FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023568083> ?p ?o ?g. }

• W2023568083 endingPage "10598" @default.
• W2023568083 startingPage "10587" @default.
• W2023568083 abstract "The translocation of Bax from the cytosol into the mitochondrial outer membrane is a central event during apoptosis. We report that beyond the addressing step, which involves its first α-helix (hα1), the helices α5 and α6 (hα5α6) are responsible for the insertion of Bax into mitochondrial outer membrane bilayer. The translocation of Bax to mitochondria is associated with specific changes in the conformation of the protein that are under the control of two prolines: Pro-13, which controls the unfolding of hα1, and Pro-168, a proline located immediately before the hydrophobic carboxyl-terminal end (i.e. helix α9, hα9), which controls the disclosure of hα5α6. An additional step, the disruption of an electrostatic bond formed between Asp-33 (hα1) and Lys-64 (BH3), allows the mitochondria addressing of Bax. We conclude that, although the intramolecular interactions of hα1 with the BH3 region control the addressing of Bax to mitochondria, the Pro-168 is involved in the control of its membrane insertion through hα5α6. The translocation of Bax from the cytosol into the mitochondrial outer membrane is a central event during apoptosis. We report that beyond the addressing step, which involves its first α-helix (hα1), the helices α5 and α6 (hα5α6) are responsible for the insertion of Bax into mitochondrial outer membrane bilayer. The translocation of Bax to mitochondria is associated with specific changes in the conformation of the protein that are under the control of two prolines: Pro-13, which controls the unfolding of hα1, and Pro-168, a proline located immediately before the hydrophobic carboxyl-terminal end (i.e. helix α9, hα9), which controls the disclosure of hα5α6. An additional step, the disruption of an electrostatic bond formed between Asp-33 (hα1) and Lys-64 (BH3), allows the mitochondria addressing of Bax. We conclude that, although the intramolecular interactions of hα1 with the BH3 region control the addressing of Bax to mitochondria, the Pro-168 is involved in the control of its membrane insertion through hα5α6. The BCL-2 family of proteins is a central regulator of apoptosis, because these proteins are the final integrators of most death signals (1Cory S. Adams J.M. Nat. Rev. Cancer. 2002; 2: 647-656Crossref PubMed Scopus (3325) Google Scholar). This family is divided into two groups: the first with anti-apoptotic/pro-survival properties such as Bcl-2, Bcl-xl, Mcl-1, and the second with pro-apoptotic/death-promoting properties such as Bax and Bak (1Cory S. Adams J.M. Nat. Rev. Cancer. 2002; 2: 647-656Crossref PubMed Scopus (3325) Google Scholar). These two groups of proteins share some degrees of homology, which are restricted to three domains called BH1, BH2, and BH3. Associated with this family are proteins like Bid or Bad, with a homology with Bcl-2 limited to the BH3 region only and hence called BH3-only proteins (BOP) 1The abbreviations used are: BOP, BH3-only protein; ART, apoptosis-regulating targeting; CT, carboxyl-terminal end; cyt c, cytochrome c; DOX, doxorubicin; GBM, glioblastoma multiforme; Hα, α-helix; IP, immunoprecipitation; IVT, in vitro translated; NT, amino-terminal end; MOM, mitochondrial outer membrane; BdGBM, human glioblastoma multiforme; RFP, red fluorescent protein; CLIC, cytosol locked in conformation; CLAC, cyt c liberation-associated conformation; CF, correlation factor.1The abbreviations used are: BOP, BH3-only protein; ART, apoptosis-regulating targeting; CT, carboxyl-terminal end; cyt c, cytochrome c; DOX, doxorubicin; GBM, glioblastoma multiforme; Hα, α-helix; IP, immunoprecipitation; IVT, in vitro translated; NT, amino-terminal end; MOM, mitochondrial outer membrane; BdGBM, human glioblastoma multiforme; RFP, red fluorescent protein; CLIC, cytosol locked in conformation; CLAC, cyt c liberation-associated conformation; CF, correlation factor. (2Huang D.C. Strasser A. Cell. 2000; 103: 839-842Abstract Full Text Full Text PDF PubMed Scopus (896) Google Scholar, 3Danial N.N. Korsmeyer S.J. Cell. 2004; 116: 205-219Abstract Full Text Full Text PDF PubMed Scopus (4024) Google Scholar). These proteins activate or sensitize to apoptosis by interacting with Bcl-2 family members: the multidomain pro-apoptotic proteins Bax and Bak can be activated directly by BOP-like Bid, whereas another BOP-like Bad activates apoptosis by binding to and thus inactivating anti-apoptotic proteins (2Huang D.C. Strasser A. Cell. 2000; 103: 839-842Abstract Full Text Full Text PDF PubMed Scopus (896) Google Scholar, 3Danial N.N. Korsmeyer S.J. Cell. 2004; 116: 205-219Abstract Full Text Full Text PDF PubMed Scopus (4024) Google Scholar). The main function of Bax and Bak appears to be the induction of permeabilization of the mitochondrial outer membrane (MOM), through a mechanism that remains obscure (4Sharpe J.C. Arnoult D. Youle R.J. Biochim. Biophys. Acta. 2004; 1644: 107-113Crossref PubMed Scopus (341) Google Scholar). According to the rheostat model (5Oltvai Z.N. Korsmeyer S.J. Cell. 1994; 79: 189-192Abstract Full Text PDF PubMed Scopus (774) Google Scholar), interactions between anti- and pro-apoptotic proteins directly or indirectly regulate apoptosis through the permeabilization of MOM. Bax is a globular protein, present in the cytosol of resting cells, in an inactive state. However, in response to apoptotic stimuli, Bax undergoes specific conformational changes, which allow its targeting/insertion into MOM (1Cory S. Adams J.M. Nat. Rev. Cancer. 2002; 2: 647-656Crossref PubMed Scopus (3325) Google Scholar). Bid induces conformational changes in Bax that cause its dimerization and integration into mitochondrial membranes (6Eskes R. Desagher S. Antonsson B. Martinou J.C. Mol. Cell. Biol. 2000; 20: 929-935Crossref PubMed Scopus (1014) Google Scholar, 7Desagher S. Osen-Sand A. Nichols A. Eskes R. Montessuit S. Lauper S. Maundrell K. Antonsson B. Martinou J.-C. J. Cell Biol. 1999; 144: 891-901Crossref PubMed Scopus (1093) Google Scholar). Structural studies of Bax (8Suzuki M. Youle R.J. Tjandra N. Cell. 2000; 103: 645-654Abstract Full Text Full Text PDF PubMed Scopus (904) Google Scholar) show that this protein consists of nine helices α (hα) that are able to form a hydrophobic pocket into which a BH3 peptide from another protein may bind. These studies also showed that the hα5α6 of Bcl-xl, Bcl-2, and Bax are structurally similar to the pore-forming domain of the colicins A/E1 and diphtheria toxin (9Schendel S.L. Montal M. Reed J.C. Cell Death Differ. 1998; 5: 372-380Crossref PubMed Scopus (276) Google Scholar). The latter result suggests that both proteins could be able to function as membrane ions channels and as such facilitate MOM permeabilization during apoptosis (9Schendel S.L. Montal M. Reed J.C. Cell Death Differ. 1998; 5: 372-380Crossref PubMed Scopus (276) Google Scholar). Consistent with these results, it has been shown that Bax formed ionic channels in artificial membranes and that the electrical activity was indeed associated with the hα5hα6 (10Nouraini S. Six E. Matsuyama S. Krajewski S. Reed J.C. Mol. Cell. Biol. 2000; 20: 1604-1615Crossref PubMed Scopus (81) Google Scholar, 11Heimlich G. McKinnon A.D. Bernardo K. Brdiczka D. Reed J.C. Kain R. Kronke M. Jurgensmeier J.M. Biochem. J. 2004; 378: 247-255Crossref PubMed Scopus (87) Google Scholar). The lack of mitochondrial integration of Bax in the absence of a death signal is correlated with a repression imposed upon the targeting signal of Bax by the NH2-terminal (NT) domain (i.e. the first 20 amino acids of Bax α) called ART for apoptosis-regulating targeting sequence (12Goping I.S. Gross A. Lavoie J.N. Nguyen M. Jemmerson R. Roth K. Korsmeyer S.J. Shore G.C. J. Cell Biol. 1998; 143: 207-215Crossref PubMed Scopus (549) Google Scholar). It has been postulated that both the NT and carboxyl termini (CT) of Bax cooperated to maintain the inactive cytosolic conformation of Bax (12Goping I.S. Gross A. Lavoie J.N. Nguyen M. Jemmerson R. Roth K. Korsmeyer S.J. Shore G.C. J. Cell Biol. 1998; 143: 207-215Crossref PubMed Scopus (549) Google Scholar, 13Nechushtan A. Smith C.L. Hsu Y.T. Youle R.J. EMBO J. 1999; 18: 2330-2341Crossref PubMed Scopus (625) Google Scholar). We have recently reported that the hα1 of Bax, which immediately follows the ART domain, carries a MOM targeting signal, because this sequence causes the addressing to mitochondria of a cytosolic protein and this construct, unlike a similar construct with hα9, inhibits the association of Bax with mitochondria (14Cartron P.F. Juin P. Oliver L. Martin S. Meflah K. Vallette F.M. Mol. Cell. Biol. 2003; 23: 4701-4712Crossref PubMed Scopus (99) Google Scholar). We and others have shown that deletion of the hydrophobic CT of Bax (i.e. hα9) did not modify the intracellular localization in the presence of the ART domain (15Tremblais K. Oliver L. Juin P. Le Cabellec T.M. Meflah K. Vallette F.M. Biochem. Biophys. Res. Commun. 1999; 260: 582-591Crossref PubMed Scopus (44) Google Scholar, 16Oliver L. Priault M. Tremblais K. LeCabellec M. Meflah K. Manon S. Vallette F.M. FEBS Lett. 2000; 487: 161-165Crossref PubMed Scopus (36) Google Scholar, 17Priault M. Cartron P.F. Camougrand N. Antonsson B. Vallette F.M. Manon S. Cell Death Differ. 2003; 10: 1068-1077Crossref PubMed Scopus (44) Google Scholar, 18John G.B. Anjum R. Khar A. Nagaraj R. Exp. Cell Res. 2002; 278: 198-208Crossref PubMed Scopus (6) Google Scholar, 19Shi B. Triebe D. Kajiji S. Iwata K.K. Bruskin A. Mahajna J. Biochem. Biophys. Res. Commun. 1999; 254: 779-785Crossref PubMed Scopus (30) Google Scholar), whereas a deletion of both sequences enhanced Bax binding to MOM (18John G.B. Anjum R. Khar A. Nagaraj R. Exp. Cell Res. 2002; 278: 198-208Crossref PubMed Scopus (6) Google Scholar, 20Cartron P.-F. Priault M. Oliver L. Meflah K. Manon S. Vallette F.M. J. Biol. Chem. 2003; 278: 11633-11641Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). These results suggest that Bax NT and not its CT are involved in Bax translocation to mitochondria. Conversely, Schinzel et al. (21Schinzel A. Kaufmann T. Schuler M. Martinalbo J. Grubb D. Borner C. J. Cell Biol. 2004; 164: 1021-1032Crossref PubMed Scopus (124) Google Scholar) have recently reported that a Pro located near the CT of Bax (Pro-168) was crucial in directing Bax localization to mitochondria and could allow a hα9-mediated targeting of a reporter cytosolic protein. Because Bax-induced targeting to, insertion into, and permeabilization of MOM is a crucial step in the implementation of many forms of apoptosis, we have investigated the role of the helices α 1, 9, 5, and 6 in the acquisition of mitochondria-bound Bax conformation. Materials—Unless specified, all reagents used in this study were from Sigma (St. Louis, MO). The following antibodies were used: monoclonal anti-cytochrome c 6H2B4 from BD Bioscience (St. Quentin Yvelines, France), monoclonal anti-Bax 2D2 and 6A7 antibodies from R&D Systems (Lille, France), and the antibody Ab-4 form Oncogene (Calbiochem). The affinity-purified polyclonal antibody TL41 was raised against the Bax BH3 region peptide (i.e. residues 57–72) as described previously (22Juin P. Hunt A. Littlewood T. Griffiths B. Swigart L.B. Korsmeyer S. Evan G. Mol. Cell. Biol. 2002; 22: 6158-6169Crossref PubMed Scopus (123) Google Scholar), and the antibody AF820, raised against a synthetic peptide derived from residues 12–33 of human Bax α, was obtained from R&D Systems (see the localization of these sequences in Bax in Fig. 1). Monoclonal Bax antibody (clone 4F11) was from Immunotech and was used at a concentration of 1 μg/ml in confocal microscopy experiments. The mitochondrion-selective probe Mitotracker Green™ and Fluorescent Alexa 568™- and Alexa 468™-conjugated secondary antibodies were obtained from Molecular Probes (Interchim, Montlucon, France) and the fluorogenic peptide Ac-DEVD-AMC from Bachem (Voisins, France). Plasmids and Cell Transfection—NT mutants of Bax were obtained by site-directed mutagenesis using the PCR-based Gateway™ method and were subcloned into pDEST12.2 and pDEST3.2 plasmids according to the manufacturer's instructions (Invitrogen). The sequences of the primers used for site-directed mutagenesis are given in Table I. The other Bax mutants constructs have been described elsewhere (14Cartron P.F. Juin P. Oliver L. Martin S. Meflah K. Vallette F.M. Mol. Cell. Biol. 2003; 23: 4701-4712Crossref PubMed Scopus (99) Google Scholar, 20Cartron P.-F. Priault M. Oliver L. Meflah K. Manon S. Vallette F.M. J. Biol. Chem. 2003; 278: 11633-11641Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar, 23Cartron P.-F. Moreau C. Oliver L. Mayat E. Meflah K. Vallette F.M. FEBS Lett. 2002; 512: 95-100Crossref PubMed Scopus (61) Google Scholar).Table IOligonucleotides used for site-directed mutagenesis of BaxKit gateway™ (Invitrogen)Primers 5′ → 3′SequencesaBold residues represent subcloning sitesSenseBax αGGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC ATG GAC GGG TCC GGG GAG CAG CCC AGA GGC GGC GGGBax ψGGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC ATG AAG ACA GGG GCC CTT TTG CTT CAG TTC ATS15LGGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC ATG GAC GGG TCC GGG GAG CAG CCC AGA GGC GGC GGG CCC ACC CTC TCT GAA CAGP8VGGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC ATG GAC GGG TCC GGG GAG CAG CTC AGA GGC GGC GGGP13VGGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC ATG GAC GGG TCC GGG GAG CAG CCC AGA GGC GGC GGG GCC ACC AGCBax Δ37GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC ATG GGG GGG AGG CAC CCC GAG CTG GCC CTG GACAntisenseBax ΔCGGGG AC CAC TTT GTA CAA GAA AGC TGG GTA TGC CAC GTG GGC GTC CCA AAG TAG GAG AGG AGBax CGGGG AC CAC TTT GTA CAA GAA AGC TGG GTT TCA GCC CAT CTT CTT CCA GAT GGT GAG CGA GGC GGT GAG CATransformer™ site-directed mutagenesis (Stratagene)Mutationshα5hα6MTGCACCGCGGTGCCGGAACTGATCAGAACCATCATGGGCTGGCCATTGGCCTTCCTCGCGGCGCGGCTGA24RATGAAGACAGGGCGCCTTTTGCTTCAGGGTTTCATCCL26GATGAAGACAGGGCCCTGGGGCTTCAGGGTTTCATCCGene Tailor™ (Clontech)MutationsE17VcaccagctctgtgcagatcatgaagacaggggcK21GcagatcatggggacaggggcccttttgcttcagggD33ActtttgcttcagggtttcatccaggctcgagcagggcgD33KcttttgcttcagggtttcatccagaagcgagcagggcgR34GcatccaggatggagcagggcgaatggggggggL63AgagcgagtgtgccaagcgcatcggggacgaacK64AccaccaagaagctgagcgagtgtctcgcgcgcatcggggacK64DccaccaagaagctgagcgagtgtctcgatcgcatcggggacR65GgtgtctcaagggcatcggggacgaactggacagD68SgcgcatcggggtcgaactggacagtaacatggD68VgcgcatcgggagcgaactggacagtaacatggP168VctttgggacggtcacgtggcagaccgtgaccatcT169ActttgggacgcccgcgtggcagaccgtgaccatctttgS184VctcaccgccgtgctcaccatctggaagaagatgS184Actcaccgccgcgctcaccatctggaagaagatga Bold residues represent subcloning sites Open table in a new tab A Bax-deficient cell line derived from a human glioblastoma multiforme (BdGBM) treated with a Bak antisense (14Cartron P.F. Juin P. Oliver L. Martin S. Meflah K. Vallette F.M. Mol. Cell. Biol. 2003; 23: 4701-4712Crossref PubMed Scopus (99) Google Scholar) was transfected with the empty vector (pDEST12.2 or pDEST3.2.) or Bax mutants cloned into this vector. Plasmid DNAs (5 μg) were introduced into 106 BdGBM-Bak (-) cells by electroporation (GenePulser, Bio-Rad) using 200 V/cm and 250 microfarads, the transfected cells were selected in a medium containing neomycin (250 μg/ml) for 48 h. After selection, the bulk of transfected cells were used in in vitro experiments to avoid clonal bias as described previously (16Oliver L. Priault M. Tremblais K. LeCabellec M. Meflah K. Manon S. Vallette F.M. FEBS Lett. 2000; 487: 161-165Crossref PubMed Scopus (36) Google Scholar). Acellular Assay of Bax Insertion—Mitochondria were prepared from normal rat liver as described previously (24Guihard G. Bellot G. Moreau C. Pradal G. Ferry N. Thomy R. Fichet P. Meflah K. Vallette F.M. J. Biol. Chem. 2004; 279: 46542-46550Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). Of note, the presence of endoplasmic reticulum markers such as GRP 78 was routinely checked by immunoblots prior to any further experiments, and in most cases, no or little contamination by endoplasmic reticulum was found in our mitochondria preparation. Cell-free association of Bax with the mitochondria was performed as described previously (23Cartron P.-F. Moreau C. Oliver L. Mayat E. Meflah K. Vallette F.M. FEBS Lett. 2002; 512: 95-100Crossref PubMed Scopus (61) Google Scholar): briefly, [35S]Met (Amersham Biosciences)-labeled proteins were synthesized from cDNAs using the TnT-coupled Transcription/Translation system from Promega (Lyon, France) to obtain IVT Bax. The post-translational insertion of IVT proteins into mitochondrial membranes and the subsequent alkaline treatment (0.1 m Na2CO3, pH 11.5) of the mitochondria were performed in a standard import buffer as described previously (23Cartron P.-F. Moreau C. Oliver L. Mayat E. Meflah K. Vallette F.M. FEBS Lett. 2002; 512: 95-100Crossref PubMed Scopus (61) Google Scholar). IVT proteins bound to the mitochondria were recovered after centrifugation of the incubation mixture for 10 min at 4 °C and at 8000 × g in the pellet. [35S]Met-IVT Bax associated with isolated mitochondria was analyzed in a SDS-PAGE and scanned with a PhosphorImager (Molecular Dynamics). The amount of proteins present in the gel was quantified with the IP Lab gel program (Signal Analytics, Vienna, VA) and expressed as a percentage of initial input. To analyze the release of mitochondrial apoptogenic factors from mitochondria, the supernatant derived from the latter acellular assay was incubated together with a non-apoptotic cellular extract, and the DEVDase activity was measured in these extracts as described before (23Cartron P.-F. Moreau C. Oliver L. Mayat E. Meflah K. Vallette F.M. FEBS Lett. 2002; 512: 95-100Crossref PubMed Scopus (61) Google Scholar). For the release of cytochrome c (cyt c), 20 μl of supernatant from the acellular assay was analyzed by immunoblotting and quantified with the IP Lab gel program. In all experiments, the aggregation of proteins was controlled by incubating the Bax constructs with non-relevant antibodies in the absence or presence of mitochondria. Of note, we never found a significant amount of proteins aggregating under our conditions (data not shown). Binding of IVT Bax to Bcl-2 or its stimulation by p13-tBid was performed as described previously (14Cartron P.F. Juin P. Oliver L. Martin S. Meflah K. Vallette F.M. Mol. Cell. Biol. 2003; 23: 4701-4712Crossref PubMed Scopus (99) Google Scholar). Quantification of Apoptosis—BdGBM cells (2 × 106 cells), transfected with the different Bax constructs, were cultured in the presence or in the absence of doxorubicin (DOX, 2 μg/ml) for 16 h before quantification of apoptosis by measurement of DEVDase activities. Briefly, the cells were washed several times with phosphate-buffered saline, plated in 96-well plates, and then the caspase-3 fluorogenic substrate (Ac-DEVD-AMC) was added in the presence of 0.01% Triton X-100 and enzymatic activity was quantified in a fluorometer over a period of 1 h (t1), whereas the activity was in a linear range. The activities were calculated from the differences measured between t1 and t0 and thus were not affected by the different backgrounds. Confocal Analysis—For laser confocal microscopy analysis, the cells were incubated for 30 min with 5 μg/ml MitoTracker Green™ at 37 °C then fixed with 1:1 methanol/acetone for 15 min at -20 °C. After saturation with 3% bovine serum albumin in phosphate-buffered saline, the cells were incubated with anti-Bax and anti-cyt c antibodies for 1 h at 37 °C. Cells were extensively washed, and then the conjugated secondary antibodies were added for 1 h at 37 °C. The weak auto fluorescence due to doxorubicin, which was mostly located in the nuclei of the treated cells, did not interfere with our analyses. Images were collected on a Leica TCS NT microscope with a 63 × 1.3 NA Fluotar objective (Leica, France). Quantification of the overlay of labeling was done using a MetaMorph 4.6 program (Universal Imaging Corp.). The correlation factor (CF) is a measure of the strength of the relationship between two variables, x (labeling specific for the mitochondria) and y (labeling specific for the protein of interest), and was calculated as instructed by the manufacturer (www.universal.imaging.com). On average, calculations were performed after analysis of 50 different cells for four independent experiments. Subcellular Fractionation and Immunoprecipitation Experiment— Cell fractionation was performed as described in Cartron et al. (20Cartron P.-F. Priault M. Oliver L. Meflah K. Manon S. Vallette F.M. J. Biol. Chem. 2003; 278: 11633-11641Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). Immunoprecipitation experiments were performed according to the manufacturer's instructions (www.zymed.com/methods/ip.html). Bax or its mutants were incubated in the presence of 4 μg of antibodies 2D2, 6A7, Ab-4, TL41, or AF820 for up to 16 h at 4 °C. Antibody-protein complexes were then incubated with gentle rocking first with a second antibody for 2 h at 4 °C and then with Zysorbin (Zymed Laboratories Inc.) for an additional 2 h at 4°C. The agarose beads were collected by centrifugation for 5 s at 13,000 × g. The supernatant was removed, and the pellet washed three times with phosphate-buffered saline before resuspension in 50 μl of SDS-PAGE loading buffer. Controls immunoprecipitated (IP) were carried out in parallel with unrelated poly- or monoclonal antibodies. SDS-PAGE analysis and quantification of the IP IVT proteins using a PhosphorImager were performed as described for IVT protein insertion into mitochondria. Bacterial Two-hybrid Assay—The interaction between Bax domains was assayed using the Bacteriomatch™ two-hybrid system (Stratagene). This assay measured the interaction between polypeptides fused to the NT of RNA polymerase α in a target plasmid (pTRG) and a sequence fused to the bacteriophage λcl protein in a bait plasmid (pBT). The interaction between the proteins ensured the survival of bacteria in a selective media. The binding of Bax hα1 with Bax BH3 was screened using as a bait the plasmid encoding for hα1-RFP (pBT-Hα1Bax-RFP), whereas the target plasmids encoded for Bax α (pTRG-Bax α), Bax Ψ (pTRG-Bax Ψ), and Bax α deleted of its first 37 amino acids (pTRG-Bax α Δ37), the BH3 region (pTRG-Bax ΔBH3), or expressing only this domain (pTRG-Bax BH3). Bacteria transformation, growth, and selection were performed according to the manufacturer's instructions (www.stgn.com/manuals/982000.pdf). The hα1 Mediates Bax Targeting to Mitochondria while the hα5α6 Is Involved in Its Membrane Insertion—It has recently been shown that the hα1 of Bax behaves as an endoplasmic reticulum transmembrane (TM) segment when fused to Escherichia coli Leader peptidase (25Garcia-Saez A.J. Mingarro I. Perez-Paya E. Salgado J. Biochemistry. 2004; 43: 10930-10943Crossref PubMed Scopus (117) Google Scholar). In a previous study, we have shown that Bax hα1 is a mitochondrial targeting signal but not a membrane insertion domain for the MOM (20Cartron P.-F. Priault M. Oliver L. Meflah K. Manon S. Vallette F.M. J. Biol. Chem. 2003; 278: 11633-11641Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). Because, during apoptosis, Bax is inserted into MOM as a membrane-embedded protein (26Schinzel A. Kaufmann T. Borner C. Biochim. Biophys. Acta. 2004; 1644: 95-105Crossref PubMed Scopus (125) Google Scholar), we have performed a series of mutants and deletions along the Bax α sequence to localize the anchor domain of Bax for the MOM. An epitope-mapping technique to detect changes in the conformation was also used to complement the mutagenesis experiments (Fig. 1 and Table II).Table IIMapping of the conformation of the Bax constructs by immunoprecipitation with different anti-Bax antibodies 1% Triton was used to expose all epitopes as described in Hsu et al. (32Hsu Y.T. Youle R.J. J. Biol. Chem. 1997; 272: 13829-13834Abstract Full Text Full Text PDF PubMed Scopus (512) Google Scholar).Antibodies2D26A7AF820TL41Ab-4Amino acids3-1612-2412-3457-6998-117DomainsARTART/Ha1ART/Ha1BH3CTWt+----Triton+++++Bax αL26G+----α5α6M+----L63E+----P13L+++-+P8L+----Wt+----Triton+++++Bax α Δhα9L26G+----α5α6M+----L63E+----Wt-++++Triton-++++Bax ψL26G-++++α5α6M-++++L63E-++++Wt-++++Triton-++++Bax ψ Δhα9L26G-++++α5α6M-++++L63E-++++ Open table in a new tab Cell free systems have been widely used to determine the nature of the signals contained in proteins that are involved in membrane integration, and indeed, this type of experiments have led to the demonstration that the CT of Bcl-2 contained a membrane addressing/anchoring signal (27Nguyen M. Branton P.E. Walton P.A. Oltvai Z.N. Korsmeyer S.J. Shore G.C. J. Biol. Chem. 1994; 269: 16521-16524Abstract Full Text PDF PubMed Google Scholar, 28Janiak F. Leber B. Andrews D. J. Biol. Chem. 1994; 269: 9842-9849Abstract Full Text PDF PubMed Google Scholar). Using the same system, several reports have shown that the association of Bax α with mitochondria in cell-free systems is extremely low (12Goping I.S. Gross A. Lavoie J.N. Nguyen M. Jemmerson R. Roth K. Korsmeyer S.J. Shore G.C. J. Cell Biol. 1998; 143: 207-215Crossref PubMed Scopus (549) Google Scholar, 15Tremblais K. Oliver L. Juin P. Le Cabellec T.M. Meflah K. Vallette F.M. Biochem. Biophys. Res. Commun. 1999; 260: 582-591Crossref PubMed Scopus (44) Google Scholar) but could be increased by a deletion of the first 19 amino acids (12Goping I.S. Gross A. Lavoie J.N. Nguyen M. Jemmerson R. Roth K. Korsmeyer S.J. Shore G.C. J. Cell Biol. 1998; 143: 207-215Crossref PubMed Scopus (549) Google Scholar). For this reason, the first 20 amino acids of Bax have been called ART for apoptosis-regulating targeting domain (12Goping I.S. Gross A. Lavoie J.N. Nguyen M. Jemmerson R. Roth K. Korsmeyer S.J. Shore G.C. J. Cell Biol. 1998; 143: 207-215Crossref PubMed Scopus (549) Google Scholar). The ART-deleted form of Bax α is equivalent to Bax Ψ, a variant of Bax identified in a series of brain tumors. This form of Bax is constitutively associated with mitochondria and particularly apoptogenic (29Cartron P.F. Oliver L. Martin S. Moreau C. LeCabellec M.T. Jezequel P. Meflah K. Vallette F.M. Hum. Mol. Genet. 2002; 11: 675-687Crossref PubMed Google Scholar). We have shown that neither hα1 nor the hydrophobic CT were the membrane anchor domain of Bax α or Bax Ψ (20Cartron P.-F. Priault M. Oliver L. Meflah K. Manon S. Vallette F.M. J. Biol. Chem. 2003; 278: 11633-11641Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). A hairpin pair of amphipathic helices hα5α6 has been predicted to form a pore and to be involved in the membrane insertion of Bax α (10Nouraini S. Six E. Matsuyama S. Krajewski S. Reed J.C. Mol. Cell. Biol. 2000; 20: 1604-1615Crossref PubMed Scopus (81) Google Scholar, 11Heimlich G. McKinnon A.D. Bernardo K. Brdiczka D. Reed J.C. Kain R. Kronke M. Jurgensmeier J.M. Biochem. J. 2004; 378: 247-255Crossref PubMed Scopus (87) Google Scholar). Nouraini et al. (10Nouraini S. Six E. Matsuyama S. Krajewski S. Reed J.C. Mol. Cell. Biol. 2000; 20: 1604-1615Crossref PubMed Scopus (81) Google Scholar) have shown that the substitution of 8 out of 10 charged residues in this domain of Bax with an Ala resulted in a loss of cytotoxicity. We performed these mutations, which we called hα5α6 M (Fig. 1), in several Bax constructs with or without the NT or CT (i.e. Bax α, Bax Ψ, and Δhα9 derivatives) and examined their effects on the association of Bax with mitochondria using a cell-free system. As shown in Fig. 2a, a L26G mutation abolished the association of Bax α and Bax Ψ with mitochondria, as previously shown (20Cartron P.-F. Priault M. Oliver L. Meflah K. Manon S. Vallette F.M. J. Biol. Chem. 2003; 278: 11633-11641Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar), whereas mutations in hα5α6 (hα5α6M) or the deletion of hα9 had no effect. Similarly, a mutation in hα1(i.e. A24R), which was designed to generate a canonical mitochondrial addressing signal (30Wiedemann N. Frazier A.E. Pfanner N. J. Biol. Chem. 2004; 279: 14473-14476Abstract Full Text Full Text PDF PubMed Scopus (278) Google Scholar), had no effect on the association of Bax with mitochondria, suggesting that the hα1 did not carry a conventional targeting sequence. Alkali treatment of the mitochondrial pellet revealed that only Bax Ψ was inserted into mitochondria and that this insertion was altered by the hα5α6 mutations and not by a deletion of Bax CT (Δhα9) (Fig. 2a). The functionality of the association/insertion of Bax mutants was assessed by quantification of cyt c release into the supernatant in cell free assay. As illustrated in Fig. 2b, only Bax Ψ and Bax ΨΔhα9 induced the liberation of cyt c from mitochondria, and this release was inhibited in hα1 and hα5α6 mutants. These results ruled out the possibility that Bax constructs, associated with mitochondria as observed in Fig. 2a, was simply aggregated on the surface of the organelle. These different constructs were expressed in BdGBM cells (14Cartron P.F. Juin P. Oliver L. Martin S. Meflah K. Vallette F.M. Mol. Cell. Biol. 2003; 23: 4701-4712Crossref PubMed Scopus (99) Google Scholar), and apoptosis was induced with DOX as described under “Experimental Procedures.” As shown in Fig. 2c, the deletion of hα9 in Bax α had no influence on the induction of cell death but increased the apoptogenicity of Bax Ψ as described before (20Cartron P.-F. Priault M. Oliver L. Meflah K. Manon S. Vallette F.M. J. Biol. Chem. 2003; 278: 11633-11641Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). On the other hand, both the hα1 and hα5α6 mutations decreased cell death to that observed with a control plasmid (Fig. 2c). Altogether, these results suggest that hα1 regulates the targeting, and the association of Bax with mitochondria and the hα5α6 regulates its membrane insertion. Conformational changes in" @default.
• W2023568083 created "2016-06-24" @default.
• W2023568083 creator A5027603422 @default.
• W2023568083 creator A5028466138 @default.
• W2023568083 creator A5033149357 @default.
• W2023568083 creator A5036886359 @default.
• W2023568083 creator A5068858377 @default.
• W2023568083 creator A5085760118 @default.
• W2023568083 date "2005-03-01" @default.
• W2023568083 modified "2023-10-13" @default.
• W2023568083 title "Distinct Domains Control the Addressing and the Insertion of Bax into Mitochondria" @default.
• W2023568083 cites W1530373462 @default.
• W2023568083 cites W1548718817 @default.
• W2023568083 cites W1598875578 @default.
• W2023568083 cites W1607777232 @default.
• W2023568083 cites W1948709514 @default.
• W2023568083 cites W1965071591 @default.
• W2023568083 cites W1966081420 @default.
• W2023568083 cites W1973111841 @default.
• W2023568083 cites W1974234869 @default.
• W2023568083 cites W1982441008 @default.
• W2023568083 cites W1983631836 @default.
• W2023568083 cites W1984498109 @default.
• W2023568083 cites W1987482424 @default.
• W2023568083 cites W1995150044 @default.
• W2023568083 cites W2000093730 @default.
• W2023568083 cites W2003472250 @default.
• W2023568083 cites W2012974735 @default.
• W2023568083 cites W2014114887 @default.
• W2023568083 cites W2014586657 @default.
• W2023568083 cites W2017671645 @default.
• W2023568083 cites W2020721942 @default.
• W2023568083 cites W2032049833 @default.
• W2023568083 cites W2033873142 @default.
• W2023568083 cites W2041822578 @default.
• W2023568083 cites W2053534788 @default.
• W2023568083 cites W2056418403 @default.
• W2023568083 cites W2057660646 @default.
• W2023568083 cites W2067130864 @default.
• W2023568083 cites W2070210709 @default.
• W2023568083 cites W2071530913 @default.
• W2023568083 cites W2073028327 @default.
• W2023568083 cites W2080458504 @default.
• W2023568083 cites W2085035973 @default.
• W2023568083 cites W2087877138 @default.
• W2023568083 cites W2095122505 @default.
• W2023568083 cites W2098210382 @default.
• W2023568083 cites W2100185604 @default.
• W2023568083 cites W2106697922 @default.
• W2023568083 cites W2111941604 @default.
• W2023568083 cites W2114001234 @default.
• W2023568083 cites W2130490261 @default.
• W2023568083 cites W2132055326 @default.
• W2023568083 cites W2134979684 @default.
• W2023568083 cites W2136269288 @default.
• W2023568083 cites W2140372706 @default.
• W2023568083 cites W2143067729 @default.
• W2023568083 cites W2143190256 @default.
• W2023568083 cites W2151827847 @default.
• W2023568083 cites W2156397833 @default.
• W2023568083 cites W2166598738 @default.
• W2023568083 cites W2171365668 @default.
• W2023568083 cites W80462140 @default.
• W2023568083 doi "https://doi.org/10.1074/jbc.m409714200" @default.
• W2023568083 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15590655" @default.
• W2023568083 hasPublicationYear "2005" @default.
• W2023568083 type Work @default.
• W2023568083 sameAs 2023568083 @default.
• W2023568083 citedByCount "87" @default.
• W2023568083 countsByYear W20235680832012 @default.
• W2023568083 countsByYear W20235680832013 @default.
• W2023568083 countsByYear W20235680832014 @default.
• W2023568083 countsByYear W20235680832015 @default.
• W2023568083 countsByYear W20235680832016 @default.
• W2023568083 countsByYear W20235680832017 @default.
• W2023568083 countsByYear W20235680832018 @default.
• W2023568083 countsByYear W20235680832019 @default.
• W2023568083 countsByYear W20235680832020 @default.
• W2023568083 countsByYear W20235680832021 @default.
• W2023568083 countsByYear W20235680832022 @default.
• W2023568083 countsByYear W20235680832023 @default.
• W2023568083 crossrefType "journal-article" @default.
• W2023568083 hasAuthorship W2023568083A5027603422 @default.
• W2023568083 hasAuthorship W2023568083A5028466138 @default.
• W2023568083 hasAuthorship W2023568083A5033149357 @default.
• W2023568083 hasAuthorship W2023568083A5036886359 @default.
• W2023568083 hasAuthorship W2023568083A5068858377 @default.
• W2023568083 hasAuthorship W2023568083A5085760118 @default.
• W2023568083 hasBestOaLocation W20235680831 @default.
• W2023568083 hasConcept C154945302 @default.
• W2023568083 hasConcept C185592680 @default.
• W2023568083 hasConcept C2775924081 @default.
• W2023568083 hasConcept C28859421 @default.
• W2023568083 hasConcept C41008148 @default.
• W2023568083 hasConcept C86803240 @default.
• W2023568083 hasConcept C95444343 @default.
• W2023568083 hasConceptScore W2023568083C154945302 @default.
• W2023568083 hasConceptScore W2023568083C185592680 @default.

• next