FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023603171> ?p ?o ?g. }

• W2023603171 endingPage "21216" @default.
• W2023603171 startingPage "21210" @default.
• W2023603171 abstract "A 5.4-kilobase mRNA, the expression of which is down-regulated after treatment of human peripheral blood mononuclear cells (PBMCs) with various T cell-activating agents, was isolated using an mRNA differential display method. Nucleotide sequence analysis identified the 5′ end of this RNA as human retinoid receptor RXRα mRNA. Here, we report the nucleotide sequence of 3.6 kilobases of this RNA, which represents the 3′ end of RXRα mRNA, the sequence of which has not been previously described. Activated PBMCs also expressed lower levels of RXRα protein, and a DNA binding assay showed that the activation-induced loss of RXRα mRNA and protein expression correlated with the loss of DNA binding activity of this protein. We present evidence that the transition from G0/G1 to S phase of the cell cycle results in the down-regulation of RXRα expression and that cell cycle inhibitors, which block the cells in G1 phase, prevent this down-regulation. The decrease in the levels of RXRα mRNA was found to be regulated at the post-transcriptional level and involved new protein synthesis. These observations indicate that the levels of RXRα expression in T lymphocytes are coupled to cell cycle progression, and there is tight regulatory control of RXRα expression during the transition from G0/G1 to S phase of the cell cycle. A 5.4-kilobase mRNA, the expression of which is down-regulated after treatment of human peripheral blood mononuclear cells (PBMCs) with various T cell-activating agents, was isolated using an mRNA differential display method. Nucleotide sequence analysis identified the 5′ end of this RNA as human retinoid receptor RXRα mRNA. Here, we report the nucleotide sequence of 3.6 kilobases of this RNA, which represents the 3′ end of RXRα mRNA, the sequence of which has not been previously described. Activated PBMCs also expressed lower levels of RXRα protein, and a DNA binding assay showed that the activation-induced loss of RXRα mRNA and protein expression correlated with the loss of DNA binding activity of this protein. We present evidence that the transition from G0/G1 to S phase of the cell cycle results in the down-regulation of RXRα expression and that cell cycle inhibitors, which block the cells in G1 phase, prevent this down-regulation. The decrease in the levels of RXRα mRNA was found to be regulated at the post-transcriptional level and involved new protein synthesis. These observations indicate that the levels of RXRα expression in T lymphocytes are coupled to cell cycle progression, and there is tight regulatory control of RXRα expression during the transition from G0/G1 to S phase of the cell cycle. During the physiological response to antigens, T cells are activated through the interaction of the processed antigen with the TCR·CD3 complex, resulting in a complex signaling pathway that culminates in cellular proliferation and a specific immune response. The activation of T cells is a highly regulated process, which involves transcriptional control of many genes (1Ullman K.S. Northrop J.P. Verweij C.L. Crabtree G.R. Annu. Rev. Immunol. 1990; 8: 421-452Crossref PubMed Scopus (491) Google Scholar). Among the well characterized pathways of TCR 1The abbreviations used are: TCRT cell receptorPBMCperipheral blood mononuclear cellDD-RT-PCRdifferential display reverse transcription polymerase chain reactionRARretinoic acid receptorRXRretinoid X receptorRACErapid amplification of cDNA endsIONionomycinRAPrapamycinCsAcyclosporin APMAphorbol 12-myristate 13-acetatePHAphytohemagglutininEMSAelectrophoretic mobility shift assayPBSphosphate-buffered salineAct Dactinomycin DCHXcycloheximidekbkilobase(s)MOPS4-morpholinepropanesulfonic acidGAPDHglyceraldehyde-3-phosphate dehydrogenaseIL2interleukin 2ConAconcanavalin A. signaling are the activation of protein kinase C and the increase in the intracellular calcium levels (2Berridge M.J. Irvine R.F. Nature. 1984; 312: 315-321Crossref PubMed Scopus (4254) Google Scholar, 3Imboden J. Weiss A. Stobo J. Immunol. Today. 1985; 6: 328-331Abstract Full Text PDF PubMed Scopus (69) Google Scholar), both of which are involved in the transcriptional control of several genes. The genes that are activated early in T cell activation include IL2, IL2 receptor, and the proto-oncogenes c-fos and c-myc (1Ullman K.S. Northrop J.P. Verweij C.L. Crabtree G.R. Annu. Rev. Immunol. 1990; 8: 421-452Crossref PubMed Scopus (491) Google Scholar). T cell receptor peripheral blood mononuclear cell differential display reverse transcription polymerase chain reaction retinoic acid receptor retinoid X receptor rapid amplification of cDNA ends ionomycin rapamycin cyclosporin A phorbol 12-myristate 13-acetate phytohemagglutinin electrophoretic mobility shift assay phosphate-buffered saline actinomycin D cycloheximide kilobase(s) 4-morpholinepropanesulfonic acid glyceraldehyde-3-phosphate dehydrogenase interleukin 2 concanavalin A. Antibodies against a number of T cell surface molecules have been shown to induce T cell activation. Among these are CD3, TCR αβ, CD2, Thy-1, and Ly-6 (4Van Wauwe J. De Mey J. Goossens J. J. Immunol. 1980; 124: 2708-2713PubMed Google Scholar, 5Chang T. Kung P.C. Gingras S. Goldstein G. Proc. Natl. Acad. Sci. U. S. A. 1981; 78: 1805-1808Crossref PubMed Scopus (279) Google Scholar, 6von Wussow P. Platsoucas C.D. Wiranowska- Stewart M. Stewart, II W.E. J. Immunol. 1981; 127: 1197-2000PubMed Google Scholar, 7Kurrle R. Schorlemmer C. Shearman L. Lauffer L. Frank K. Kanzy E.J. Seiler F.R. Transplant. Proc. 1991; 23: 272-276PubMed Google Scholar, 8Meuer S.C. Hussey R.E. Fabbi M. Fox D. Acuto O. Fitzgerald K.A. Hodgon J.L. Potentis J.P. Schlossman S.F. Reinherz E.L. Cell. 1984; 36: 897-906Abstract Full Text PDF PubMed Scopus (921) Google Scholar, 9Coligan J.E. Kruisbeek A.M. Margulies D.H. Shevach E.M. Strober W. Current Protocols in Immunology. Vol. 2. John Wiley & Sons, Inc., New York1992: 7.10.1-7.10.10Google Scholar). The activation of resting peripheral blood T cells by TCR·CD3 ligation can be mimicked by treatment with phorbol myristate and ionomycin (ION), which induce protein kinase C activation and an increase in the intracellular calcium pool (10Lindsten T. June C.H. Thompson C.B. EMBO J. 1988; 7: 2787-2794Crossref PubMed Scopus (67) Google Scholar). In addition, lectins like phytohemagglutinin (PHA) or concanavalin A can induce T cell activation in normal peripheral blood T cells (9Coligan J.E. Kruisbeek A.M. Margulies D.H. Shevach E.M. Strober W. Current Protocols in Immunology. Vol. 2. John Wiley & Sons, Inc., New York1992: 7.10.1-7.10.10Google Scholar). Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are a group of nuclear receptors involved in retinoic acid-mediated gene activation (11Mangelsdorf D.J. Man J. Kliewer S.A. Kakizuka A. Umesono K. Evans R.M. Recent Prog. Horm. Res. 1993; 48: 99-121Crossref PubMed Google Scholar, 12Mangelsdorf D.J. Evans R.M. Cell. 1995; 83: 841-850Abstract Full Text PDF PubMed Scopus (2843) Google Scholar). After ligand binding, these receptors exert their action by binding, as homodimers or heterodimers, to specific sequences in the promoters of target genes and regulate their transcription. Retinoid receptor functions can also be mediated by a pathway that does not require receptor-DNA interaction. This mechanism involves interaction of nuclear receptors and the transcription factor AP-1 (c-Jun/c-Fos), which results in the inhibition of AP-1 activity (13Pfahl M. Endocr. Rev. 1993; 14: 651-658Crossref PubMed Scopus (447) Google Scholar). Recent studies have shown that retinoic acid inhibits activation-induced apoptosis in T cell hybridomas and thymocytes, and RXRs may have a role in this protection (14Iwata M. Mukai M. Nakai Y. Iseki R. J. Immunol. 1992; 149: 3302-3308PubMed Google Scholar, 15Yang Y. Vacchio M.S. Ashwell J.D. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6170-6174Crossref PubMed Scopus (124) Google Scholar, 16Yang Y. Mercep M. Ware C.F. Ashwell J.D. J. Exp. Med. 1995; 181: 1673-1682Crossref PubMed Scopus (206) Google Scholar, 17Bissonnette R.P. Brunner T. Lazarchik S.B. Yoo N.M. Boehm M.F. Green D.R. Heyman R.A. Mol. Cell. Biol. 1995; 15: 5576-5585Crossref PubMed Scopus (106) Google Scholar). To understand the molecular basis of T cell activation, the analysis of changes in gene expression after activation is of prime importance. We are interested in the identification of genes that are involved in T cell activation, proliferation, and cell death. A recently described PCR-based method called differential display PCR (18Liang P. Pardee A.B. Science. 1992; 257: 967-971Crossref PubMed Scopus (4707) Google Scholar, 19Welsh J. Chada K. Dalal S.S. Cheng R. Dalph D. McClelland M. Nucleic Acids Res. 1992; 20: 4965-4970Crossref PubMed Scopus (495) Google Scholar) has been used to isolate genes and study their differential expression (20McClelland M. Mathien-Daude F. Welsh J. Trends Genet. 1995; 11: 242-246Abstract Full Text PDF PubMed Scopus (202) Google Scholar, 21Shen R. Su Z-Z. Olsson C.A. Fisher P.B. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 6778-6782Crossref PubMed Scopus (107) Google Scholar, 22Liang P. Pardee A.B. Curr. Opin. Immunol. 1995; 7: 274-280Crossref PubMed Scopus (241) Google Scholar). In this report using differential display reverse transcription polymerase chain reaction (DD-RT-PCR), we describe the isolation of an approximately 5.4-kb mRNA from human PBMCs, the expression of which is down-regulated after treatment of PBMCs or purified T lymphocytes with various T cell-activating agents. Nucleotide sequence analysis reveals that the 5′ end of this mRNA (approximately 1.8 kb) is homologous to the published sequences of human RXRα, and the 3′ end (approximately 3.6 kb) does not match any sequences in the GenBank except some expressed sequence tags. We show that this 3.6-kb sequence represents the 3′ end of the human RXRα mRNA, the sequence of which has not been previously reported in the literature. We also provide evidence that the activation-induced down-regulation of expression of RXRα can be prevented by treatments that block cells in G1 phase and prevent activation and transition into the S phase of the cell cycle, indicating cell cycle regulation of RXRα expression in T cells. Human PBMCs obtained by lymphapheresis of healthy donors were purified by Histopaque (Sigma) density gradient centrifugation. PBMCs were maintained in RPMI medium (Biowhitaker, Frederick, MD) supplemented with 10 mm HEPES buffer, 2 mml-glutamine, 60 μg/ml gentamicin, and 10% fetal bovine serum (Life Technologies, Inc.). CD4+ and CD8+ T lymphocytes were isolated using Dynal beads (Dynal, Oslo, Norway). The resulting cell populations were greater than 97% CD3-positive as monitored by flow cytometry. Cells (106/ml) were treated with OKT3 (Ortho-Biotech) or anti-TCR αβ (T Cell Diagnostics, Woburn, MA) antibodies immobilized on polystyrene surfaces. Antibodies (10 μg/ml in PBS) were immobilized by incubating in polystyrene tissue culture flasks at 37 °C for 3–5 h. PHA, phorbol 12-myristate 13-acetate (PMA), and ionomycin (ION) were from Sigma and were used at 2.5 μg/ml, 10 ng/ml, and 350 ng/ml, respectively. rIL-2 (Boehringer Mannheim) was used at 20–30 units/ml. Cyclosporin A (CsA) and rapamycin (RAP) (Biomol, Plymouth, PA) were used at 2.5 and 1 μg/ml, respectively. Mimosine (Biomol) was used at 100 and 25 μg/ml for 24- and 72-h cultures, respectively. Actinomycin D (Act D) and cycloheximide (CHX) were from Sigma and were used at 2.5 and 10 μg/ml, respectively. After 65 h of incubation with different agents, cells were treated in duplicate with 1 μCi of [3H]thymidine/ml and incubated for an additional 4–6 h; the incorporation of [3H]thymidine was determined by liquid scintillation counting. DD-RT-PCR was done in duplicate with 300 and 600 ng of total RNA from untreated and OKT3-treated PBMCs using instructions and primers from a Differential Display Kit purchased from Display Systems (Los Angeles). The 5′ and 3′ ends of mRNA were isolated by using the rapid amplification of cDNA ends (RACE) procedure (23Frohman M.A. Dush M.K. Martin G.R. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 8998-9002Crossref PubMed Scopus (4341) Google Scholar) and a PromoterFinder DNA walking kit (CLONTECH). PCR products were cloned and sequenced using the ABI automatic DNA sequencer (model 377). The most updated nucleic acid data banks (GenBank and Entrez) were searched using GCG software (University of Wisconsin). RNase protection assay was performed using RiboQuant Multi-Probe RNase protection system kit purchased from Pharmingen (San Diego). The RXRα probe was generated from pNotA/T7 plasmid (5 Prime → 3 Prime) in which a 302-base pair PCR fragment of RXRα cDNA was cloned (the cDNA fragment was generated by RT-PCR using primers from the newly isolated sequence; see below). Control plasmids containing GAPDH and L32 cDNA sequences were purchased from Pharmingen. All three plasmids were transcribed in a single tube using T7 RNA polymerase according to the instructions in the kit. RNase protection was performed using total RNA, and the products were resolved in 8 m urea, 6% polyacrylamide gels. The gels were dried and scanned using a bio-imaging analyzer (Bas 1000, Fuji) and also exposed to x-ray films. The equal amount of RNA used for RT-PCR was determined from absorbance at 260 nm (A260), the intensity of the total RNA bands on an agarose gel, and bands obtained after RT-PCR of 18 S ribosomal RNA, the expression of which was not affected by any of the treatments in this study. The analysis of the PCR products was done when the reactions were in the linear range and the amount of product was directly proportional to the amount of input cDNA. This was accomplished by quantitating the product accumulation at different cycle numbers. Under the conditions described, 750–24,000 copies of RXRα DNA could be amplified in the linear range. Half a microgram of total RNA was reverse transcribed in duplicate with 200 units of Superscript II RNase H−reverse transcriptase (Life Technologies, Inc.) in the presence of 2.5 μm random hexamers. PCR was performed for 25 cycles at 94 °C for 30 s, 58 °C for 30 s, and 68 °C for 1 min in the presence of [α-32P]dCTP, and the products were electrophoresed in 6% precast polyacrylamide gels (Novex, San Diego). The gels were dried and scanned for quantitation of the PCR products using a bio-imaging analyzer (Bas 1000, Fuji). Primer pairs used for RXRα PCR were 5′-AGGGCTGGGACTGTTTCG (5000–5017), 5′-CCACGATGTTTCAGAGACAATCGTACG (5301–5275) from the newly isolated sequence, and 5′-CCATAAGGAAGGTGTCAATGG (1412–1432), 5′-AGAAGGTCTATGCGTCCTTGG (1276 -1256) from the published sequence (24Mangelsdorf D.J. Ong E.S. Dyck J.A. Evans R.M. Nature. 1990; 345: 224-229Crossref PubMed Scopus (1258) Google Scholar). The primer pair for 18 S rRNA was 5′-CGAAGACGATCAGATACCGTCGTAG (1047–1071) and 5′-GGGCATCACAGACCTGTTATTGCTC (1503–1479) (25McCallum F.S. Maden B.E.H. Biochem. J. 1985; 232: 725-733Crossref PubMed Scopus (99) Google Scholar). Primers for IL2 receptor were 5′-ATCAGCGTCCTCCTCCTGAGT (931–951) and 5′-CAAGCACAACGGATGTCTCC (1116–1097) (26Nikaido T. Shimizu A. Ishida N. Sabe H. Teshigawara K. Maeda M. Uchiyama T. Yodoi T.J. Honjo T. Nature. 1984; 311: 631-635Crossref PubMed Scopus (396) Google Scholar). 100 μg of protein were electrophoresed in a 10% NuPAGE Bis Tris gel using NuPAGE MOPS-SDS running buffer (Novex) and transferred to polyvinyldifluoride membrane using XCell blot module (Novex). The membrane was blocked with Blocker Blotto (Pierce) and treated overnight at 4 °C with 1:1000 dilution of RXRα (D-20) (Santa Cruz Biotechnology), a rabbit polyclonal antibody against a peptide corresponding to amino acids 2–21 of human RXRα, or 1:2000 dilution of a monoclonal anti-α-tubulin antibody (Sigma). Proteins were detected using the ECL Western blotting detection system from Amersham Pharmacia Biotech. The DNA binding activity of RXRs was studied by EMSA using oligonucleotides corresponding to CRBPII RXRE (AGCTTCAGGTCAGAGGTCAGAGAGCT). AP-1 binding activity was determined using the triplet AP-1 consensus sequence TGACTCATGACTCATGACTCA and the AP-1 mutant sequence CGACTCGCGACTCGCGACTCG. Sp1 binding activity was determined using the sequence ATTCGATCGGGGCGGGGCGAGC. 2–5 μg of nuclear extracts were incubated for 10 min at room temperature with 0.5 μg poly(dI-dC) in 10 mm Tris, 50 mm NaCl, 0.5 mm DTT, 0.5 mm EDTA,1 mm MgCl2, and 4% glycerol in a total volume of 10 μl followed by the addition of 1 ng of 32P end-labeled probe for 20 min at room temperature. For the competition experiment, a 50-fold excess of unlabeled probe was added before the addition of the 32P end-labeled probe. The protein-DNA complexes were resolved in a 6% DNA retardation gel (Novex). The gels were dried and scanned for quantitation using a bio-imaging analyzer (Bas 1000, Fuji) and also exposed to x-ray films. 108 cells were washed in PBS, resuspended in 1 ml of lysis buffer (10 mm Tris, pH 7.4, 3 mm CaCl2, 2 mm MgCl2, 1% Nonidet P-40) and homogenized in a Dounce homogenizer. Nuclei were pelleted, washed once, and stored in 200 μl of 10 mm Tris, pH 8.3, 40% glycerol, 5 mm MgCl2, 1 mm EDTA at −130 °C. Transcription was performed for 45 min at 30 °C with 200 μl of nuclei in the presence of 5 mm Tris, pH 8.0, 2.5 mm MgCl2, 150 mm KCl, 0.25 mm each of ATP, GTP, UTP, and 200 μCi of [α-32P]CTP (3,000 Ci/mmol). The mixture was treated with 150 units of RQ1 DNase (Promega) and incubated for another 15 min followed by treatment with 10 mg/ml proteinase K at 37 °C for 45 min. RNA was isolated using Trizol (Life Technologies, Inc.) and heated for 10 min at 95 °C before hybridization. Equivalent amounts of radioactivity were hybridized to nylon membranes on which 10 μg of various linearized and denatured plasmids were slot blotted. Hybridizations were performed for 3 days at 42 °C in 6 × SSPE, 1 × Denhardt, 0.5% SDS, 50% formamide, 50 μg/ml salmon sperm DNA and washed at 0.1 × SSPE, 0.1% SDS at 56 °C. The membranes were scanned for quantitation using a bio-imaging analyzer (Bas 1000, Fuji) and also exposed to x-ray films. For DNA content measurement, the cells were fixed in 70% ethanol on ice for 30 min, washed with PBS, and incubated with 200 units/ml DNase-free RNase for 15 min at 37 °C. Cells were stained with 50 μg/ml propidium iodide and analyzed with a Coulter flow cytometer using an argon laser. Debris and doublets were excluded by electronic gating on a cytogram drawn from the peakversus linear PI signal. Histograms of DNA content of the gated events were drawn using the Multicycle program. Electrophoretic analysis of OKT3-treated and untreated DD-RT-PCR products revealed a complex pattern of different cDNAs. A number of differentially amplified products were cloned and sequenced. One of them (designated clone 5), which was down-regulated in OKT3-treated PBMCs (Fig.1) and was not related to any known sequence in the GenBank, was further studied. Northern blot hybridization using the clone 5 cDNA probe identified this RNA as an approximately 5.4-kb RNA that was expressed in PBMCs and also in a number of human tissues like spleen, thymus, prostate, testis, ovary, small intestine, and colon (data not shown). Based on the sequence information obtained from the clone 5, 3′ and 5′ ends of this RNA were isolated using RACE. An approximately 450-base pair sequence (excluding the poly(A) tail) was identified by 3′ RACE, and 3.1 kb of cDNA sequence was obtained by 5′ RACE and 5′ genomic DNA walking, followed by RT-PCR using primers from genomic DNA sequences. Comparison of these sequences revealed that about 200 nucleotides from the 5′ end of this newly isolated cDNA were identical to human RXRα (24Mangelsdorf D.J. Ong E.S. Dyck J.A. Evans R.M. Nature. 1990; 345: 224-229Crossref PubMed Scopus (1258) Google Scholar). RXRα mRNA has been characterized as a 5.4-kb mRNA, but only about 1.8 kb of the mRNA sequence has been reported (24Mangelsdorf D.J. Ong E.S. Dyck J.A. Evans R.M. Nature. 1990; 345: 224-229Crossref PubMed Scopus (1258) Google Scholar). RT-PCR using primers from the newly isolated sequences and the published regions of RXRα yielded the expected size cDNA PCR products, and sequence analysis of these PCR products established that the newly isolated sequence was indeed the 3′ end of human RXRα mRNA. This was further confirmed by Northern blot hybridization using an RXRα cDNA probe prepared by PCR using the primers from the published RXRα cDNA sequences. This probe hybridized to the same 5.4-kb RNA as did the probe from the newly isolated sequence (data not shown). Sequence analysis of the newly isolated RNA (approximately 3.6 kb) showed two additional open reading frames designated ORF-2 (2125–2877) and ORF-3 (4260–4754), which can code for polypeptides of 251 and 165 amino acids, respectively (data not shown). Treatment of PBMCs with anti-CD3 antibodies resulted in the activation of T cells as shown by [3H]thymidine incorporation. RNase protection assay (Fig.2 A) and RT-PCR (using primers from the newly isolated sequence and from the published RXRα sequence) were used to estimate the relative levels of RXRα mRNA. There was an approximately 90% decrease in the levels of RXRα mRNA when PBMCs were treated with OKT3 for 72 h. Fig.2 B shows the kinetics of this down-regulation. The data show that there was a 70% decrease in the RXRα mRNA levels in first 24 h and, after 72 h of OKT3 treatment, a 90–95% reduction in the level of the RXRα mRNA. For comparison, cDNA samples were also amplified with IL2-receptor specific primers that served as an activation marker. To demonstrate that the down-regulation of RXRα mRNA was T cell-specific, purified CD4+/CD8+ T cells were treated with OKT3 or the combination of PMA + ION, known to induce T cell activation (10Lindsten T. June C.H. Thompson C.B. EMBO J. 1988; 7: 2787-2794Crossref PubMed Scopus (67) Google Scholar). The levels of RXRα mRNA were reduced in the purified T cells after both treatments (data not shown). Western blot analysis revealed that the OKT3-induced down-regulation of RXRα was also observed at the protein level (Fig. 3).Figure 3Expression of RXRα protein in PBMCs after OKT3 activation. PBMCs (106/ml) were treated with OKT3 in the presence or absence of CsA. After 72 h, cells were harvested, lysates were made, and 100 μg of protein were subjected to SDS-PAGE. After transfer to a membrane, RXRα protein was detected by RXRα (D-20) antibody using ECL Western blotting detection system from Amersham. Lanes 1–3 are, respectively, untreated, OKT3 treated-, and OKT3 + CsA-treated lysates. In lane 4, 12.5 μg of HeLa cell nuclear extract-phorbol (Santa Cruz Biotechnology) were loaded as a positive control for the detection of RXRα protein. The membrane was also blotted with an anti-α-tubulin antibody to demonstrate that equal amount of protein was loaded in each lane.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To investigate whether the decrease in the RXRα mRNA expression, seen after CD3 cross-linking of PBMCs, could also be achieved by stimulating cells with other known T cell-proliferating agents, we treated PBMCs with immobilized monoclonal anti-TCR αβ antibody, PMA +ION, PHA, concanavalin A, IL2, or PHA + IL2 (Fig. 4 A). RT-PCR data show that all of these treatments resulted in a decrease in RXRα mRNA levels when compared with untreated cells (Fig.4 B). The extent of RXRα mRNA down-regulation differed between the treatments. Results presented in Fig. 4 C show the relative effectiveness of different activating agents in inducing the down-regulation of RXRα mRNA expression. Retinoid receptors bind to specific DNA sequences called retinoic acid response elements (RAREs). The core motif of these RAREs is AGGTCA. Using natural and synthetic RAREs, it has been shown that RXRs preferentially bind and activate direct repeat elements in which core motifs are separated by 1 or 2 base pairs (28Mangelsdorf D.J. Umesono K. Kliewer S.A. Borgmeyer U. Ong E.S. Evans R.M. Cell. 1991; 66: 555-561Abstract Full Text PDF PubMed Scopus (525) Google Scholar, 29Rottman J.N. Windom R.L. Nadal-Ginard B. Mahadevi V. Karathanasis S.K. Mol. Cell. Biol. 1991; 11: 3814-3820Crossref PubMed Scopus (184) Google Scholar, 30Zhang X.-K. Lehman J. Hoffman B. Dawson M.I. Cameron J. Graupner G. Hermann T. Pfahl M. Nature. 1992; 358: 587-591Crossref PubMed Scopus (522) Google Scholar). To determine if the down-regulation of RXRα levels after activation were reflected in a comparable difference in DNA binding activity of this protein, the DNA binding activity was studied by EMSA using oligonucleotides corresponding to CRBPII RXRE. As can be seen from Fig.5, there is almost complete loss of DNA binding activity after the treatment of PBMCs with OKT3. When the same nuclear extracts were analyzed for AP-1 binding by EMSA, there was 6-fold increase in the AP-1 binding activity of OKT3-treated PBMCs. The levels of a constitutively expressed transcription factor Sp1 (31Briggs M.R. Kadonaga J.T. Bell S.P. Tjian R. Science. 1986; 234: 47-52Crossref PubMed Scopus (1059) Google Scholar) showed only a moderate increase (less than 2-fold) after activation, indicating that the integrity and the amount of nuclear extracts derived from activated PBMCs were comparable with that from untreated cells. These data indicate that T cell activation, which is associated with a marked increase in AP-1 binding activity, nevertheless results in the loss of RXR binding activity. Thus, activation-induced loss of RXRα mRNA and protein expression in T cells correlates with the loss of DNA binding activity of this protein. To study the fate of RXRα mRNA expression in actively proliferating human T cells, freshly isolated PBMCs were treated with PHA and IL2 for 3–4 days. The cells were washed to remove the PHA and maintained in IL2. Flow cytometry revealed that the proliferating cells were >98% CD3+ T lymphocytes. The kinetics of alteration of RXRα mRNA expression (Fig.6) showed 75% down-regulation after 4 days of PHA + IL2 treatment (when the cells had started to divide), and by day 10 when the cells were actively proliferating, the levels of RXRα mRNA had reached 10% of the levels seen in resting cells. This low level expression of RXRα mRNA was maintained throughout T cell proliferation. These results indicate that the expression of RXRα in T lymphocytes may be cell cycle-regulated. CsA inhibits T cell activation by inhibiting calcineurin (a Ca2+/calmodulin-dependent phosphatase), which, in turn, inhibits the transcription of IL2. Because the binding of IL2 to its receptor is important for the progression from the G1 to the S phase of the cell cycle (32Smith K.A. Annu. Rev. Immunol. 1984; 2: 319-333Crossref PubMed Scopus (434) Google Scholar), signaling through the IL2 receptor is inhibited in the absence of IL2, and the cells are prevented from entering into the S phase of the cell cycle. RAP does not affect the production of IL2 but does inhibit signals transmitted via the IL2 receptor at least in part by inhibiting the IL2-induced phosphorylation and activation of p70S6K(33Schreiber S.L. Cell. 1992; 70: 365-368Abstract Full Text PDF PubMed Scopus (302) Google Scholar). In the presence of RAP, IL2-stimulated T cells are blocked in G1 (34Terada N. Takase K. Papst P. Nairn A.C. Gelfand E.W. J. Immunol. 1995; 155: 3418-3426PubMed Google Scholar). To study the cell cycle regulation of RXRα expression in T cells, PBMCs were treated with OKT3 in presence of CsA or RAP. Measurement of [3H]thymidine incorporation (Fig.4 A) showed that both CsA and RAP inhibited cellular activation induced by TCR·CD3 cross-linking. This was accompanied by inhibition of activation-induced down-regulation of RXRα mRNA expression (Fig. 4 B). CsA was more effective than RAP in preventing the down-regulation of RXRα mRNA expression induced by OKT3. In addition, CsA inhibited the down-regulation of RXRα mRNA expression induced by anti-TCR αβ antibody (Fig.4 C). CsA inhibition of OKT3-induced RXRα down-regulation was completely prevented by the addition of IL2 (Fig.7 A), suggesting that IL2 may be necessary for the activation-induced decrease in RXRα. To study the possibility that the IL2 effect may be mediated by regulation of the cell cycle, we treated PBMCs with OKT3 in the presence of mimosine, a rare plant amino acid that blocks the cell cycle at the G1 phase by inhibiting eukaryotic initiation factor 5-A (eIF5-A) (35Hanauske-Abel H.M. Park H.M. Hanauske A.R. Popowicz A.M. Lalande M. Folke J.E. Biochim. Biophys. Acta. 1994; 1221: 115-124Crossref PubMed Scopus (132) Google Scholar) (Table I), either alone or in combination with IL2. As shown in Fig. 7 A, mimosine completely inhibited the OKT3-induced down-regulation of RXRα expression. IL2 had no effect in preventing this inhibition. Consistent with the inability of IL2 to release the G1 block induced by mimosine (Table I), the inhibition of RXRα down-regulation could not be prevented by treatment with IL2. These data indicate that the cell cycle block in the G1 phase accounted for the inhibition of activation-induced down-regulation induced by CsA, RAP, and mimosine. Moreover, the effect of IL2 in preventing the CsA-induced inhibition of RXRα down-regulation was correlated to the release of the CsA-induced G1 block (Table I). Further proof that the levels of RXRα are cell cycle-regulated came from the experiment in which actively dividing peripheral T lymphocytes, which express low levels of RXRα mRNA as compared with the resting cells, were treated with mimosine for 24 h. Treatment with mimosine blocked the cells in G1 phase and resulted in a marked up-regulation of RXRα mRNA. When the mimosine block was released to allow progression into the cell cycle, the levels of RXRα mRNA decreased progressively and, in 24 h after release, reached the levels seen in actively cycling untreated cells (Fig.7 B).Table ICell cycle analysis of CsA and mimosine-treated PBMCsPBMCsG0/G1G2S%Untreated94.73.22.1OKT374.34.721OKT3 + CsA97.80.31.9OKT3 + CsA + IL275.35.619.1OKT3 + mimosine95.72.12.2OKT3 + mimosine + IL294.35.70 Open table in a new tab To study the involvement of transcriptional or post-transcriptional factors in the regulation of RXRα mRNA expression during T cell activation and transition from G0/G1 to the S phase, we measured the transcription of RXRα mRNA in OKT3-treated PBMCs and mimosine-blocked and -released proliferating peripheral blood T cells, using nuclear run-on transcription assay. The results indicate (Fig. 8) that the levels of RXRα mRNA synthesis show only moderate (less than 2-fold) increase during G0/G1 block. Next, we analyzed the effect of actinomycin D and cycloheximide on the loss of RXRα mRNA levels during mimosine release. As shown in Fig.9, Act D had no effect on the kinetics of RXRα mRNA down-regulation during mimosine release. In contrast, when mimosine release was carried out in the presence of CHX, there was a marked inhibition of RXRα mRNA down-regulation. Together, these data suggest that the loss of RXRα mRNA expression during G0/G1 to S transition is partly due to the decrease in the gene transcription but is primarily a result of decreased mRNA stability. In addition, CHX may block the synthesis of post-transcriptional regulatory factor(s) capable of modulating the RXRα mRNA levels during G0/G1 to S transition.Figure 9Effect of Act D and CHX on the RXRα mRNA down-regulation during G1 to S switch. Peripheral blood T cells were treated with mimosine as described. Cells were washed to remove mimosine and maintained in IL2 in presence of Act D or CHX as described. Cells were harvested after the indicated time intervals, and RXRα mRNA was quantitated by RT-PCR. The values represent the mean of three independent experiments with standard error calculated for each value.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Although there is a growing list of genes that are known to be up-regulated after T cell activation (1Ullman K.S. Northrop J.P. Verweij C.L. Crabtree G.R. Annu. Rev. Immunol. 1990; 8: 421-452Crossref PubMed Scopus (491) Google Scholar), there are only a few that are known to be inhibited after activation (36Marth J.D. Lewis D.B. Wilson C.B. Gearn M.E. Krebs E.G. Perlmutter R.M. EMBO J. 1987; 6: 2727-2734Crossref PubMed Scopus (102) Google Scholar, 37Bhargava A.K. Li Z. Weisman S.H. Proc. Natl. Acad. Sci. 1993; 90: 10260-10264Crossref PubMed Scopus (26) Google Scholar, 38Prashar Y. Weissman S.H. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 659-663Crossref PubMed Scopus (101) Google Scholar). We have utilized the DD-RT-PCR technique to identify and analyze the genes involved in T cell activation. In this paper, we chose to characterize one such gene and have identified the newly isolated sequence as the unpublished 3′ end of the 5.4-kb human RXRα mRNA. We have shown that the activation of PBMCs resulted in the down-regulation of RXRα mRNA, protein, and DNA binding activity. The extent of RXRα mRNA down-regulation differed between the activating agents; the most effective were those that induced maximum activation. These data demonstrate that down-regulation of RXRα mRNA expression is an event associated with the T cell activation induced by a variety of stimuli, and the level of down-regulation reflects the extent of cellular activation. The finding that the low levels of RXRα are maintained throughout active T cell proliferation as compared with the resting cells is consistent with the possibility of cell cycle regulation of RXRα expression. The activation-induced down-regulation of RXRα mRNA expression was inhibited by agents that blocked the cells in G1 phase, suggesting that the cell cycle block in G1 phase accounted for such inhibition. Because IL2 prevented only the CsA but not the mimosine-induced inhibition of RXRα down-regulation by OKT3, we suspect that the IL2 effect is most likely mediated by the regulation of cell cycle (through the release of the CsA-induced G1 block). Our conclusion that the RXRα mRNA levels are cell cycle regulated is further supported by the studies on the effect of mimosine on actively dividing peripheral T lymphocytes, where large populations of cells were in S phase and RXRα levels were low. Mimosine inhibited proliferation, blocked the cells in the G1 phase, and resulted in significant up-regulation of RXRα mRNA. The release of mimosine-induced G1 block was accompanied by progression into cell cycle and a progressive loss of RXRα mRNA expression. The molecular mechanism of activation-induced down-regulation of RXRα mRNA remains unknown. The data obtained on the role of transcriptional and postranscriptional mechanisms in regulating the levels of RXRα mRNA during T cell activation and G1to S switch show that the down-regulation of RXRα mRNA is primarily the result of a decrease in the mRNA stability and partly the result of a decrease in the gene transcription; new protein synthesis is required to accomplish this. The 3′-untranslated sequence of RXRα mRNA contains a single copy of AUUUA sequence. This sequence has been identified as the mRNA instability signal involved in the mRNA decay (39Shaw G. Kamen R. Cell. 1986; 46: 659-667Abstract Full Text PDF PubMed Scopus (3124) Google Scholar). Whereas the role of this sequence in the stability of RXRα mRNA remains to be studied, this sequence alone may not account for the RXRα mRNA destabilization during G0/G1 to S switch. Together, our data indicate that the levels of RXRα expression in T lymphocytes are coupled to cell cycle progression, and there is tight regulatory control of RXRα expression during the transition from G0/G1 to S phase of the cell cycle. RXRs along with RARs have the ability to silence transcription in the absence of ligand (40Tsai M.-J. O' Malley B.W. Annu. Rev. Biochem. 1994; 63: 451-486Crossref PubMed Scopus (2702) Google Scholar). It is known that T cell activation induces expression of transcription factor AP-1 (41Makover D. Cuddy M. Yum S. Bradley K. Alpers J. Sukhatme V. Reed J.C. Oncogene. 1991; 6: 455-460PubMed Google Scholar, 42Kvanta A. Kontny E. Jondal M. Okret S. Fredholm B.B. Cell. Signalling. 1992; 4: 257-260Crossref Scopus (29) Google Scholar). Retinoid receptors regulate transcriptional activation either through receptor-DNA interactions or by inhibiting AP-1 (13Pfahl M. Endocr. Rev. 1993; 14: 651-658Crossref PubMed Scopus (447) Google Scholar). It can be speculated that the levels of RXRα in resting T lymphocytes are inhibitory to AP-1 activity and prevent AP-1-induced gene transcription and proliferation. Thus, RXRα may play an important role by providing a switch that allows operation of a signaling system that controls fine tuning of regulation of T cell proliferation. Recent data suggest that RXRs may have a role in the prevention of activation-induced apoptosis in T cell hybridomas and thymocytes (14Iwata M. Mukai M. Nakai Y. Iseki R. J. Immunol. 1992; 149: 3302-3308PubMed Google Scholar, 15Yang Y. Vacchio M.S. Ashwell J.D. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6170-6174Crossref PubMed Scopus (124) Google Scholar, 16Yang Y. Mercep M. Ware C.F. Ashwell J.D. J. Exp. Med. 1995; 181: 1673-1682Crossref PubMed Scopus (206) Google Scholar, 17Bissonnette R.P. Brunner T. Lazarchik S.B. Yoo N.M. Boehm M.F. Green D.R. Heyman R.A. Mol. Cell. Biol. 1995; 15: 5576-5585Crossref PubMed Scopus (106) Google Scholar). It has been shown that activation-induced apoptosis can be prevented by treatment with 9-cis retinoic acid, a ligand that has very high affinity for the RXR receptor (16Yang Y. Mercep M. Ware C.F. Ashwell J.D. J. Exp. Med. 1995; 181: 1673-1682Crossref PubMed Scopus (206) Google Scholar, 17Bissonnette R.P. Brunner T. Lazarchik S.B. Yoo N.M. Boehm M.F. Green D.R. Heyman R.A. Mol. Cell. Biol. 1995; 15: 5576-5585Crossref PubMed Scopus (106) Google Scholar). These findings, together with our results, point to a role of RXRs in general and RXRα in particular in the regulation of T lymphocyte activation, proliferation, and cell death. We are thankful to Ming Fan, Lysa Baginsky, Dennis O' Neill, Edward Scott, Allison Hazen, and Marjorie Bosche for their technical help; Dr. M. Baseler and his technical staff for their help in flow cytometry; Julie Metcalf for providing blood samples; and Dr. H. Clifford Lane and Dr. Robin Dewar for critically reading the manuscript and providing valuable suggestions." @default.
• W2023603171 created "2016-06-24" @default.
• W2023603171 creator A5048817987 @default.
• W2023603171 creator A5071752496 @default.
• W2023603171 creator A5089750328 @default.
• W2023603171 date "1998-08-01" @default.
• W2023603171 modified "2023-10-13" @default.
• W2023603171 title "Activation-induced Down-regulation of Retinoid Receptor RXRα Expression in Human T Lymphocytes" @default.
• W2023603171 cites W1484412481 @default.
• W2023603171 cites W1520102740 @default.
• W2023603171 cites W1605882546 @default.
• W2023603171 cites W1646722613 @default.
• W2023603171 cites W1976038149 @default.
• W2023603171 cites W1978368163 @default.
• W2023603171 cites W1987269203 @default.
• W2023603171 cites W1990529390 @default.
• W2023603171 cites W1995754186 @default.
• W2023603171 cites W2006517943 @default.
• W2023603171 cites W2007443977 @default.
• W2023603171 cites W2016620180 @default.
• W2023603171 cites W2017719948 @default.
• W2023603171 cites W2031984352 @default.
• W2023603171 cites W2032151689 @default.
• W2023603171 cites W2034425561 @default.
• W2023603171 cites W2041639550 @default.
• W2023603171 cites W2043831384 @default.
• W2023603171 cites W2057348713 @default.
• W2023603171 cites W2068770118 @default.
• W2023603171 cites W2068877244 @default.
• W2023603171 cites W2080532845 @default.
• W2023603171 cites W2083436346 @default.
• W2023603171 cites W2089798261 @default.
• W2023603171 cites W2090308278 @default.
• W2023603171 cites W2108388593 @default.
• W2023603171 cites W2115796752 @default.
• W2023603171 cites W2128840922 @default.
• W2023603171 cites W2134642581 @default.
• W2023603171 cites W2136242443 @default.
• W2023603171 cites W2172523660 @default.
• W2023603171 cites W34350150 @default.
• W2023603171 cites W4205429959 @default.
• W2023603171 cites W4233138673 @default.
• W2023603171 cites W4321835896 @default.
• W2023603171 cites W84461096 @default.
• W2023603171 doi "https://doi.org/10.1074/jbc.273.33.21210" @default.
• W2023603171 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9694878" @default.
• W2023603171 hasPublicationYear "1998" @default.
• W2023603171 type Work @default.
• W2023603171 sameAs 2023603171 @default.
• W2023603171 citedByCount "15" @default.
• W2023603171 crossrefType "journal-article" @default.
• W2023603171 hasAuthorship W2023603171A5048817987 @default.
• W2023603171 hasAuthorship W2023603171A5071752496 @default.
• W2023603171 hasAuthorship W2023603171A5089750328 @default.
• W2023603171 hasBestOaLocation W20236031711 @default.
• W2023603171 hasConcept C104317684 @default.
• W2023603171 hasConcept C128821507 @default.
• W2023603171 hasConcept C162253465 @default.
• W2023603171 hasConcept C170493617 @default.
• W2023603171 hasConcept C185592680 @default.
• W2023603171 hasConcept C2775954498 @default.
• W2023603171 hasConcept C2781121885 @default.
• W2023603171 hasConcept C55493867 @default.
• W2023603171 hasConcept C63932345 @default.
• W2023603171 hasConcept C68484354 @default.
• W2023603171 hasConcept C758759 @default.
• W2023603171 hasConcept C86339819 @default.
• W2023603171 hasConcept C86803240 @default.
• W2023603171 hasConcept C95444343 @default.
• W2023603171 hasConceptScore W2023603171C104317684 @default.
• W2023603171 hasConceptScore W2023603171C128821507 @default.
• W2023603171 hasConceptScore W2023603171C162253465 @default.
• W2023603171 hasConceptScore W2023603171C170493617 @default.
• W2023603171 hasConceptScore W2023603171C185592680 @default.
• W2023603171 hasConceptScore W2023603171C2775954498 @default.
• W2023603171 hasConceptScore W2023603171C2781121885 @default.
• W2023603171 hasConceptScore W2023603171C55493867 @default.
• W2023603171 hasConceptScore W2023603171C63932345 @default.
• W2023603171 hasConceptScore W2023603171C68484354 @default.
• W2023603171 hasConceptScore W2023603171C758759 @default.
• W2023603171 hasConceptScore W2023603171C86339819 @default.
• W2023603171 hasConceptScore W2023603171C86803240 @default.
• W2023603171 hasConceptScore W2023603171C95444343 @default.
• W2023603171 hasIssue "33" @default.
• W2023603171 hasLocation W20236031711 @default.
• W2023603171 hasOpenAccess W2023603171 @default.
• W2023603171 hasPrimaryLocation W20236031711 @default.
• W2023603171 hasRelatedWork W1810512602 @default.
• W2023603171 hasRelatedWork W1852623435 @default.
• W2023603171 hasRelatedWork W1986994198 @default.
• W2023603171 hasRelatedWork W2017719948 @default.
• W2023603171 hasRelatedWork W2019055828 @default.
• W2023603171 hasRelatedWork W2023754711 @default.
• W2023603171 hasRelatedWork W2109679303 @default.
• W2023603171 hasRelatedWork W2138096813 @default.
• W2023603171 hasRelatedWork W2396166587 @default.
• W2023603171 hasRelatedWork W4238956790 @default.
• W2023603171 hasVolume "273" @default.

• next