FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023557746> ?p ?o ?g. }

• W2023557746 endingPage "23315" @default.
• W2023557746 startingPage "23306" @default.
• W2023557746 abstract "The regulation of PTEN intrinsic biochemical properties has not been fully elucidated. In this report, we investigated the role of the PTEN carboxyl-terminal tail domain in regulating its membrane targeting and catalytic functions. Characterization of a panel of PTEN phosphorylation site mutants revealed that mutating Ser-385 to alanine (S385A) promoted membrane localization in vivo and phosphatase activity in vitro. Furthermore, S385A mutation was associated with a substantial reduction in the phosphorylation of the Ser-380/Thr-382/Thr-383 cluster. Therefore, Ser-385 could prime additional dephosphorylation events to regulate PTEN catalytic activity. Moreover, substituting Ser-380/Thr-382/Thr-383 to phosphomimic residues reversed the phosphatase activity of the S385A mutation. Next, we further defined the underlying mechanisms responsible for the COOH-terminal tail region in modulating PTEN biological activity. We have identified an interaction between the 71-amino acid carboxyl-terminal tail region and the CBRIII motif of the C2 domain, which has been implicated in membrane binding. In addition, a synthetic phosphomimic peptide encompassing the phosphorylation site cluster between amino acids 368 and 390 within the tail region mediated the suppression of PTEN catalytic activity in vitro. This same peptide when expressed in cultured cells also impeded PTEN membrane localization and enhanced phospho-Akt levels. Thus, our data suggest that the COOH-terminal tail can act as an autoinhibitory domain to control both PTEN membrane recruitment and phosphatase activity. The regulation of PTEN intrinsic biochemical properties has not been fully elucidated. In this report, we investigated the role of the PTEN carboxyl-terminal tail domain in regulating its membrane targeting and catalytic functions. Characterization of a panel of PTEN phosphorylation site mutants revealed that mutating Ser-385 to alanine (S385A) promoted membrane localization in vivo and phosphatase activity in vitro. Furthermore, S385A mutation was associated with a substantial reduction in the phosphorylation of the Ser-380/Thr-382/Thr-383 cluster. Therefore, Ser-385 could prime additional dephosphorylation events to regulate PTEN catalytic activity. Moreover, substituting Ser-380/Thr-382/Thr-383 to phosphomimic residues reversed the phosphatase activity of the S385A mutation. Next, we further defined the underlying mechanisms responsible for the COOH-terminal tail region in modulating PTEN biological activity. We have identified an interaction between the 71-amino acid carboxyl-terminal tail region and the CBRIII motif of the C2 domain, which has been implicated in membrane binding. In addition, a synthetic phosphomimic peptide encompassing the phosphorylation site cluster between amino acids 368 and 390 within the tail region mediated the suppression of PTEN catalytic activity in vitro. This same peptide when expressed in cultured cells also impeded PTEN membrane localization and enhanced phospho-Akt levels. Thus, our data suggest that the COOH-terminal tail can act as an autoinhibitory domain to control both PTEN membrane recruitment and phosphatase activity. PTEN is a bona fide tumor suppressor gene frequently inactivated in multiple human tumors (1Stiles B. Groszer M. Wang S. Jiao J. Wu H. Dev. Biol. 2004; 273: 175-184Crossref PubMed Scopus (206) Google Scholar, 2Parsons R. Semin. Cell Dev. Biol. 2004; 15: 171-176Crossref PubMed Scopus (201) Google Scholar, 3Maehama T. Dixon J.E. Trends Cell Biol. 1999; 9: 125-128Abstract Full Text Full Text PDF PubMed Scopus (506) Google Scholar, 4Eng C. Hum. Mutat. 2003; 22: 183-198Crossref PubMed Scopus (666) Google Scholar, 5Cantley L.C. Neel B.G. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 4240-4245Crossref PubMed Scopus (1754) Google Scholar, 6Myers M.P. Tonks N.K. Am. J. Hum. Genet. 1997; 61: 1234-1238Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, 7Backman S. Stambolic V. Mak T. Curr. Opin. Neurobiol. 2002; 12: 516-522Crossref PubMed Scopus (77) Google Scholar, 8Leslie N.R. Downes C.P. Biochem. J. 2004; 382: 1-11Crossref PubMed Scopus (349) Google Scholar). PTEN encodes a phosphatidylinositol (3Maehama T. Dixon J.E. Trends Cell Biol. 1999; 9: 125-128Abstract Full Text Full Text PDF PubMed Scopus (506) Google Scholar, 4Eng C. Hum. Mutat. 2003; 22: 183-198Crossref PubMed Scopus (666) Google Scholar, 5Cantley L.C. Neel B.G. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 4240-4245Crossref PubMed Scopus (1754) Google Scholar) triphosphate (PIP3) 4The abbreviations used are: PIP3, phosphatidylinositol 3,4,5-bisphosphate; aa, amino acid; CTD, COOH-terminal domain; DAPI, 4′,6-diamidino-2-phenylindole; PTPase, phosphatase; PIP2, phosphatidylinositol 4,5-bisphosphate; PMSF, phenylmethylsulfonyl fluoride; MES, 4-morpholineethanesulfonic acid; GFP, green fluorescent protein. phosphatase (PTPase) that plays a critical role in regulating the intracellular levels of PIP3 (9Maehama T. Dixon J.E. J. Biol. Chem. 1998; 273: 13375-13378Abstract Full Text Full Text PDF PubMed Scopus (2614) Google Scholar, 10Stambolic V. Suzuki A. de la Pompa J.L. Brothers G.M. Mirtsos C. Sasaki T. Ruland J. Penninger J.M. Siderovski D.P. Mak T.W. Cell. 1998; 95: 29-39Abstract Full Text Full Text PDF PubMed Scopus (2120) Google Scholar, 11Myers M.P. Pass I. Batty I.H. Van der Kaay J. Stolarov J.P. Hemmings B.A. Wigler M.H. Downes C.P. Tonks N.K. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13513-13518Crossref PubMed Scopus (1013) Google Scholar). The mechanism by which PTEN targets the plasma membrane is under intense investigation. In addition, how the intrinsic catalytic activity of PTEN is regulated has not been fully delineated. The resolution of the PTEN crystal structure has provided biophysical data in identifying functional motifs responsible for mediating PTEN membrane binding (12Lee J.O. Yang H. Georgescu M.M. Di Cristofano A. Maehama T. Shi Y. Dixon J.E. Pandolfi P. Pavletich N.P. Cell. 1999; 99: 323-334Abstract Full Text Full Text PDF PubMed Scopus (883) Google Scholar). PTEN possesses in its carboxyl terminus between amino acids (aa) 186 and 351 a C2 domain, which is similar to that found in phospholipase C81. In particular, the conserved CBRIII loop possesses five positively charged and two hydrophobic residues that are implicated in phospholipids binding (12Lee J.O. Yang H. Georgescu M.M. Di Cristofano A. Maehama T. Shi Y. Dixon J.E. Pandolfi P. Pavletich N.P. Cell. 1999; 99: 323-334Abstract Full Text Full Text PDF PubMed Scopus (883) Google Scholar, 13Georgescu M.M. Kirsch K.H. Kaloudis P. Yang H. Pavletich N.P. Hanafusa H. Cancer Res. 2000; 60: 7033-7038PubMed Google Scholar, 14Das S. Dixon J.E. Cho W. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 7491-7496Crossref PubMed Scopus (283) Google Scholar). Additional positively charged residues interfacing the lipid bilayer at Arg-161, Lys-163, and Lys-164 have been shown to contribute to membrane binding through electrostatic interactions (14Das S. Dixon J.E. Cho W. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 7491-7496Crossref PubMed Scopus (283) Google Scholar). Consequently, these interactions orient the catalytic pocket toward the lipid bilayer. Based on protease sensitivity assays, the 7-aa NH2-terminal and 49-aa COOH-terminal regions of PTEN are unstructured and therefore unable to be crystallized (12Lee J.O. Yang H. Georgescu M.M. Di Cristofano A. Maehama T. Shi Y. Dixon J.E. Pandolfi P. Pavletich N.P. Cell. 1999; 99: 323-334Abstract Full Text Full Text PDF PubMed Scopus (883) Google Scholar). Nevertheless, structure-functional analysis of these regions has implicated their involvement in membrane binding and PTEN biological activities. The NH2-terminal 16-aa polybasic region constitutes a PIP2-binding motif that is essential for PTEN tumor suppressor function. Deletion of this region or the acquisition of a tumor-associated Lys → Glu-13 mutation greatly reduces PTEN membrane binding and tumor suppressing activity (15Walker S.M. Leslie N.R. Perera N.M. Batty I.H. Downes C.P. Biochem. J. 2004; 379: 301-307Crossref PubMed Scopus (130) Google Scholar, 16Campbell R.B. Liu F. Ross A.H. J. Biol. Chem. 2003; 278: 33617-33620Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar, 17Vazquez F. Devreotes P. Cell Cycle. 2006; 5: 1523-1527Crossref PubMed Scopus (77) Google Scholar, 18Iijima M. Huang Y.E. Luo H.R. Vazquez F. Devreotes P.N. J. Biol. Chem. 2004; 279: 16606-16613Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar). PIP2 binding to this motif greatly stimulates the intrinsic catalytic activity of PTEN (16Campbell R.B. Liu F. Ross A.H. J. Biol. Chem. 2003; 278: 33617-33620Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar, 18Iijima M. Huang Y.E. Luo H.R. Vazquez F. Devreotes P.N. J. Biol. Chem. 2004; 279: 16606-16613Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar). The fact that PIP2 fails to stimulate PTEN when a soluble lipid substrate, inositol 1,3,4,5-trisphosphate, was used argues for a role of a PIP2-rich membrane in orientating the catalytic pocket of PTEN toward the lipid bilayer (18Iijima M. Huang Y.E. Luo H.R. Vazquez F. Devreotes P.N. J. Biol. Chem. 2004; 279: 16606-16613Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar). However, it has also been suggested that PIP2 may activate PTEN through an allosteric mechanism (16Campbell R.B. Liu F. Ross A.H. J. Biol. Chem. 2003; 278: 33617-33620Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar). All of these findings favor an interfacial activation mechanism of PTEN at the lipid bilayer involving interactions of multiple membrane binding moieties (19McConnachie G. Pass I. Walker S.M. Downes C.P. Biochem. J. 2003; 371: 947-955Crossref PubMed Scopus (98) Google Scholar). The COOH-terminal 63-aa region (aa 347-399) of PTEN was initially referred to as the PEST domain (20Vazquez F. Grossman S.R. Takahashi Y. Rokas M.V. Nakamura N. Sellers W.R. J. Biol. Chem. 2001; 276: 48627-48630Abstract Full Text Full Text PDF PubMed Scopus (361) Google Scholar, 21Vazquez F. Ramaswamy S. Nakamura N. Sellers W.R. Mol. Cell. Biol. 2000; 20: 5010-5018Crossref PubMed Scopus (656) Google Scholar, 22Tolkacheva T. Chan A.M. Oncogene. 2000; 19: 680-689Crossref PubMed Scopus (63) Google Scholar). There are six phosphorylation sites at Thr-366, Ser-370, Ser-380, Thr-382, Thr-383, and Ser-385 that are implicated in modulating PTEN tumor suppressor functions, subcellular distribution, and stability. In general, PTEN mutants with these sites substituted with nonphosphorylatable amino acids have greater tumor suppressor activity, enhanced membrane affinity, and reduced protein stability (14Das S. Dixon J.E. Cho W. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 7491-7496Crossref PubMed Scopus (283) Google Scholar, 20Vazquez F. Grossman S.R. Takahashi Y. Rokas M.V. Nakamura N. Sellers W.R. J. Biol. Chem. 2001; 276: 48627-48630Abstract Full Text Full Text PDF PubMed Scopus (361) Google Scholar, 21Vazquez F. Ramaswamy S. Nakamura N. Sellers W.R. Mol. Cell. Biol. 2000; 20: 5010-5018Crossref PubMed Scopus (656) Google Scholar, 23Tolkacheva T. Boddapati M. Sanfiz A. Tsuchida K. Kimmelman A.C. Chan A.M. Cancer Res. 2001; 61: 4985-4989PubMed Google Scholar, 24Torres J. Pulido R. J. Biol. Chem. 2001; 276: 993-998Abstract Full Text Full Text PDF PubMed Scopus (534) Google Scholar, 25Solari F. Bourbon-Piffaut A. Masse I. Payrastre B. Chan A.M. Billaud M. Oncogene. 2005; 24: 20-27Crossref PubMed Scopus (60) Google Scholar, 26Okahara F. Ikawa H. Kanaho Y. Maehama T. J. Biol. Chem. 2004; 279: 45300-45303Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar, 27Torres J. Rodriguez J. Myers M.P. Valiente M. Graves J.D. Tonks N.K. Pulido R. J. Biol. Chem. 2003; 278: 30652-30660Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar, 28Lu Y. Yu Q. Liu J.H. Zhang J. Wang H. Koul D. McMurray J.S. Fang X. Yung W.K. Siminovitch K.A. Mills G.B. J. Biol. Chem. 2003; 278: 40057-40066Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar, 29Al-Khouri A.M. Ma Y. Togo S.H. Williams S. Mustelin T. J. Biol. Chem. 2005; 280: 35195-35202Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar). The biochemical basis for these observations is believed to be the result of a more open conformation displayed by these mutants (17Vazquez F. Devreotes P. Cell Cycle. 2006; 5: 1523-1527Crossref PubMed Scopus (77) Google Scholar, 20Vazquez F. Grossman S.R. Takahashi Y. Rokas M.V. Nakamura N. Sellers W.R. J. Biol. Chem. 2001; 276: 48627-48630Abstract Full Text Full Text PDF PubMed Scopus (361) Google Scholar). However, whether these phosphorylation sites contribute to the intrinsic catalytic activity of PTEN remained to be determined. By mass spectroscopy, two casein kinase II sites at Ser-370 and Ser-385 have been shown to be preferentially phosphorylated in vivo (30Miller S.J. Lou D.Y. Seldin D.C. Lane W.S. Neel B.G. Fed. Eur. Biochem. Soc. 2002; 528: 145-153Crossref PubMed Scopus (174) Google Scholar). The biological relevance of phosphorylation at Ser-370 and Ser-385 is not well defined, although a double mutant of S370A/S385A has been shown to have shorter half-life than the wild-type protein (24Torres J. Pulido R. J. Biol. Chem. 2001; 276: 993-998Abstract Full Text Full Text PDF PubMed Scopus (534) Google Scholar). Additional phosphorylation sites at Ser-362 and Thr-366 have been reported to be the targets of glycogen synthase kinase-3. It is speculated that phosphorylation at these sites constitutes a negative feedback mechanism in attenuating signaling events initiated by insulin-like growth factor (29Al-Khouri A.M. Ma Y. Togo S.H. Williams S. Mustelin T. J. Biol. Chem. 2005; 280: 35195-35202Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar). Furthermore, ROCK has been shown to phosphorylate Ser-229, Thr-232, Thr-319, and Thr-321 within the C2 domain of PTEN in cells exposed to chemoattractants (31Li Z. Dong X. Wang Z. Liu W. Deng N. Ding Y. Tang L. Hla T. Zeng R. Li L. Wu D. Nat. Cell. Biol. 2005; 7: 399-404Crossref PubMed Scopus (399) Google Scholar). The cluster of Ser-380, Thr-382, and Thr-383 residues in the tail region are minor phosphorylation sites (29Al-Khouri A.M. Ma Y. Togo S.H. Williams S. Mustelin T. J. Biol. Chem. 2005; 280: 35195-35202Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar, 30Miller S.J. Lou D.Y. Seldin D.C. Lane W.S. Neel B.G. Fed. Eur. Biochem. Soc. 2002; 528: 145-153Crossref PubMed Scopus (174) Google Scholar). However, leptin has recently been reported to stimulate their phosphorylation, resulting in the inhibition of PTEN catalytic activity (32Ning K. Miller L.C. Laidlaw H.A. Burgess L.A. Perera N.M. Downes C.P. Leslie N.R. Ashford M.L. EMBO J. 2006; 25: 2377-2387Crossref PubMed Scopus (91) Google Scholar). Furthermore, Thr-383 has been identified as a putative autodephosphorylation site for PTEN, since its dephosphorylation greatly enhances the ability of PTEN to suppress cell migration in human glioblastoma cell lines (33Raftopoulou M. Etienne-Manneville S. Self A. Nicholls S. Hall A. Science. 2004; 303: 1179-1181Crossref PubMed Scopus (284) Google Scholar). There is still considerable uncertainty in how the COOH-terminal domain of PTEN regulates its biochemical function. In this report, we provide evidence that this tail region mediates intramolecular interactions with the C2 domain. In addition, the PEST domain rich in acidic residues can serve as an autoinhibitory motif in suppressing PTEN catalytic activity. Cell Cultures—The PTEN-null human prostate carcinoma cell line PC3 and human kidney epithelial cell line 293T were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum. For transfection of 293T cells, ∼106 cells were transfected in 100-mm plates with 10 μg of DNA using 12 μl of Lipofectamine2000 (Invitrogen) in 6 ml of serum- and antibiotic-free Dulbecco’s modified Eagle’s medium for 4 h. Cells were lysed after 48 h of incubation. For gene transfer in PC3 cells, ∼105 cells on a 6-well plate were transfected with 2-4 μg of DNA using 2 μl of Lipofectamine2000 (Invitrogen) in 1 ml of serum- and antibiotic-free Dulbecco’s modified Eagle’s medium for 4 h. Cells were analyzed after 48 h of incubation. Plasmids—The construction of the PTEN-WT cDNA has been described previously (22Tolkacheva T. Chan A.M. Oncogene. 2000; 19: 680-689Crossref PubMed Scopus (63) Google Scholar, 23Tolkacheva T. Boddapati M. Sanfiz A. Tsuchida K. Kimmelman A.C. Chan A.M. Cancer Res. 2001; 61: 4985-4989PubMed Google Scholar). For the generation of PTEN S370A, S380A, T382A, T383A, S385A, S370A/S385A, S380A/T382A/T383A, S380E, S385E, S380D/T382E/T383E, S385A, and CBR3 mutants, standard PCR-based site-directed mutagenesis was used. All PTEN mutant cDNAs were restriction-digested with BamHI and EcoRI enzymes and cloned into the BglII and EcoRI sites of the expression vector, pCEFL-KZ-AU5. The MYR-PTEN was constructed by fusing an adaptor, agcttctcgaggccgccaccatggggagtagcaagagcaagcctaaggaccccagccagcgcg, containing the myristoylation signal peptide (GSSKSKPKDPSQR) in the HindIII and BamHI sites of the pCEFL-KZ-AU5-PTEN expression plasmid. The ΔN16-PTEN mutant was generated by a tandem PCR-based strategy using two overlapping primers to delete the NH2-terminal 16 aa of PTEN: aaaagcttctcgaggccgccaccatgggatcc accgacttctacctaaagagatcc and ttctacctaaagagatccatgcaagaggatggattcgactta. The PCR fragment was cloned into the HindIII and BglII sites of pCEFL-KZ-AU5-PTEN. GFP-Cp23 and GFP-Cp23/385E expression plasmids were generated by subcloning cDNA fragments encompassing aa 368-390 of PTEN into the BglII-EcoRI sites of the pEGFP expression vector (Clontech). Antibodies—The anti-PTEN mouse monoclonal antibodies (Santa Cruz Biotechnology and Cascade Bioscience) the anti-Ser(P)-380/Thr(P)-382/Thr(P)-383-PTEN polyclonal antibody (Cell Signaling), the anti-Ser(P)-385-PTEN polyclonal antibody (AnaSpec), the anti-AU5 monoclonal antibody (Covance), the anti-FLAG monoclonal antibody (Sigma), the polyclonal α-AKT, the polyclonal α-Thr(P)-308-AKT (Cell Signaling), the anti-Sp1 (Santa Cruz Biotechnology), and the anti-lactate dehydrogenase (Sigma) antibodies were purchased from commercial sources. The anti-PTEN rabbit polyclonal antibody, GPC07, was raised against a fusion protein of GST and the COOH-terminal 216 aa of PTEN. The anti-Ser(P)-380-PTEN antibody was generated using the phosphopeptide EPDHYRYpSDTTDSD (where pS represents phosphoserine) as the immunogen (Research Genetics). Immunoprecipitation—Cells were solubilized in buffer A: 25 mm Tris-HCl, pH 8.0, 150 mm NaCl, 1% Nonidet P-40 (Nonidet P-40), 1 mm EDTA, 1 mm phenylmethylsulfonyl fluoride (PMSF), 10 μg/ml aprotinin, 10 μg/ml leupeptin, 1 mm sodium orthovanadate (Na3VO4), 1 mm sodium pyrophosphate (Na4P2O7), and 10 mm sodium fluoride (NaF). 1 mg of total protein was immunoprecipitated with 1 μg of α-FLAG monoclonal antibody (Sigma) or α-PTEN polyclonal antibody for 5 h at 4 °C. Immunocomplexes were absorbed onto 30 μl of GammaBind G-Sepharose beads (Amersham Biosciences) for 1 h at 4 °C. The immunoprecipitates were washed three times with 1 ml of lysis buffer, boiled in 30 μl of 2× Laemmli buffer, and subjected to Western blotting analysis. Hypotonic Subcellular Fractionation—Cells were scraped in a hypotonic buffer composed of 20 mm HEPES, pH 7.4, 5 mm Na4P2O7, 5 mm EGTA, 1 mm MgCl2, 1 mm Na3VO4, 1 mm PMSF, 10 μg/ml aprotinin, and 10 μg/ml leupeptin. Cell extracts were homogenized with 30 strokes in a glass Dounce homogenizer. Nuclei were pelleted at 500 × g for 5 min at 4 °C. The supernatant was centrifuged at 100,000 × g for 50 min at 4 °C. The supernatant was the cytosolic fraction. The pellet was resuspended in a Triton X-100 buffer (50 mm Tris-HCl, pH 7.5, 150 mm NaCl, 5 mm EDTA, 1% Triton X-100, 1 mm PMSF, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 1 mm Na3VO4, 1 mm Na4P2O7, and 10 mm NaF) and centrifuged at 18,000 × g for 10 min at 4 °C. The supernatant was the membrane fraction. Sucrose Gradient—Cells were scraped in an extraction buffer (25 mm MES, pH 6.5, 150 mm NaCl, 1% Triton X-100, 1 mm PMSF, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 1 mm Na3VO4, 1 mm Na4P2O7, and 10 mm NaF) for 20 min on ice. The extracts were homogenized by 30 strokes in a Dounce homogenizer, and sucrose was adjusted to 40%. The samples were placed on the bottom of an ultracentrifuge tube, and step sucrose gradient (5, 10, 15, 20, 25, and 30% in 25 mm MES, pH 6.5, 150 mm NaCl) was layered on top. The samples were centrifuged for 18 h at 34,000 × g at 4 °C. A 1-ml fraction was collected, diluted 1:1 with 25 mm MES, pH 6.5, 150 mm NaCl, and centrifuged again at 14,000 × g for 30 min. The pellets for each fraction were resuspended in 1× Laemmli buffer, boiled, and analyzed by Western blotting. Saponin Subcellular Fractionation—Cells were lysed in 10 mm Tris-HCl, pH 7.4, 150 mm NaCl, 0.01% saponin, 5 mm EDTA, 2 mm EGTA, 1 mm PMSF, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 1 mm Na3VO4, 1 mm Na4P2O7, and 10 mm NaF for 20 min on ice. The lysates were centrifuged for 30 min at 18,000 × g. The supernatant was collected as the cytosolic fraction. The pellet was resuspended in 50 mm HEPES, pH 7.4, 150 mm NaCl, 1% Triton X-100, 1.5 mm MgCl2, 1 mm EGTA, 10% glycerol, 1 mm PMSF, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 1 mm Na3VO4, 1 mm Na4P2O7, 10 mm NaF and centrifuged for 30 min at 18,000 × g. The supernatant was collected as the membrane fraction. Nuclear-Cytosolic Fractionation—Nuclear and cytoplasmic fractions were prepared using the NE-PER fractionation kit (Pierce) according to a modified manufacturer’s protocol. Immunofluorescence Analysis—Cells were plated on polylysine-coated glass coverslips. Following fixation with 3% paraformaldehyde, cells were permeabilized with 0.2% Triton X-100 in phosphate-buffered saline and blocked in 3% bovine serum albumin, phosphate-buffered saline. Samples were incubated overnight at 4 °C with anti-AU5 (1:500). Bound antibody was detected with an Alexa Fluor 488 anti-mouse secondary antibody (1:1000; Invitrogen). Nuclei were visualized with DAPI (1 μg/ml). Specimens were mounted onto glass slides and analyzed by confocal microscopy on a Leica TCS-SP inverted microscope with a ×63 objective. Purification of Recombinant PTEN and C-tail from Bacteria—BL21 bacteria harboring pET15B-His-PTEN or pET15B-His-C-tail were grown to A600 = 0.5-0.7 and induced with 0.3 mm isopropyl 1-thio-β-d-galactopyranoside overnight at 25 °C, pelleted, and resuspended in phosphate-buffered saline with 2 mm β-mercaptoethanol, 1 mm PMSF, 10 μg/ml aprotinin, and 10 μg/ml leupeptin. Cells were lysed by sonication, and Triton X-100 and NaCl were adjusted to 1% and 350 mm, respectively. Lysates were clarified by centrifugation at 18,000 × g, and supernatant was treated with 20 μg/μl DNase I for 1 h at 4 °C. PTEN was purified on a HisTrap HP column (Amersham Biosciences) using a 20-500 mm imidazole gradient. The monomeric protein was isolated through gel filtration on a Superdex 200 column (Amersham Biosciences). Purification of Recombinant PTEN from Insect Cells—Sf9 cells were infected with baculoviruses harboring His-tagged PTEN WT, S370A, T382A, T382A, T383A, S385A, S370A/S385A, and S380A/T382A/T383A expression plasmids for 5-7 days. Cells were lysed in buffer A, and monomeric PTEN was purified as described above. PTEN purified by this method has an average PIP3 phosphatase activity of ∼1.3 pmol/ng/min. Phosphatase Activity Assay—Recombinant PTEN was incubated with 50 μm synthetic diC8-PI(3,4,5)P3 (Echelon) with or without 50 μm synthetic diC8-PI(4,5)P2 (Echelon), both in soluble form for 10 min at 37 °C in a final volume of 25 μl. The reaction buffer was in 10 mm dithiothreitol and 25 mm Tris-HCl, pH 8.0. The reaction was stopped with 100 μl of malachite green reagent (Echelon). The amount of phosphate released was measured by reading the absorbance at 620 nm. The amount of protein used was predetermined and within the linear range of the reaction. The amount of phosphate released was normalized to the amount of protein used in the reaction. For measuring PTEN activity in vitro, 5 × 106 293T cells were transfected with 15 μg of expression plasmids using 9 μl of Lipofectamine 2000 (Invitrogen). After 48 h, cells were solubilized in 600 μl of a lysis buffer containing 25 mm Tris-HCl, pH 8.0, 150 mm NaCl, 1% Triton X-100, 2 mm dithiothreitol, 1 mm EDTA, 1 mm PMSF, 10 μg/ml aprotinin, and 10 μg/ml leupeptin. Approximately 3 mg of total cell extracts were immunoprecipitated with 5 μg of an anti-AU5 antibody for 4 h, and immunocomplexes were affinity-absorbed onto 30 μl of GammaBind G-Sepharose beads. PTEN phosphatase activity was then assayed as described above. Peptide Inhibition Assay—20 nm bacterial PTEN was incubated with 50 μm synthetic diC8-PI(3,4,5)P3 in soluble form, in the presence of increasing amounts of the Cp-23 (0.1, 0.4, 0.6, 0.8, 1, and 2 mm), Cp-23DE (0.1, 0.2, 0.3, 0.4, and 0.5 mm), and Cp-23DEr (0, 0.07, 0.2, 0.7, and 2 mm) peptides for 10 min at 37 °C in a final volume of 25 μl. The phosphatase reaction was carried out as described above. The peptide sequences were as follows: Cp-23, DVSDNEPDHYRYSDTTDSDPENE; Cp-23DE, DVDDNEPDHYRYDDEEDDDPENE; Cp-23DEr, EDHNDPDVDRDDYYDEENEDEPD. In Vitro Binding—The expression plasmids (2 μg) were in vitro translated with 2 μl of [35S]methionine/cysteine (10 mCi/ml) (Amersham Biosciences) and 90 μl of rabbit reticulocyte lysate (Promega). The mixture was incubated for 1 h at 30 °C. The C-tail was expressed in bacteria, purified on a nickel-agarose column (Qiagen) to a final concentration of 3 μg of protein/30 μl of beads. The binding reaction was performed using 45 μl of the in vitro translation reaction and 3 μg of the C-tail in a final volume of 500 μl of binding buffer composed of 25 mm Tris-HCl, pH 8.0, 150 mm NaCl, and 1% Nonidet P-40. The binding reaction was incubated overnight at 4 °C, and the beads were washed three times with the binding buffer. Bound proteins were eluted with 30 μl of 2× Laemmli buffer, boiled, and analyzed by SDS-PAGE. The gel was stained with Coomassie Blue, dried, and analyzed on a phosphor imager (Bio-Rad). Subcellular Distribution of PTEN in Cultured Cells—To gain insights into the distribution of PTEN in different cellular compartments, the subcellular distribution of endogenous PTEN was investigated in three nontransformed cell lines, NIH3T3, MCF10A, and Madin-Darby canine kidney cells. Solubilizing cells with a hypotonic buffer followed by Triton X-100 (1%) extraction resulted in the majority of PTEN proteins being found in the cytosolic fractions. The levels of PTEN in the membrane fractions were almost undetectable under these experimental conditions (Fig. 1A). As has been reported previously, the use of a weaker nonionic detergent, saponin (0.01%), increased the amount of PTEN in the membrane fraction to a detectable level in NIH3T3 cells (Fig. 1B) (34Nagata Y. Lan K.H. Zhou X. Tan M. Esteva F.J. Sahin A.A. Klos K.S. Li P. Monia B.P. Nguyen N.T. Hortobagyi G.N. Hung M.C. Yu D. Cancer Cell. 2004; 6: 117-127Abstract Full Text Full Text PDF PubMed Scopus (1546) Google Scholar). The potential of cross-contamination was monitored by using lactate dehydrogenase and R-Ras as the cytoplasmic and membrane marker, respectively (Fig. 1, A and B). In addition, the levels of PTEN in the nuclei of these cell lines were substantially lower than in the cytosolic fractions (Fig. 1C). Furthermore, by sucrose gradient fractionation, PTEN was not detected in the caveolin-rich lipid raft fractions (Fig. 1D). All of these data were consistent with several previous reports showing the predominant cytosolic localization of PTEN in mammalian cells (34Nagata Y. Lan K.H. Zhou X. Tan M. Esteva F.J. Sahin A.A. Klos K.S. Li P. Monia B.P. Nguyen N.T. Hortobagyi G.N. Hung M.C. Yu D. Cancer Cell. 2004; 6: 117-127Abstract Full Text Full Text PDF PubMed Scopus (1546) Google Scholar). Involvement of Ser-380 and Ser-385 in PTEN Membrane Targeting Capacity—Phosphorylation events in the C-tail region have been implicated in PTEN membrane binding capacity (14Das S. Dixon J.E. Cho W. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 7491-7496Crossref PubMed Scopus (283) Google Scholar, 17Vazquez F. Devreotes P. Cell Cycle. 2006; 5: 1523-1527Crossref PubMed Scopus (77) Google Scholar). However, the relative contribution of individual phosphorylation sites to membrane targeting in mammalian cells has not been clearly defined. For this, a panel of PTEN phosphorylation site mutants was constructed. They consisted of single site mutants S370A, S380A, T382A, T383A, and S385A; double site mutant S370A/S385A; and triple site mutant S380A/T382A/T383A. Using a PTEN null cell line, PC3, PTEN mutants were transiently transfected and subjected to subcellular fractionation using the saponin-containing lysis buffer as described in the legend to Fig. 1B. Among the single site mutants, both S380A and S385A displayed 4- and 3.5-fold greater proportion in the membrane fraction when compared with wild-type PTEN, respectively (Fig. 2A). The double site mutant, S370A/S385A, has the highest membrane targeting capacity, which was 5.5-fold greater than that of the wild-type protein. On the contrary, single site mutants S370A and T382A did not display differences from the wild-type protein. Finally, the T383A and the triple mutant only showed a 2-fold increase. To ascertain the role of phosphorylation at positions Ser-380 and Ser-385 in membrane recruitment, we constructed two phosphomimic mutants, S380E and S385E. Using the saponin-based fractionation procedures, the S380E mutant showed similar membrane distribution when compared with the S380A mutant. On the contrary, the S385E mutant has a significantly lower membrane binding capacity tha" @default.
• W2023557746 created "2016-06-24" @default.
• W2023557746 creator A5000897767 @default.
• W2023557746 creator A5050346445 @default.
• W2023557746 creator A5082454005 @default.
• W2023557746 creator A5089775365 @default.
• W2023557746 date "2007-08-01" @default.
• W2023557746 modified "2023-09-27" @default.
• W2023557746 title "Regulation of PTEN Activity by Its Carboxyl-terminal Autoinhibitory Domain" @default.
• W2023557746 cites W1860466326 @default.
• W2023557746 cites W1939083266 @default.
• W2023557746 cites W1964948442 @default.
• W2023557746 cites W1965090530 @default.
• W2023557746 cites W1984252209 @default.
• W2023557746 cites W1984418041 @default.
• W2023557746 cites W1988769784 @default.
• W2023557746 cites W1988845013 @default.
• W2023557746 cites W1998038367 @default.
• W2023557746 cites W2000780971 @default.
• W2023557746 cites W2001800178 @default.
• W2023557746 cites W2010784970 @default.
• W2023557746 cites W2012137424 @default.
• W2023557746 cites W2012192404 @default.
• W2023557746 cites W2012453416 @default.
• W2023557746 cites W2020891498 @default.
• W2023557746 cites W2033790217 @default.
• W2023557746 cites W2042084973 @default.
• W2023557746 cites W2048861528 @default.
• W2023557746 cites W2052068383 @default.
• W2023557746 cites W2059411043 @default.
• W2023557746 cites W2068427129 @default.
• W2023557746 cites W2071426679 @default.
• W2023557746 cites W2075211183 @default.
• W2023557746 cites W2077834462 @default.
• W2023557746 cites W2082810201 @default.
• W2023557746 cites W2083402635 @default.
• W2023557746 cites W2087984101 @default.
• W2023557746 cites W2094648330 @default.
• W2023557746 cites W2148285923 @default.
• W2023557746 cites W2152988906 @default.
• W2023557746 cites W2155737059 @default.
• W2023557746 cites W2160368371 @default.
• W2023557746 cites W2167355903 @default.
• W2023557746 cites W2170296344 @default.
• W2023557746 cites W2170374900 @default.
• W2023557746 cites W2319636149 @default.
• W2023557746 doi "https://doi.org/10.1074/jbc.m611240200" @default.
• W2023557746 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17565999" @default.
• W2023557746 hasPublicationYear "2007" @default.
• W2023557746 type Work @default.
• W2023557746 sameAs 2023557746 @default.
• W2023557746 citedByCount "151" @default.
• W2023557746 countsByYear W20235577462012 @default.
• W2023557746 countsByYear W20235577462013 @default.
• W2023557746 countsByYear W20235577462014 @default.
• W2023557746 countsByYear W20235577462015 @default.
• W2023557746 countsByYear W20235577462016 @default.
• W2023557746 countsByYear W20235577462017 @default.
• W2023557746 countsByYear W20235577462018 @default.
• W2023557746 countsByYear W20235577462019 @default.
• W2023557746 countsByYear W20235577462020 @default.
• W2023557746 countsByYear W20235577462021 @default.
• W2023557746 countsByYear W20235577462022 @default.
• W2023557746 countsByYear W20235577462023 @default.
• W2023557746 crossrefType "journal-article" @default.
• W2023557746 hasAuthorship W2023557746A5000897767 @default.
• W2023557746 hasAuthorship W2023557746A5050346445 @default.
• W2023557746 hasAuthorship W2023557746A5082454005 @default.
• W2023557746 hasAuthorship W2023557746A5089775365 @default.
• W2023557746 hasBestOaLocation W20235577461 @default.
• W2023557746 hasConcept C134306372 @default.
• W2023557746 hasConcept C185592680 @default.
• W2023557746 hasConcept C2777609662 @default.
• W2023557746 hasConcept C2779664074 @default.
• W2023557746 hasConcept C31258907 @default.
• W2023557746 hasConcept C33923547 @default.
• W2023557746 hasConcept C36503486 @default.
• W2023557746 hasConcept C41008148 @default.
• W2023557746 hasConcept C55493867 @default.
• W2023557746 hasConcept C62478195 @default.
• W2023557746 hasConcept C70721500 @default.
• W2023557746 hasConcept C86554907 @default.
• W2023557746 hasConcept C86803240 @default.
• W2023557746 hasConcept C95444343 @default.
• W2023557746 hasConceptScore W2023557746C134306372 @default.
• W2023557746 hasConceptScore W2023557746C185592680 @default.
• W2023557746 hasConceptScore W2023557746C2777609662 @default.
• W2023557746 hasConceptScore W2023557746C2779664074 @default.
• W2023557746 hasConceptScore W2023557746C31258907 @default.
• W2023557746 hasConceptScore W2023557746C33923547 @default.
• W2023557746 hasConceptScore W2023557746C36503486 @default.
• W2023557746 hasConceptScore W2023557746C41008148 @default.
• W2023557746 hasConceptScore W2023557746C55493867 @default.
• W2023557746 hasConceptScore W2023557746C62478195 @default.
• W2023557746 hasConceptScore W2023557746C70721500 @default.
• W2023557746 hasConceptScore W2023557746C86554907 @default.
• W2023557746 hasConceptScore W2023557746C86803240 @default.
• W2023557746 hasConceptScore W2023557746C95444343 @default.

• next