FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023576480> ?p ?o ?g. }

• W2023576480 endingPage "512" @default.
• W2023576480 startingPage "504" @default.
• W2023576480 abstract "A simple and rapid method to detect the epidermal growth factor receptor hot spot mutation L858R in lung adenocarcinoma was developed based on principles similar to the universal heteroduplex generator technology. A single-stranded oligonucleotide with an internal deletion was used to generate heteroduplexes (loop-hybrids) bearing a loop in the complementary strand derived from the polymerase chain reaction product of the normal or mutant allele. By placing deletion in the oligonucleotide adjacent to the mutational site, difference in electrophoretic mobility between loop-hybrids with normal and mutated DNA was distinguishable in a native polyacrylamide gel. The method was also modified to detect in-frame deletion mutations of epidermal growth factor receptor in lung adenocarcinomas. In addition, the method was adapted to detect hot spot mutations in the B-type Raf kinase (BRAF) at V600 and in a Ras-oncogene (NRAS) at Q61, the mutations commonly found in thyroid carcinomas. Our mutation detection system, designated the loop-hybrid mobility shift assay was sensitive enough to detect mutant DNA comprising 7.5% of the total DNA. As a simple and straightforward mutation detection technique, loop-hybrid mobility shift assay may be useful for the molecular diagnosis of certain types of clinical cancers. Other applications are also discussed. A simple and rapid method to detect the epidermal growth factor receptor hot spot mutation L858R in lung adenocarcinoma was developed based on principles similar to the universal heteroduplex generator technology. A single-stranded oligonucleotide with an internal deletion was used to generate heteroduplexes (loop-hybrids) bearing a loop in the complementary strand derived from the polymerase chain reaction product of the normal or mutant allele. By placing deletion in the oligonucleotide adjacent to the mutational site, difference in electrophoretic mobility between loop-hybrids with normal and mutated DNA was distinguishable in a native polyacrylamide gel. The method was also modified to detect in-frame deletion mutations of epidermal growth factor receptor in lung adenocarcinomas. In addition, the method was adapted to detect hot spot mutations in the B-type Raf kinase (BRAF) at V600 and in a Ras-oncogene (NRAS) at Q61, the mutations commonly found in thyroid carcinomas. Our mutation detection system, designated the loop-hybrid mobility shift assay was sensitive enough to detect mutant DNA comprising 7.5% of the total DNA. As a simple and straightforward mutation detection technique, loop-hybrid mobility shift assay may be useful for the molecular diagnosis of certain types of clinical cancers. Other applications are also discussed. Rapid and accurate detection of mutations in various cancer-related genes has become increasingly important to provide molecular diagnostic information about clinical cancers. For example, information of the mutated states of particular genes is crucial for successful chemotherapy with certain gene-targeting drugs. Namely, gleevec (imatinib) has been shown to be effective for gastrointestinal stromal tumor with specific mutations in KIT1Hirota S Isozaki K Moriyama Y Hashimoto K Nishida T Ishiguro S Kawano K Hanada M Kurata A Takeda M Muhammad Tunio G Matsuzawa Y Kanakura Y Shinomura Y Kitamura Y Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors.Science. 1998; 279: 577-580Crossref PubMed Scopus (3834) Google Scholar,2Joensuu H Roberts P Sarlomo-Rikala M Andersson L Tervahartiala P Tuveson D Silberman S Capdeville R Dimitrijevic S Druker B Demetri G Effect of the tyrosine kinase inhibitor STI571 in a patient with a metastatic gastrointestinal stromal tumor.N Engl J Med. 2001; 344: 1052-1056Crossref PubMed Scopus (1833) Google Scholar and PDGFRA,3Heinrich M Corless C Duensing A McGreevey L Chen C Joseph N Singer S Griffith D Haley A Town A Demetri G Fletcher C Fletcher J PDGFRA activating mutations in gastrointestinal stromal tumors.Science. 2003; 299: 708-710Crossref PubMed Scopus (2003) Google Scholar as well as for chronic myelogenous leukemia carrying the chimeric gene BCR/ABL1.4Savage D Antman K Imatinib mesylate—a new oral targeted therapy.N Engl J Med. 2002; 346: 683-693Crossref PubMed Scopus (727) Google Scholar Recently, a subset of lung adenocarcinomas with specific mutations in epidermal growth factor receptor (EGFR) has been reported to respond remarkably well to Iressa (gefitinib).5Arao T Fukumoto H Takeda M Tamura T Saijo N Nishio K Small in-frame deletion in the epidermal growth factor receptor as a target for ZD6474.Cancer Res. 2004; 64: 9101-9104Crossref PubMed Scopus (114) Google Scholar6Lynch T Bell D Sordella R Gurubhagavatula S Okimoto R Brannigan B Harris P Haserlat S Supko J Haluska F Louis D Christiani D Settleman J Haber D Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib.N Engl J Med. 2004; 350: 2129-2139Crossref PubMed Scopus (10037) Google Scholar7Marchetti A Martella C Felicioni L Barassi F Salvatore S Chella A Camplese P Iarussi T Mucilli F Mezzetti A Cuccurullo F Sacco R Buttitta F EGFR mutations in non-small-cell lung cancer: analysis of a large series of cases and development of a rapid and sensitive method for diagnostic screening with potential implications on pharmacologic treatment.J Clin Oncol. 2005; 23: 857-865Crossref PubMed Scopus (776) Google Scholar8Paez J Janne P Lee J Tracy S Greulich H Gabriel S Herman P Kaye F Lindeman N Boggon T Naoki K Sasaki H Fujii Y Eck M Sellers W Johnson B Meyerson M EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy.Science. 2004; 304: 1497-1500Crossref PubMed Scopus (8492) Google Scholar9Pao W Miller V Zakowski M Doherty J Politi K Sarkaria I Singh B Heelan R Rusch V Fulton L Mardis E Kupfer D Wilson R Kris M Varmus H EGF receptor gene mutations are common in lung cancers from “never smokers” and are associated with sensitivity of tumors to gefitinib and erlotinib.Proc Natl Acad Sci USA. 2004; 101: 13306-13311Crossref PubMed Scopus (3890) Google Scholar To detect mutations in these and other oncogenes, there are several long-standing methods available such as direct sequencing of polymerase chain reaction (PCR)-amplified DNA, single-strand conformation polymorphism (SSCP),10Orita M Iwahana H Kanazawa H Hayashi K Sekiya T Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms.Proc Natl Acad Sci USA. 1989; 86: 2766-2770Crossref PubMed Scopus (3390) Google Scholar SSCP/duplex analyses,11Kozlowski P Krzyzosiak W Combined SSCP/duplex analysis by capillary electrophoresis for more efficient mutation detection.Nucleic Acids Res. 2001; 29: E71Crossref PubMed Scopus (61) Google Scholar mutant allele-specific amplification,12Takeda S Ichii S Nakamura Y Detection of K-ras mutation in sputum by mutant-allele-specific amplification (MASA).Hum Mutat. 1993; 2: 112-117Crossref PubMed Scopus (148) Google Scholar and denaturing high performance liquid chromatography.13Underhill P Jin L Lin A Mehdi S Jenkins T Vollrath D Davis R Cavalli-Sforza L Oefner P Detection of numerous Y chromosome biallelic polymorphisms by denaturing high-performance liquid chromatography.Genome Res. 1997; 7: 996-1005Crossref PubMed Scopus (580) Google Scholar,14Liu W Smith D Rechtzigel K Thibodeau S James C Denaturing high performance liquid chromatography (DHPLC) used in the detection of germline and somatic mutations.Nucleic Acids Res. 1998; 26: 1396-1400Crossref PubMed Scopus (230) Google Scholar These techniques have been successfully applied for the detection of mutational changes in various cancer genes. Each method has its own advantages as well as disadvantages or difficulties in practical situations. Direct sequencing of heterozygous point mutations and deletions may produce results requiring sophisticated data analysis for heterozygous mutations, especially in the presence of contaminating normal tissue DNA. SSCP, widely used for its simplicity, requires strict temperature control during a long electrophoretic time and radiolabeling in standard detection. SSCP/duplex and denaturing high performance liquid chromatography analyses necessitate sophisticated separation equipment such as capillary electrophoresis or high performance liquid chromatography with temperature control. Mutant allele-specific amplification requires several primers with mutational sites at the 3′ ends to discriminate the mutational base changes by the lack of polymerase extension beyond the mismatched end, and occasional read-through can cause ambiguous results. Heteroduplex analysis using universal heteroduplex generator (UHG) technology15Wood N Standen G Hows J Bradley B Bidwell J Diagnosis of sickle-cell disease with a universal heteroduplex generator.Lancet. 1993; 342: 1519-1520Abstract PubMed Scopus (17) Google Scholar,16Wood N Tyfield L Bidwell J Rapid classification of phenylketonuria genotypes by analysis of heteroduplexes generated by PCR-amplifiable synthetic DNA.Hum Mutat. 1993; 2: 131-137Crossref PubMed Scopus (26) Google Scholar is based on the retarded mobility in native polyacrylamide gel electrophoresis (PAGE) of a heteroduplex between the test PCR fragment and the PCR fragment termed the heteroduplex generator. Heteroduplex generators contain small deletions in the vicinities of mutational sites and generate four kinds of heteroduplexes with mutant and normal strands by hybridization, which are differentiated by the mobility changes. The method was applied to detect point mutations in sickle-cell diseases and phenylketonuria. Recently, UHG technology was adapted for detection of point mutations in NRAS at codons 12, 13, and 61.17Belli C De Brasi C Larripa I Rapid detection of exon 1 NRAS gene mutations using universal heteroduplex generator technology.Hum Mutat. 2003; 21: 132-137Crossref PubMed Scopus (5) Google Scholar,18Belli C Bowen D De Brasi C Larripa I A single, multiplex analysis for all relevant activating NRAS gene mutations using heteroduplex generators.Br J Haematol. 2004; 126: 602-605Crossref PubMed Scopus (3) Google Scholar In UHG technology, band patterns of four different retarded bands in PAGE are analyzed to determine mutational states. We simplified UHG technology by using single-stranded oligonucleotides with internal deletions as the generators of the loop-bearing heteroduplexes. This modification yields two bands for heterozygosity and one band for homozygosity, enabling more straightforward data analysis. Our method, designated the loop-hybrid mobility shift assay (LH-MSA), was developed to detect the point mutation L858R of EGFR exon 21 in lung adenocarcinoma that is associated with responsiveness to gene-targeted kinase inhibitors such as gefitinib. Adaptations of LH-MSA to detect in-frame deletions of EGFR exon 19 in lung adenocarcinoma and hot spot point mutations of BRAF and NRAS in thyroid carcinoma are also described. DNA from fresh tumor tissues (16 cases of lung adenocarcinoma, 25 cases of papillary thyroid carcinoma, and 19 cases of follicular thyroid carcinoma) was prepared according to standard protocols after obtaining informed consent. Formalin-fixed, paraffin-embedded (FFPE) tissue sections of lung adenocarcinoma and papillary thyroid carcinoma were also used for preparing DNA as follows. Thin-sectioned tissues (15 to 20 μm thick) were deparaffinized with xylene followed by ethanol series and air-dried. Tumor tissues, identified in the hematoxylin and eosin-stained serial sections (2 μm), were applied with a pinpoint solution (Pinpoint slide DNA isolation system; Zymo Research, Orange, CA), air-dried, and cut out together with the overlaid dried film of the pinpoint solution. The excised tissues (3-mm square) were digested in proteinase K buffer solution at 55°C for 4 hours, heat inactivated at 95°C for 15 minutes, and used as PCR template directly, or after purification with a spin column. PCR-amplified DNA fragments were ligated to the TOPO-TA ligation vector pCR4TOPO (Invitrogen, Carlsbad, CA), electroporated into Escherichia coli, and cloned. Cloned bacterial cells were suspended in lysis solution (CloneChecker; Invitrogen), heat-lysed at 98°C for 30 seconds, and used as the cloned plasmid DNA solutions. DNA of the cloned plasmids was amplified with Phi29 polymerase (GE Health Care Bio-Science, Piscataway, NJ) and used for sequencing the inserts of tumor DNA fragments (CEQ8000 sequence analysis system; Beckman Coulter, Fullerton, CA). Direct sequencing of the PCR products from EGFR exon 21 was performed as described by Lynch and colleagues.6Lynch T Bell D Sordella R Gurubhagavatula S Okimoto R Brannigan B Harris P Haserlat S Supko J Haluska F Louis D Christiani D Settleman J Haber D Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib.N Engl J Med. 2004; 350: 2129-2139Crossref PubMed Scopus (10037) Google Scholar The LH-MSA consisted of two parts: hybridization of PCR products to the loop-hybrid generator (LH-G) probes made from synthetic oligonucleotides (70 to 99 mers) to generate loop-hybrids (Figure 1A) and analysis of mobility shifts of the loop-hybrids after native PAGE as described below. Nucleotide sequences of PCR primers and LH-G probes used to detect point mutations (7R, 18R, 9F, and 10K) and deletions (19JWTF) are described in Table 1. Each LH-G probe was designed to overlap with one of the PCR primer pairs at the 5′ end, and a stretch of up to 18 nucleotides was deleted in the region adjacent to the mutational hot spot for detection of point mutations. To detect deletion mutations in EGFR exon 19, the LH-G probe (19JWTF) was an oligonucleotide with no internal deletion that extended 26 nucleotides beyond the region of deletion mutations so that a loop forms only when it hybridizes with PCR products containing a deletion in EGFR exon 19 (Figure 3A). LH-G probes were purified with high performance liquid chromatography. PCR was performed with Accuprime Taq polymerase containing primer-template hybridization-enhancing reagent (Invitrogen). Generation of loop-hybrids was conducted at the end of the PCR amplification cycles by adding a specific LH-G probe into the PCR reaction solution at a final concentration of 500 nmol/L, ie, in large excess to the initial concentration of primer pairs (200 nmol/L). The mixture was then subjected to the loop-hybrid formation (LH-F) steps, consisting of 1) denaturation at 94°C for 2 minutes, 2) hybridization of the LH-G probe to the complementary strand at 55°C for 15 seconds, and 3) extension of the 3′ end of the LH-G probe in loop-hybrids by Taq polymerase at 68°C for 4 minutes. After the LH-F steps, reaction products were analyzed by PAGE to detect migration shift of the loop-hybrid bands by the mutations.Table 1PCR Primers and LH-G Probes Used for Detection of Mutations in EGFR, BRAF, and NRASGeneMutationAmpliconPCR primer†(F), forward primers; (R), reverse primers.LH-G probe‡deleted nucleotides; underlined nucleotides indicate the hot spots of mutations to be detected. (probe name)EGFRIn-frame deletion in exon 19212 bp(F) GGACTCTGGATCCCAGAAGGTGGGACTCTGGA TCCCAGAAGG TGAGAAAGTTAAAATTCCCG TCGCTATCAA GGAATTAAGA(R) CATTTAGGATGTGGAGATGAGCGAAGCAACAT CTCCGAAAGC CAACAAGGAAATCCTCGAT (19JWTF)EGFRPoint mutation in exon 21 at L858161 bp(F) GGCATGAACTACTTGGAGGACCTTACTTTGC CTCCTTCTGC ATGGTATTCTTTCTCTTCCG CACCCAGCAG *******AGC(R) CTTACTTTGCCTCCTTCTGCATGCCAAAATCTG TGATCTTGAC ATGCTGCG(7R)CTTACTTTGC CTCCTTCTGC ATGGTATTCTTTCTCTTCC* ********** *******AGCCCAAAATCTG TGATCTTGAC ATGCTGCG(18R)BRAFPoint mutation in exon 15 at V600157 bp(F) ATTTCTTCATGAAGACCTCACAGATTTCTTCAT GAAGACCTCA CAGTAAAAATAGGTGATTTT GGTCTAGCTA CAGT******(R) GGCCAAAAATTTAATCAGTGGA***ATGGAGT GGGTCCCATC AGTTTG(9F)NRASPoint mutation at 061149 bp(F) GTGAAACCTGTTTGTTGGACGTGAAACCTG TTTGTTGGAC ATACTGGATACAGCTGGACA ********** AGTGCCATGA(R) CCTGTAGAGGTTAATATCCGGAGACCAATA CATGAGGACA GG (10K)† (F), forward primers; (R), reverse primers.‡* deleted nucleotides; underlined nucleotides indicate the hot spots of mutations to be detected. Open table in a new tab Figure 3Detection of deletion mutations in EGFR exon 19 with LH-MSA. A: Schematic representation of loop-hybrids (LH) generated by the normal LH-G probe (Np) hybridized to the anti-sense strands of the PCR products of deleted mutant alleles. Homoduplexes of the deleted mutants are reproduced in LH-MSA by extension of the PCR primer (p) hybridized to the sense strands of the PCR products. The symbols are the same as in Figure 1A. B: LH-MSA of PCR products from the plasmid clones of deletion mutant alleles G1 to G7 (lanes 1 to 7) and of the normal allele (N) treated with the normal LH-G probe 19JWTF. C: Partial nucleotide sequences of the deletion mutants (G1 to G7) and the normal allele (N) of EGFR exon 19, as well as the corresponding normal amino acid sequence. Deleted nucleotides are indicated by dots, and nucleotide displacements are underlined. Incidences of the single deleted mutations in 118 cases of lung adenocarcinoma are shown in parentheses.View Large Image Figure ViewerDownload Hi-res image Download (PPT) PCR products subjected to LH-F steps in the presence of LH-G probes were separated by electrophoresis in a native 10% polyacrylamide gel (6 cm × 6 cm preformed compact gels; ATTO Inc., Tokyo, Japan) in Tris-glycine buffer (37.5 mmol/L Tris, 288 mmol/L glycine) at 20 mA for 30 minutes at room temperature. Using a native 8% polyacrylamide gel in TBE buffer (89 mmol/L Tris, 89 mmol/L boric acid, 2 mmol/L ethylenediaminetetraacetic acid), electrophoresis of the loop-hybrid DNA performed at 10 mA for 1 hour at room temperature yielded equivalent results. After electrophoresis, gels were stained for 10 minutes with SYBER Green I (Cambrex Bio Science, Rockland, ME) diluted to 1/10,000 in distilled water and placed in deionized water to remove excess dye. After the staining, DNA was detected with a laser-scanning imager (STORM860; GE Health Care Bio-Science) using 450-nm excitation and a 520-nm long path filter. A 100-bp ladder (Promega, Madison, WI) was used to distinguish the bands of loop-hybrid DNA showing retarded migration from the homoduplex bands showing size-dependent migration. Plasmid clones of PCR products from the L858R mutant and normal alleles of EGFR exon 21 were mixed together at mutant to normal ratios ranging from 1 to 0.05. After PCR of these mixed samples with Accuprime Taq High Fidelity (Invitrogen), an aliquot was examined directly with LH-MSA using the 18R LH-G probe to determine the sensitivity of mutation detection and the remaining portion was used for TOPO-TA ligation and cloning as described above. Forty-eight to ninety-six bacterial clones were genotyped with LH-MSA using the 18R LH-G probe to estimate copy numbers of the mutant allele in PCR products from the mixed samples. No mutant was found in the 48 clones of the normal control. Dideoxy sequencing of the mixed plasmid DNA was performed as described above. For simple and easy detection of the point mutation at L858 in EGFR exon 21, a method similar to the universal heteroduplex generator technology15Wood N Standen G Hows J Bradley B Bidwell J Diagnosis of sickle-cell disease with a universal heteroduplex generator.Lancet. 1993; 342: 1519-1520Abstract PubMed Scopus (17) Google Scholar16Wood N Tyfield L Bidwell J Rapid classification of phenylketonuria genotypes by analysis of heteroduplexes generated by PCR-amplifiable synthetic DNA.Hum Mutat. 1993; 2: 131-137Crossref PubMed Scopus (26) Google Scholar17Belli C De Brasi C Larripa I Rapid detection of exon 1 NRAS gene mutations using universal heteroduplex generator technology.Hum Mutat. 2003; 21: 132-137Crossref PubMed Scopus (5) Google Scholar18Belli C Bowen D De Brasi C Larripa I A single, multiplex analysis for all relevant activating NRAS gene mutations using heteroduplex generators.Br J Haematol. 2004; 126: 602-605Crossref PubMed Scopus (3) Google Scholar was developed. As illustrated in Figure 1A, the heteroduplex with a loop (hereafter referred to as loop-hybrid) can be generated by hybridization of the PCR product from EGFR exon 21 with a synthetic oligonucleotide (LH-G probe) having a stretch of nucleotides deleted adjacent to the mutation hotspot at L858. A series of LH-G probes expected to generate loops of various nucleotide lengths (Figure 1B) was examined. Migration of the loop-hybrids in PAGE was markedly retarded compared to the size-dependent migration of the homoduplex, and the degree of retarded mobility depended on the size of loop in the loop-hybrid (Figure 1, B and C). The loop-hybrid band of the mutant allele was markedly shifted from that of the normal allele when the same LH-G probe was used (Figure 1B). The shift was particularly pronounced for the LH-G probes 4R, 7R, 14R, and 18R. Faint secondary bands were visible beside the major LH band when the LH-G probes 3R, 6R, and 8R were used. DNA from the retarded bands excised from the gel was amplified with PCR and cloned into plasmids. When these clones were sequenced, both the original PCR fragment and the derivative of the LH-G probe used to generate the loop-hybrid were identified (data not shown), confirming our model (Figure 1A). When the faint secondary band produced by LH-G probe 8R was similarly analyzed, a mutation (one base deletion five bases upstream of the internally deleted site) was detected in the sequence corresponding to the 8R LH-G probe, whereas the expected sequence of 8R was found in the main loop-hybrid band. Therefore, the faint secondary band seemed to be generated by a contaminating mutant form of the 8R LH-G probe. Purification of LH-G probes with PAGE may be necessary to reduce such inadvertent contaminants. The LH-G probes 7R and 18R showed single, discrete loop-hybrid bands, well distinguishing the mutant from the normal allele and distinctly separated from the homoduplex band. Therefore, these LH-G probes were adopted in the following LH-MSA analysis to detect the L858R mutation in EGFR exon 21. Heterozygous mutations are detected as the double bands of the normal and the shifted mutant loop-hybrid bands. DNA prepared from fresh lung adenocarcinoma tumor tissues was screened for the L858R mutation using LH-MSA (Figure 2A). The expected double bands for the putatively heterozygous mutation were clearly shown for 3 of 16 examined cases. The L858R mutation in these three cases was confirmed by direct sequencing. For comparison DNA from FFPE tissues of 50 cases in pathological archives of operated lung adenocarcinoma were analyzed by LH-MSA and by direct sequencing. PCR products from those cases in which mutations were detected by LH-MSA were cloned in plasmids and screened with LH-MSA, and mutant clones were sequenced. As summarized in Table 2, 26% of the cases (13 of 50) exhibited the L858R mutation. Nine of these were consistent with the direct sequencing results, but the remaining four were not confirmed because of insufficient quality of the direct sequence data. One mutation (2%) other than L858R was detected by LH-MSA and determined to be A859T by sequence analysis of the mutant clone and by the direct sequencing. When FFPE tissue DNA from an additional 68 lung adenocarcinoma cases was examined by LH-MSA, the mutation L858R was again observed at a high frequency (27.9%, Table 2). Mutations other than L858R (L861R) were detected at a low frequency (2.9%, 2 of 68) by LH-MSA and sequence analysis of the mutant clones. One of the rare mutations (L861R) produced a mutant loop-hybrid band that shifted differently from that of L858R (Figure 2B). These rare mutations were close in proximity to L858 (Figure 2C). In the present analysis, the mutational state of EGFR exon 21 at L858 was diagnosed by LH-MSA with a high accuracy of 97.5%, taking into account mutations other than L858R (2.5%). Mutations other than L858R that were undetected by LH-MSA could occur, but their presence was not verified in this study.Table 2Point Mutations in EGFR Exon 21 Detected by LH-MSA in FFPE Tissue DNA from Lung AdenocarcinomasExperiment 1Experiment 2TotalGenotype of EGFR exon 21LH-MSA (%)Direct sequence (%)LH-MSA (%)LH-MSA (%)Normal36 (72)35 (70)47 (69.1)83 (70.3)L858R13 (26)9 (18)19 (27.9)32 (27.1)A859T1 (2)1 (2)1 (0.8)L861R2 (2.9)2 (1.7)Undetermined5 (10)Total505068118 Open table in a new tab LH-MSA may be used semiquantitatively, as shown in Figure 2D. The mutant allele in the mixed sample at the mutant to normal ratio 0.05 (0.08 by the observed ratio) was detected with LH-MSA but not detected by dideoxy sequencing (data not shown). Our results show that LH-MSA was able to detect a mutant allele comprising 7.5% of the total DNA, suggesting that tumor cells with a heterozygous mutation that comprise 15% of the total cell mixture might be detected by LH-MSA. In-frame deletion mutations in EGFR exon 19 involving 9 to 18 bases (including the overlapping region L747 to E749; Figure 3C) were detected frequently in lung adenocarcinoma.5Arao T Fukumoto H Takeda M Tamura T Saijo N Nishio K Small in-frame deletion in the epidermal growth factor receptor as a target for ZD6474.Cancer Res. 2004; 64: 9101-9104Crossref PubMed Scopus (114) Google Scholar6Lynch T Bell D Sordella R Gurubhagavatula S Okimoto R Brannigan B Harris P Haserlat S Supko J Haluska F Louis D Christiani D Settleman J Haber D Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib.N Engl J Med. 2004; 350: 2129-2139Crossref PubMed Scopus (10037) Google Scholar7Marchetti A Martella C Felicioni L Barassi F Salvatore S Chella A Camplese P Iarussi T Mucilli F Mezzetti A Cuccurullo F Sacco R Buttitta F EGFR mutations in non-small-cell lung cancer: analysis of a large series of cases and development of a rapid and sensitive method for diagnostic screening with potential implications on pharmacologic treatment.J Clin Oncol. 2005; 23: 857-865Crossref PubMed Scopus (776) Google Scholar8Paez J Janne P Lee J Tracy S Greulich H Gabriel S Herman P Kaye F Lindeman N Boggon T Naoki K Sasaki H Fujii Y Eck M Sellers W Johnson B Meyerson M EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy.Science. 2004; 304: 1497-1500Crossref PubMed Scopus (8492) Google Scholar9Pao W Miller V Zakowski M Doherty J Politi K Sarkaria I Singh B Heelan R Rusch V Fulton L Mardis E Kupfer D Wilson R Kris M Varmus H EGF receptor gene mutations are common in lung cancers from “never smokers” and are associated with sensitivity of tumors to gefitinib and erlotinib.Proc Natl Acad Sci USA. 2004; 101: 13306-13311Crossref PubMed Scopus (3890) Google Scholar For heterozygous deletion mutations, heteroduplexes between the normal and the deleted mutant alleles of the PCR product were detected in PAGE as a pair of retarded mobility bands easily distinguishable from the homoduplex band showing size-dependent migration (data not shown). LH-MSA was adapted to detect not only heterozygous but also mono-allelic deletion mutations (Figure 3A). Namely, a normal oligonucleotide, 19JWTF, was added as the LH-G probe to the PCR products from plasmid clones of several deleted mutant alleles and hybridized using LH-F steps. Analysis of these reaction products in PAGE revealed various retarded mobility bands of loop-hybrids at specific positions for each of the deleted mutant alleles (Figure 3B). No retarded mobility band was observed for the PCR product of the normal allele treated with this LH-G probe. Using this LH-MSA adapted for the detection of deletion mutations in EGFR exon 19, 49 deletion mutations (41.5%) were detected in DNA samples from FFPE tumor tissues of 118 lung adenocarcinoma cases and these deletions were confirmed by sequencing the cloned mutants. Although most of the cases (45 of 49, 92%) were uniquely associated with one of the deletion mutations shown in Figure 3C, composite mutations of two different in-frame deletions were also found after sequencing mutant clones. They were composed of G1 and G2 (two cases), G1 and G3 (one case), and G1 and G4 (one case) (Figure 3C). These observations implicated multiple mutations in these tumor cases. The kinase-activating mutation V600E in BRAF was shown to occur at high frequencies in papillary thyroid carcinoma,19Cohen Y Xing M Mambo E Guo Z Wu G Trink B Beller U Westra W Ladenson P Sidransky D BRAF mutation in papillary thyroid carcinoma.J Natl Cancer Inst. 2003; 95: 625-627Crossref PubMed Scopus (785) Google Scholar20Kimura E Nikiforova M Zhu Z Knauf J Nikiforov Y Fagin J High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma.Cancer Res. 2003; 63: 1454-1457PubMed Google Scholar21Xu X Quiros R Gattuso P Ain K Prinz R High prevalence of BRAF gene mutation in papillary thyroid carcinomas and thyroid tumor cell lines.Cancer Res. 2003; 63: 4561-4567PubMed Google Scholar whereas the activating mutation at Q61 in NRAS is prevalent in follicular thyroid carcinoma.22Vasko V Ferrand M Di Cristofaro J Carayon P Henry J de Micco C Specific pattern of RAS oncogene mutations in follicular thyroid tumors.J Clin Endocrinol Metab. 2003; 88: 2745-2752Crossref PubMed Scopus (240) Google Scholar,23Nikiforova M Lynch R Biddinger P Alexander E Dorn IIG Tallini G Kroll T Nikiforov Y RAS point mutations and PAX8-PPAR gamma rearrangement in thyroid tumors: evidence for distinct molecular pathways in thyroid follicular carcinoma.J Clin Endocrinol Metab." @default.
• W2023576480 created "2016-06-24" @default.
• W2023576480 creator A5013873963 @default.
• W2023576480 creator A5017547327 @default.
• W2023576480 creator A5018139084 @default.
• W2023576480 creator A5040876838 @default.
• W2023576480 creator A5042372860 @default.
• W2023576480 creator A5045083915 @default.
• W2023576480 creator A5056982885 @default.
• W2023576480 creator A5066700761 @default.
• W2023576480 creator A5071736888 @default.
• W2023576480 creator A5075007744 @default.
• W2023576480 creator A5076512316 @default.
• W2023576480 creator A5080015561 @default.
• W2023576480 creator A5080098656 @default.
• W2023576480 date "2006-09-01" @default.
• W2023576480 modified "2023-10-01" @default.
• W2023576480 title "Rapid and Simple Detection of Hot Spot Point Mutations of Epidermal Growth Factor Receptor, BRAF, and NRAS in Cancers Using the Loop-Hybrid Mobility Shift Assay" @default.
• W2023576480 cites W1679065037 @default.
• W2023576480 cites W1819015028 @default.
• W2023576480 cites W1933537883 @default.
• W2023576480 cites W1982669023 @default.
• W2023576480 cites W1983517741 @default.
• W2023576480 cites W1989121777 @default.
• W2023576480 cites W2011840673 @default.
• W2023576480 cites W2018581324 @default.
• W2023576480 cites W2023029702 @default.
• W2023576480 cites W2037268137 @default.
• W2023576480 cites W2039045990 @default.
• W2023576480 cites W2043696829 @default.
• W2023576480 cites W2071937923 @default.
• W2023576480 cites W2079478551 @default.
• W2023576480 cites W2087916660 @default.
• W2023576480 cites W2093778213 @default.
• W2023576480 cites W2100478222 @default.
• W2023576480 cites W2103535380 @default.
• W2023576480 cites W2121566802 @default.
• W2023576480 cites W2125195105 @default.
• W2023576480 cites W2130482724 @default.
• W2023576480 cites W2132888849 @default.
• W2023576480 cites W2139236349 @default.
• W2023576480 cites W2140626630 @default.
• W2023576480 cites W2159370558 @default.
• W2023576480 cites W2161821474 @default.
• W2023576480 cites W2163188200 @default.
• W2023576480 cites W2171003891 @default.
• W2023576480 cites W2171620774 @default.
• W2023576480 cites W2324850882 @default.
• W2023576480 doi "https://doi.org/10.2353/jmoldx.2006.060030" @default.
• W2023576480 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1867624" @default.
• W2023576480 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16931592" @default.
• W2023576480 hasPublicationYear "2006" @default.
• W2023576480 type Work @default.
• W2023576480 sameAs 2023576480 @default.
• W2023576480 citedByCount "45" @default.
• W2023576480 countsByYear W20235764802012 @default.
• W2023576480 countsByYear W20235764802013 @default.
• W2023576480 countsByYear W20235764802014 @default.
• W2023576480 countsByYear W20235764802015 @default.
• W2023576480 countsByYear W20235764802016 @default.
• W2023576480 countsByYear W20235764802017 @default.
• W2023576480 countsByYear W20235764802018 @default.
• W2023576480 countsByYear W20235764802019 @default.
• W2023576480 countsByYear W20235764802020 @default.
• W2023576480 countsByYear W20235764802021 @default.
• W2023576480 countsByYear W20235764802022 @default.
• W2023576480 crossrefType "journal-article" @default.
• W2023576480 hasAuthorship W2023576480A5013873963 @default.
• W2023576480 hasAuthorship W2023576480A5017547327 @default.
• W2023576480 hasAuthorship W2023576480A5018139084 @default.
• W2023576480 hasAuthorship W2023576480A5040876838 @default.
• W2023576480 hasAuthorship W2023576480A5042372860 @default.
• W2023576480 hasAuthorship W2023576480A5045083915 @default.
• W2023576480 hasAuthorship W2023576480A5056982885 @default.
• W2023576480 hasAuthorship W2023576480A5066700761 @default.
• W2023576480 hasAuthorship W2023576480A5071736888 @default.
• W2023576480 hasAuthorship W2023576480A5075007744 @default.
• W2023576480 hasAuthorship W2023576480A5076512316 @default.
• W2023576480 hasAuthorship W2023576480A5080015561 @default.
• W2023576480 hasAuthorship W2023576480A5080098656 @default.
• W2023576480 hasBestOaLocation W20235764801 @default.
• W2023576480 hasConcept C104317684 @default.
• W2023576480 hasConcept C170493617 @default.
• W2023576480 hasConcept C176944494 @default.
• W2023576480 hasConcept C21790070 @default.
• W2023576480 hasConcept C2779438470 @default.
• W2023576480 hasConcept C2781187634 @default.
• W2023576480 hasConcept C501734568 @default.
• W2023576480 hasConcept C502942594 @default.
• W2023576480 hasConcept C54355233 @default.
• W2023576480 hasConcept C86803240 @default.
• W2023576480 hasConceptScore W2023576480C104317684 @default.
• W2023576480 hasConceptScore W2023576480C170493617 @default.
• W2023576480 hasConceptScore W2023576480C176944494 @default.
• W2023576480 hasConceptScore W2023576480C21790070 @default.
• W2023576480 hasConceptScore W2023576480C2779438470 @default.
• W2023576480 hasConceptScore W2023576480C2781187634 @default.
• W2023576480 hasConceptScore W2023576480C501734568 @default.

• next