP, 4 mm MgCl2, 1 mm NADP+, and 3 units of glucose-6-phosphate dehydrogenase. The reaction was started by the addition of 10 mm glucose. The phosphorylation of different substrates was followed by coupling the formation of ADP to the oxidation of NADH via pyruvate kinase (rabbit muscle (EC 2.7.1.40) and l-lactate dehydrogenase (rabbit muscle, EC 1.1.1.27). The assay (1 ml total volume) was performed in 100 mm Tris/HCl (pH 7.5, 50 °C), 2 mm ATP, 2 mm MgCl2, 5 mm phosphoenolpyruvate, 20 mm of the tested sugar, 0.5 mm NADH, 25 units of pyruvate kinase, and 90 units of l-lactate dehydrogenase. The reaction was started by the addition of hexokinase (10–20 μg of protein). Enzymatic activities were measured by monitoring the increase in absorption at 366 nm (ϵnadph 50 °C = 3.36 mm–1 cm–1, ϵnadph 50 °C = 3.43 mm–1 cm–1). The substrate specificity for different sugars was examined following the formation of ADP and replacing glucose by other substrates such as fructose or mannose. The nucleotide and cation specificity, as well as effector studies, were determined via the standard enzyme assay with glucose as substrate. Effector studies were performed in the presence of 1 mm MgCl2 and half-saturating concentrations of glucose (60 μm) and ATP (300 μm). The different substances were added at a concentration of 0.1, 1, 5, or 10 mm. To test the metal ion requirement, 2.5 mm EDTA or metal ions (Mg2+ and Mn2+) were added to the mixture. The protein concentration was determined according to the method of Bradford (38Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (217544) Google Scholar) using the Bio-Rad protein assay with bovine standard albumin as standard. Cloning of the hxk Gene and Expression in E. coli—In the course of the ongoing T. tenax genome sequencing project an open reading frame with significant sequence similarity to glucokinases was identified (accession number AJ510140, EMBL nucleotide sequence data base). For expression the hxk gene was cloned into pET-11c using two new restriction sites (NdeI and BamHI) introduced by PCR mutagenesis with the following primer set: GK-2-NdeI-f (TCCAGAGTCAGCATATGATCTTGGCCATCG, sense) and GK-2-BamHI-rev (AGCGGTCTGTTGGCGGATCCAAACGCTCAG, antisense). The mutations are shown in boldface, and the resulting NdeI and BamHI restriction sites are underlined. PCR mutagenesis was performed using Pwo polymerase and genomic T. tenax DNA as template. The sequence of the expression clones was controlled by sequencing. Expression of the T. tenax enzyme in E. coli BL21(DE3) and BL21-CodonPlus(DE3)-RIL was performed following the instructions of the manufacturer (Stratagene). Purification of the Recombinant Hexokinase—Recombinant E. coli cells (5 g, wet weight) were suspended in 15 ml of 100 mm HEPES/KOH (pH 7.5) containing 7.5 mm dithiothreitol (buffer A) and passed three times through a French pressure cell at 150 MPa. Cell debris and unbroken cells were removed by centrifugation (85,000 × g for 30 min at 4 °C), and the resulting crude extract was diluted 1:1 with buffer A, heat-precipitated (90 °C, 30 min), centrifuged again (20,000 × g for 20 min at 4 °C), and dialyzed overnight against 50 mm HEPES/KOH (pH 7.5), 7.5 mm dithiothreitol (2-liter volume, 4 °C). The dialyzed fraction was applied to a Q-Sepharose fast flow (Amersham Biosciences) column (volume 30 ml, C16/20) equilibrated in the same buffer at a flow rate of 0.25 ml/min. Hexokinase activity was detected only in flow-through fractions, and those containing the homogeneous enzyme solution were pooled. Gel filtration experiments were performed as described previously (5Siebers B. Klenk H.P. Hensel R. J. Bacteriol. 1998; 180: 2137-2143Crossref PubMed Google Scholar). Northern Blot Analyses of the hxk Transcript—Digoxigenin-labeled antisense mRNA of hexokinase was obtained by cloning a part of the hxk gene (278 bp) into pSPT19 (Roche Diagnostics) by PCR mutagenesis using the primer set GK-pSPT19-EcoRI-f (TGGCCAACGAATTCGTTGCCGCCGC, sense) and GK-pSPT19-BamHI-rev (GGCGCCCTGGATCCCAACCTAGCGG, antisense). The introduced EcoRI and BamHI restriction sites are underlined and the mutations are shown in boldface. In vitro transcription from the T7 promoter of pSPT19 was performed according to the instructions of the manufacturer. Preparation of total RNA from auto- and heterotrophically grown T. tenax cells and Northern blot analyses were performed as described previously (36Schramm A. Siebers B. Tjaden B. Brinkmann H. Hensel R. J. Bacteriol. 2000; 182: 2001-2009Crossref PubMed Scopus (60) Google Scholar). Sequence Retrieval and Phylogenetic Analyses—Protein sequences were extracted from GenBank and the TIGR microbial data base using BLAST, first aligned with ClustalX (39Thompson J.D. Gibson T.J. Plewniak F. Jeanmougin F. Higgins D.G. Nucleic Acids Res. 1997; 25: 4876-4882Crossref PubMed Scopus (35620) Google Scholar), and then manually refined using the MUST program package (40Philippe H. Nucleic Acids Res. 1993; 21: 5264-5272Crossref PubMed Scopus (564) Google Scholar). Regions of uncertain alignment and partial sequences were omitted from the analyses leaving a total of 53 sequences and 212 amino acid positions. The phylogenetic tree shown in Fig. 4 corresponds to the consensus tree obtained by the MrBayes analysis, the option majority rule consensus tree was used (41Huelsenbeck J.P. Ronquist F. Bioinformatics. 2001; 17: 754-755Crossref PubMed Scopus (19396) Google Scholar). MrBayes version 2.01 was used for the Baysian inference with 100,000 generations using the JTT model and gamma distributed rates, the trees were sampled every 10 generations (41Huelsenbeck J.P. Ronquist F. Bioinformatics. 2001; 17: 754-755Crossref PubMed Scopus (19396) Google Scholar). The number of generations needed until convergence around a stable likelihood value was in the range of 5–10%. The posterior probabilities given in the MrBayes consensus tree are indicated as percent values in the phylogenetic tree. A maximum likelihood based estimate of the gamma parameter as well as of the statistical support for internal nodes (quartet puzzling support values) was performed using the program TREE-PUZZLE v.5 (42Strimmer K. van Haeseler A. Mol. Biol. Evol. 1996; 13: 964-969Crossref Scopus (2276) Google Scholar). Distance analyses including 1000 bootstrap replicates were performed with the MEGA2 package using gamma correction and the Minimal evolution approach (43Kumar S. Tamura K. Jakobsen I.B. Nei M. Bioinformatics. 2001; 17: 1244-1245Crossref PubMed Scopus (4557) Google Scholar). A Maximum parsimony bootstrap analysis was performed using PAUP* with 1000 bootstrap replicates and 10 times random addition (44Swofford D.L. PAUP*: Phylogenetic Analysis Using Parsimony (*and Other Methods). Sinauer Associates, Sunderland, MA" @default.
• W2023551301 created "2016-06-24" @default.
• W2023551301 creator A5002061336 @default.
• W2023551301 creator A5009768393 @default.
• W2023551301 creator A5018586983 @default.
• W2023551301 creator A5029633742 @default.
• W2023551301 creator A5090341703 @default.
• W2023551301 date "2003-05-01" @default.
• W2023551301 modified "2023-10-17" @default.
• W2023551301 title "The Hexokinase of the Hyperthermophile Thermoproteus tenax" @default.
• W2023551301 cites W1482287895 @default.
• W2023551301 cites W1511759035 @default.
• W2023551301 cites W1531341650 @default.
• W2023551301 cites W1563363363 @default.
• W2023551301 cites W1576429937 @default.
• W2023551301 cites W1615776902 @default.
• W2023551301 cites W1850524686 @default.
• W2023551301 cites W1890305607 @default.
• W2023551301 cites W1903153800 @default.
• W2023551301 cites W1936339737 @default.
• W2023551301 cites W1970163329 @default.
• W2023551301 cites W1970548423 @default.
• W2023551301 cites W1970970361 @default.
• W2023551301 cites W1979107288 @default.
• W2023551301 cites W1981781775 @default.
• W2023551301 cites W1988747760 @default.
• W2023551301 cites W1989761314 @default.
• W2023551301 cites W1990295300 @default.
• W2023551301 cites W1993978232 @default.
• W2023551301 cites W2002456691 @default.
• W2023551301 cites W2002477714 @default.
• W2023551301 cites W2003188984 @default.
• W2023551301 cites W2012940246 @default.
• W2023551301 cites W2014808835 @default.
• W2023551301 cites W2019774858 @default.
• W2023551301 cites W2021144678 @default.
• W2023551301 cites W2036049240 @default.
• W2023551301 cites W2041091404 @default.
• W2023551301 cites W2055503466 @default.
• W2023551301 cites W2055712387 @default.
• W2023551301 cites W2059984941 @default.
• W2023551301 cites W2060081863 @default.
• W2023551301 cites W2061711320 @default.
• W2023551301 cites W2062345761 @default.
• W2023551301 cites W2071955064 @default.
• W2023551301 cites W2077176943 @default.
• W2023551301 cites W2082525069 @default.
• W2023551301 cites W2084738041 @default.
• W2023551301 cites W2086425689 @default.
• W2023551301 cites W2086747333 @default.
• W2023551301 cites W2092875909 @default.
• W2023551301 cites W2094993739 @default.
• W2023551301 cites W2097382368 @default.
• W2023551301 cites W2100971512 @default.
• W2023551301 cites W2109919119 @default.
• W2023551301 cites W2113756362 @default.
• W2023551301 cites W2116014716 @default.
• W2023551301 cites W2124279235 @default.
• W2023551301 cites W2135566721 @default.
• W2023551301 cites W2137919029 @default.
• W2023551301 cites W2145206794 @default.
• W2023551301 cites W2147902635 @default.
• W2023551301 cites W2156434383 @default.
• W2023551301 cites W2157902039 @default.
• W2023551301 cites W2161444534 @default.
• W2023551301 cites W2163323866 @default.
• W2023551301 cites W2164997158 @default.
• W2023551301 cites W2169644178 @default.
• W2023551301 cites W34578014 @default.
• W2023551301 cites W4293247451 @default.
• W2023551301 cites W91890918 @default.
• W2023551301 cites W1984026325 @default.
• W2023551301 doi "https://doi.org/10.1074/jbc.m301914200" @default.
• W2023551301 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12626506" @default.
• W2023551301 hasPublicationYear "2003" @default.
• W2023551301 type Work @default.
• W2023551301 sameAs 2023551301 @default.
• W2023551301 citedByCount "54" @default.
• W2023551301 countsByYear W20235513012012 @default.
• W2023551301 countsByYear W20235513012013 @default.
• W2023551301 countsByYear W20235513012014 @default.
• W2023551301 countsByYear W20235513012015 @default.
• W2023551301 countsByYear W20235513012016 @default.
• W2023551301 countsByYear W20235513012017 @default.
• W2023551301 countsByYear W20235513012018 @default.
• W2023551301 countsByYear W20235513012019 @default.
• W2023551301 countsByYear W20235513012020 @default.
• W2023551301 countsByYear W20235513012021 @default.
• W2023551301 countsByYear W20235513012023 @default.
• W2023551301 crossrefType "journal-article" @default.
• W2023551301 hasAuthorship W2023551301A5002061336 @default.
• W2023551301 hasAuthorship W2023551301A5009768393 @default.
• W2023551301 hasAuthorship W2023551301A5018586983 @default.
• W2023551301 hasAuthorship W2023551301A5029633742 @default.
• W2023551301 hasAuthorship W2023551301A5090341703 @default.
• W2023551301 hasBestOaLocation W20235513011 @default.
• W2023551301 hasConcept C104317684 @default.
• W2023551301 hasConcept C181199279 @default.

• next