FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023705783> ?p ?o ?g. }

• W2023705783 endingPage "2473" @default.
• W2023705783 startingPage "2466" @default.
• W2023705783 abstract "Clumping factor A (ClfA) is a cell surface-associated protein of Staphylococcus aureus that promotes binding of this pathogen to both soluble and immobilized fibrinogen (Fg). Previous studies have localized the Fg-binding activity of ClfA to residues 221–559 within the A region of this protein. In addition, the C-terminal part of the A region (residues 484–550) has been implicated as being important for Fg binding. In this study, we further investigate the involvement of this part of ClfA in the interaction of this protein with Fg. Polyclonal antibodies generated against a recombinant protein encompassing residues 500–559 of the A region inhibited the interaction of both S. aureusand recombinant ClfA with immobilized Fg in a dose-dependent manner. Using site-directed mutagenesis, two adjacent residues, Glu526 and Val527, were identified as being important for the activity of ClfA. S. aureus expressing ClfA containing either the E526A or V527S substitution exhibited a reduced ability to bind to soluble Fg and to adhere to immobilized Fg. Furthermore, bacteria expressing ClfA containing both substitutions were almost completely defective in Fg binding. The E526A and V527S substitutions were also introduced into recombinant ClfA (rClfA-(221–559)) expressed in Escherichia coli. The single mutant rClfA-(221–559) proteins showed a significant reduction in affinity for both immobilized Fg and a synthetic fluorescein-labeled C-terminal γ-chain peptide compared with the wild-type protein, whereas the double mutant rClfA-(221–559) protein was almost completely defective in binding to either species. Substitution of Glu526 and/or Val527 did not appear to alter the secondary structure of rClfA-(221–559) as determined by far-UV circular dichroism spectroscopy. These data suggest that the C terminus of the A region may contain at least part of the Fg-binding site of ClfA and that Glu526 and Val527 may be involved in ligand recognition. Clumping factor A (ClfA) is a cell surface-associated protein of Staphylococcus aureus that promotes binding of this pathogen to both soluble and immobilized fibrinogen (Fg). Previous studies have localized the Fg-binding activity of ClfA to residues 221–559 within the A region of this protein. In addition, the C-terminal part of the A region (residues 484–550) has been implicated as being important for Fg binding. In this study, we further investigate the involvement of this part of ClfA in the interaction of this protein with Fg. Polyclonal antibodies generated against a recombinant protein encompassing residues 500–559 of the A region inhibited the interaction of both S. aureusand recombinant ClfA with immobilized Fg in a dose-dependent manner. Using site-directed mutagenesis, two adjacent residues, Glu526 and Val527, were identified as being important for the activity of ClfA. S. aureus expressing ClfA containing either the E526A or V527S substitution exhibited a reduced ability to bind to soluble Fg and to adhere to immobilized Fg. Furthermore, bacteria expressing ClfA containing both substitutions were almost completely defective in Fg binding. The E526A and V527S substitutions were also introduced into recombinant ClfA (rClfA-(221–559)) expressed in Escherichia coli. The single mutant rClfA-(221–559) proteins showed a significant reduction in affinity for both immobilized Fg and a synthetic fluorescein-labeled C-terminal γ-chain peptide compared with the wild-type protein, whereas the double mutant rClfA-(221–559) protein was almost completely defective in binding to either species. Substitution of Glu526 and/or Val527 did not appear to alter the secondary structure of rClfA-(221–559) as determined by far-UV circular dichroism spectroscopy. These data suggest that the C terminus of the A region may contain at least part of the Fg-binding site of ClfA and that Glu526 and Val527 may be involved in ligand recognition. microbial surface components recognizing adhesive matrix molecules fibrinogen clumping factor A recombinant ClfA antibodies polymerase chain reaction glutathioneS-transferase Tris-buffered saline horseradish peroxidase phosphate-buffered saline bovine serum albumin Staphylococcus aureus is an important pathogen that causes a wide spectrum of infections both in the community and in hospitalized patients, ranging from skin abscesses to more serious invasive diseases such as septic arthritis, osteomyelitis, and endocarditis. It is also a major cause of surgical wound infection and infections associated with indwelling medical devices (1Waldvogel F.A. Mandel G.L. Bennett J.E. Dolin R. Principles and Practice of Infectious Diseases. Churchill-Livingstone, Inc., New York1995: 1754-1777Google Scholar). Primarily an extracellular pathogen, S. aureus colonizes the host by adhering to components of the extracellular matrix. This process is mediated by a family of cell surface-expressed proteins called MSCRAMMs1 (2Patti J.M. Allen B.L. McGavin M.J. Höök M. Annu. Rev. Microbiol. 1994; 48: 585-617Crossref PubMed Scopus (938) Google Scholar, 3Foster T.J. Höök M. Trends Microbiol. 1998; 6: 461-501Abstract Full Text Full Text PDF PubMed Scopus (786) Google Scholar). Several MSCRAMMs of S. aureus have been identified, including those that bind to collagen, bone sialoprotein, fibronectin, and fibrinogen (Fg) (4Switalski L.M. Speziale P. Höök M. J. Biol. Chem. 1989; 264: 21080-21086Abstract Full Text PDF PubMed Google Scholar, 5Tung H. Guss B. Hellman U. Persson L. Rubin K. Ryden C. Biochem. J. 2000; 345: 611-619Crossref PubMed Scopus (120) Google Scholar, 6McDevitt D. François P. Vaudaux P. Foster T.J. Mol. Microbiol. 1994; 11: 237-248Crossref PubMed Scopus (446) Google Scholar, 7Nı́ Eidhin D. Perkins S. François P. Vaudaux P. Höök M. Foster T.J. Mol. Microbiol. 1998; 30: 245-257Crossref PubMed Scopus (327) Google Scholar, 8Signas C. Raucci G. Jönsson K. Lindgren P.E. Anantharamaiah G.M. Höök M. Lindberg M. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 699-703Crossref PubMed Scopus (309) Google Scholar, 9Jönsson K. Signas C. Müller H.P. Lindberg M. Eur. J. Biochem. 1991; 202: 1041-1048Crossref PubMed Scopus (295) Google Scholar). Fg is a 340-kDa glycoprotein that is present at a concentration of ∼9 μm in the blood. It is composed of six polypeptide chains (two Aα-, two Bβ-, and two γ-chains) that are arranged in a symmetrical dimeric structure. A key player in hemostasis, Fg mediates platelet adherence and aggregation at sites of injury. In addition, it is cleaved by thrombin to form fibrin, which is the major component of blood clots. Fg is also one of the main proteins deposited on implanted biomaterials. Clumping factor A (ClfA) was the first Fg-binding MSCRAMM of S. aureus to be identified and characterized in detail (see Fig. 1) (6McDevitt D. François P. Vaudaux P. Foster T.J. Mol. Microbiol. 1994; 11: 237-248Crossref PubMed Scopus (446) Google Scholar). This protein is the prototype of a family of staphylococcal surface proteins (Sdr protein family) characterized by the presence of a unique serine-aspartate dipeptide repeat region (R region) (see Fig.1) (6McDevitt D. François P. Vaudaux P. Foster T.J. Mol. Microbiol. 1994; 11: 237-248Crossref PubMed Scopus (446) Google Scholar, 10Josefsson E. McCrea K.W., Nı́ Eidhin D. O'Connell D. Cox J. Höök M. Foster T.J. Microbiology (Read.). 1998; 144: 3387-3395Crossref PubMed Scopus (171) Google Scholar, 11McCrea K.W. Hartford O. Davis S., Nı́ Eidhin D. Lina G. Speziale P. Foster T.J. Höök M. Microbiology (Read.). 2000; 146: 1535-1546Crossref PubMed Scopus (134) Google Scholar). ClfA has structural features that are common to many other surface proteins expressed by Gram-positive bacteria. At the N terminus is a signal sequence for Sec-dependent secretion (see Fig. 1, S), whereas the C terminus contains an LPXTG motif, a hydrophobic membrane-spanning region (M), and positively charged amino acid residues. The LPXTG motif is the target of a transpeptidase (called “sortase”) that cleaves the motif between the threonine and glycine residues and anchors the protein to the peptidoglycan cell wall (12Schneewind O. Fowler A. Faull K.F. Science. 1995; 268: 103-106Crossref PubMed Scopus (377) Google Scholar,13Mazmanian S.K. Liu G. Ton-That H. Schneewind O. Science. 1999; 285: 760-763Crossref PubMed Scopus (795) Google Scholar). The Fg-binding activity of ClfA has been localized to the N-terminal A region of this protein (see Fig. 1) (14McDevitt D. François P. Vaudaux P. Foster T.J. Mol. Microbiol. 1995; 16: 895-907Crossref PubMed Scopus (141) Google Scholar). The binding site in Fg for ClfA has been localized to the C-terminal end of the γ-chain, a site that is also recognized by the platelet integrin αIIbβ3 (15Hawiger J. Timmons S. Strong D.D. Cottrell B.A. Riley M. Doolittle R.F. Biochemistry. 1982; 21: 1407-1413Crossref PubMed Scopus (104) Google Scholar, 16Strong D.D. Laudano A.P. Hawiger J. Doolittle R.F. Biochemistry. 1982; 21: 1414-1420Crossref PubMed Scopus (42) Google Scholar, 17McDevitt D. Nanavaty T. House-Pompeo K. Bell E. Turner N. McIntire L. Foster T.J. Höök M. Eur. J. Biochem. 1997; 247: 416-424Crossref PubMed Scopus (170) Google Scholar, 18Hawiger J. Timmons S. Kloczewiak M. Strong D.D. Dolittle R.F. Proc. Natl. Acad. Sci. U. S. A. 1982; 79: 2068-2071Crossref PubMed Scopus (116) Google Scholar, 19Kloczewiak M. Timmons S. Lukas T. Hawiger J. Biochemistry. 1984; 23: 1767-1774Crossref PubMed Scopus (350) Google Scholar). Indeed, recombinant ClfA is a potent inhibitor of both Fg-mediated platelet aggregation and adherence of platelets to immobilized Fg in vitro (17McDevitt D. Nanavaty T. House-Pompeo K. Bell E. Turner N. McIntire L. Foster T.J. Höök M. Eur. J. Biochem. 1997; 247: 416-424Crossref PubMed Scopus (170) Google Scholar). As for αIIbβ3, the binding of ClfA to Fg is regulated by divalent cations, including Ca2+ and Mn2+ (20O'Connell D.P. Nanavaty T. McDevitt D. Gurusiddappa S. Höök M. Foster T.J. J. Biol. Chem. 1998; 273: 6821-6829Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar, 21Kirchhofer D. Gailit J. Ruoslahti E. Grzesiak J. Pierschbacher M.D. J. Biol. Chem. 1990; 265: 18525-18530Abstract Full Text PDF PubMed Google Scholar, 22Smith J.W. Piotrowicz R.S. Mathis D. J. Biol. Chem. 1994; 269: 960-967Abstract Full Text PDF PubMed Google Scholar). Both of these cations inhibit ClfA-mediated clumping of S. aureus in the presence of soluble Fg and the interaction of recombinant ClfA with a synthetic fluorescein-labeled C-terminal γ-chain peptide (20O'Connell D.P. Nanavaty T. McDevitt D. Gurusiddappa S. Höök M. Foster T.J. J. Biol. Chem. 1998; 273: 6821-6829Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). Consistent with this, ClfA has a putative EF-hand motif (residues 310–321) within the A region that is required both for Ca2+ regulation and ligand binding (see Fig. 1) (20O'Connell D.P. Nanavaty T. McDevitt D. Gurusiddappa S. Höök M. Foster T.J. J. Biol. Chem. 1998; 273: 6821-6829Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). Overlapping this putative EF-hand motif is another motif (YTFTDYV) that occurs in the same position in the A regions of the other members of the Sdr protein family and also in the A regions of the fibronectin-binding MSCRAMMs (FnbpA and FnbpB) of S. aureus (see Fig. 1) (10Josefsson E. McCrea K.W., Nı́ Eidhin D. O'Connell D. Cox J. Höök M. Foster T.J. Microbiology (Read.). 1998; 144: 3387-3395Crossref PubMed Scopus (171) Google Scholar). However, the function of this motif is currently unknown. In a previous study, we sought to identify the Fg-binding site within ClfA by constructing a series of recombinant truncates of the A region of this protein (14McDevitt D. François P. Vaudaux P. Foster T.J. Mol. Microbiol. 1995; 16: 895-907Crossref PubMed Scopus (141) Google Scholar). This analysis revealed that the smallest recombinant truncate that retained Fg-binding activity was composed of residues 221–550. Further truncation of either the N or C terminus of this construct resulted in the loss of Fg-binding activity, suggesting that the overall conformation of the protein is important in maintaining the integrity of the Fg-binding site. However, it was also noted that a non-Fg-binding truncate, composed of residues 332–550, retained the ability to absorb out the clumping-blocking activity of polyclonal antibodies (Abs) raised against the entire A region (residues 40–559), whereas another truncate, composed of residues 221–484, did not (14McDevitt D. François P. Vaudaux P. Foster T.J. Mol. Microbiol. 1995; 16: 895-907Crossref PubMed Scopus (141) Google Scholar). These observations raise the possibility that the C-terminal part of the A region of ClfA (between residues 484 and 500) may contain at least part of the Fg-binding site of this protein. In this study, we investigated the role of the C-terminal part of the A region in the Fg-binding activity of ClfA. We found that polyclonal antibodies raised against a recombinant ClfA truncate, composed of residues 500–559 of the A region, blocked the interaction of bothS. aureus and recombinant ClfA with immobilized Fg. In addition, using site-directed mutagenesis, we identified two adjacent residues, Glu526 and Val527, within this part of the A region that are important for the interaction of ClfA with both soluble and immobilized Fg. Escherichia coliXL-1 Blue (Stratagene) was used for plasmid cloning and protein expression. S. aureus strain RN4220 was the recipient used for introducing plasmids into S. aureus by electroporation. Plasmids were subsequently transferred to DU5941, a mutant of S. aureus strain 8325-4 lacking expression of both ClfA and protein A (strain 8325-4 clfA1::Tn917Δspa::TcR) (23Hartford O. François P. Vaudaux P. Foster T.J. Mol. Microbiol. 1997; 25: 1065-1076Crossref PubMed Scopus (119) Google Scholar). Strain DU5873, a mutant of strain Newman lacking expression of protein A (strain Newman Δspa::TcR) (14McDevitt D. François P. Vaudaux P. Foster T.J. Mol. Microbiol. 1995; 16: 895-907Crossref PubMed Scopus (141) Google Scholar) was used for the antibody inhibition studies. The shuttle plasmid pCU1 (24Augustin J. Gotz F. FEMS Microbiol. Lett. 1990; 54: 203-207Crossref PubMed Google Scholar), which confers resistance to chloramphenicol in S. aureus and ampicillin in E. coli, was used to express the wild-type and mutant ClfA proteins in strain DU5941. Plasmids pQE30 (QIAGEN Inc.) and pGEX-KG (25Guan K.L. Dixon J.E. Anal. Biochem. 1991; 192: 262-267Crossref PubMed Scopus (1641) Google Scholar) were used for recombinant protein expression. E. colistrains harboring plasmids were routinely grown in L-broth or on L-agar (26Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1972Google Scholar). S. aureus cultures were grown in trypticase soy broth or on trypticase soy agar. Ampicillin (100 μg/ml) was used for the selection of plasmids in E. coli, and chloramphenicol (10 μg/ml), erythromycin (3 μg/ml), or tetracycline (2 μg/ml) was used for selection of plasmids or chromosomal markers in S. aureus. E. coli XL-1 Blue cells were made competent by CaCl2 treatment (27Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Electrocompetent S. aureus cells were prepared by the method of Oskouian and Stewart (28Oskouian B. Stewart G.C. J. Bacteriol. 1990; 172: 3804-3812Crossref PubMed Google Scholar). The pCU1-derived plasmids were initially introduced into S. aureus strain RN4220 by electroporation (29Schenck S. Laddaga R.A. FEMS Microbiol. Lett. 1992; 73: 133-138Crossref PubMed Google Scholar) with a Gene Pulser II set at 2.3 kV, 25 microfarads, and 100 ohms in a 0.2-cm cuvette and were subsequently transduced to strain DU5941 using phage 85 (30). DNA manipulations were performed by standard procedures (27Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Plasmid DNA for cloning and sequence analysis was purified using the WizardTM Plus miniprep kit (Promega). PCR-amplified DNA was purified using the WizardTM PCR prep kit (Promega). DNA restriction and modification enzymes were purchased from Roche Molecular Biochemicals. Double-stranded plasmid DNA was sequenced by the dideoxy chain termination method (27Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) using the Taq DyeDeoxy Terminator Cycle sequencing kit and an automated sequencer (Applied Biosystems Model 373A). The PCR mixtures contained 100 ng of template DNA, 100 pmol of forward and reverse primer, 200 μm dNTP, ThermoPol reaction buffer (New England Biolabs Inc.), and 1 unit of Vent® polymerase (New England Biolabs Inc.). All reactions were carried out with a 1-min denaturation step at 94 °C, a 1-min annealing step at 50–60 °C (depending on the primer pair), and an extension time of 1 min/1 kilobase pair of DNA to be amplified. The standard cycle was repeated for 30 cycles, followed by incubation at 72 °C for 10 min. PCR amplifications were performed using a PerkinElmer Life Sciences DNA thermocycler. Restriction enzyme sites were incorporated at the 5′-end of the primers to facilitate subsequent cloning of the PCR products into the appropriate plasmid vector. A previously described PCR method was used to introduce site-directed mutations into theclfA gene (20O'Connell D.P. Nanavaty T. McDevitt D. Gurusiddappa S. Höök M. Foster T.J. J. Biol. Chem. 1998; 273: 6821-6829Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). Briefly, the shuttle plasmid expressing the mutant ClfA protein with the E526A substitution was constructed as follows. Using S. aureus strain Newman genomic DNA as template, a 915-base pair fragment of the clfA gene was amplified using the flanking primer F1 (covering the PstI site in clfA) and the internal primer R2 (incorporating aBglII site and the nucleotide mismatch required for the desired mutation) (Table I). In a second PCR, a 1135-base pair fragment of the clfA gene was amplified using the internal primer F2 (incorporating aBglII site) and the flanking primer R1 (incorporating aHindIII site) (Table I). Primer R1 was complementary to noncoding sequences 100 base pairs downstream from the clfAstop codon in the chromosome. The two PCR products were then cleaved with PstI and BglII or with BglII andHindIII, as appropriate, and ligated together at theBglII site. The mutant PstI-HindIIIclfA gene fragment was cloned into plasmid pCF77 (pCU1 carrying a copy of the wild-type clfA gene (23Hartford O. François P. Vaudaux P. Foster T.J. Mol. Microbiol. 1997; 25: 1065-1076Crossref PubMed Scopus (119) Google Scholar)), yielding plasmid pClfA(E526A). This cloning reaction was facilitated by the presence of a unique PstI site in the wild-typeclfA gene and involved replacing the wild-typePstI-HindIII clfA gene fragment in pCF77 with the mutant PstI-HindIIIclfA gene fragment. The pCF77-derived plasmids expressing the ClfA proteins with the substitutions N525A, V527S, E526A/V527S, A528V/G532A, D537A, E546A, and E559A were generated in a similar fashion using the primers indicated in Table I. The DNA sequence of each of the mutations was verified as described above.Table ISynthetic oligonucleotides for amplifying clfA gene fragments from S. aureus strain Newman genomic DNA and for site-directed mutagenesis of clfApCF77-derived mutant shuttle plasmids Flanking primers F1TATGGATCCATGGTAGCTGCAGATGGCACC R1GCCAAGCTTGTCAGTTTCAACGACTCA Internal primers pClfA(E526A) F2GGCAGATCTATGTCATGGGACAACGCAGTAGCATTT R2GGCAGATCTCCAAATTATATTCGAGTTATACCC pClfA(V527S) F3GCCGGATCCGGTTCTGGTGACGGTATCGAT R3ACCGGATCCGTTATTAAATGCTGATTCGTTGTC pClfA(E526A/V527S) F4GCCGGATCCGGTTCTGGTGACGGTATCGAT R4ACCGGATCCGTTATTAAATGCTGATGCGTTGTC pClfA(N525A) F5CCGGGATCCGGTTCTGGTGACGGTATCGATAA R5ACGGATCCGTTATTAAATGCTACTTCGGCGTCCCATG pClfA(D537A) F6GGCGGATCCGGTTCTGGTGCCGGTATCGAT R6GGCGGATCCGTTATTAAATGCTACTTCGTTGTC pClfA(E546A) F7GGCCCCGGGGAAATTGAACCAATTCCAGAGGATTC R7GCCCCCGGGCGCATCAGGTTGTTCAGGAACAAC pClfA(E559A) F8GCCCCGGGGAAATTGAACCAATTCCAGCGGATTCAG R8CGGCCCGGGCTCATCAGGTTGTTCAGGAAC pClfA(A528V/G532A) F9CAACGAAGTAGTATTTAATAACGCATCAGGTTCTGGT R9ACCAGAACCTGATGCGTTATTAAATACTACTTCGTTGTCpQE30-derived mutant expression plasmids pClfA-(221–559) (E526A) F1-ATATGGATCCATGGTAGCTGCAGATGGCACC R1-ACGCAAGCTTCTCTGGAATTGGTTCAATTTC pClfA-(221–559) (V527S) F2-ATATAGATCTGTAGCTGCAGATGGCACC R1-ACGCAAGCTTCTCTGGAATTGGTTCAATTTC pClfA-(221–559) (E526A/V527S) F2-ATATAGATCTGTAGCTGCAGATGGCACC R1-ACGCAAGCTTCTCTGGAATTGGTTCAATTTC pClfA-(221–559) (A528V/G532A) F1-ATATGGATCCATGGTAGCTGCAGATGGCACC R1-ACGCAAGCTTCTCTGGAATTGGTTCAATTTCpGST-ClfA-(500–559) expression plasmid F10GGCGGATCCGGTGATTTAGCTTTACGTTC R10CGCAAGCTTCTCTGGAATTGGTTCAATTTRestriction endonuclease sites are underlined. Open table in a new tab Restriction endonuclease sites are underlined. The E526A, V527S, E526A/V527S, and A528V/G532A substitutions were introduced into a recombinant protein composed of residues 221–559 of ClfA, called rClfA-(221–559) (previously called Clf41 (20O'Connell D.P. Nanavaty T. McDevitt D. Gurusiddappa S. Höök M. Foster T.J. J. Biol. Chem. 1998; 273: 6821-6829Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar)). To construct the plasmids expressing rClfA-(221–559) with the E526A and A528V/G532A substitutions, a 1019-base pair fragment (encoding residues 221–559) was amplified from the pCF77-derived plasmid carrying the mutant clfA gene of interest using primers F1-A (incorporating a BamHI site) and R1-A (incorporating a HindIII site) (Table I). The amplified DNA was then cleaved with BamHI and HindIII and ligated into the expression vector pQE30, which was also cleaved with these enzymes. To construct the plasmids expressing rClfA-(221–559) with the V527S and E526A/V527S substitutions, primers F2-A (incorporating a BglII site) and R1-A were used (Table I). The amplified DNA was then cleaved with BglII andHindIII and ligated into pQE30, which was cleaved withBamHI and HindIII. The DNA sequence of each of the mutations was verified as described above. Construction of the plasmid expressing wild-type rClfA-(221–559) has been described previously (20O'Connell D.P. Nanavaty T. McDevitt D. Gurusiddappa S. Höök M. Foster T.J. J. Biol. Chem. 1998; 273: 6821-6829Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). The rClfA-(221–559) proteins expressed from pQE30 contained an N-terminal extension of six histidine residues (His tag), facilitating purification by immobilized metal chelate affinity chromatography. DNA encoding residues 500–559 of the A region of ClfA was amplified by PCR with primers F10 (incorporating a BamHI site) and R10 (incorporating a HindIII site) (Table I) usingS. aureus strain Newman genomic DNA as template. The amplified product was cloned into plasmid pGEX-KG and cleaved withBamHI and HindIII, yielding plasmid pGST-ClfA-(500–559). The recombinant fusion protein expressed was called rGST-ClfA-(500–559). Cells harboring the pQE30-derived plasmids were grown, and bacterial cell lysates were prepared as described previously (20O'Connell D.P. Nanavaty T. McDevitt D. Gurusiddappa S. Höök M. Foster T.J. J. Biol. Chem. 1998; 273: 6821-6829Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). The fusion proteins containing an N-terminal His tag were purified by immobilized metal chelate affinity chromatography as described previously (31Wann E.R. Gurusiddappa S. Höök M. J. Biol. Chem. 2000; 275: 13863-13871Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar). Cells harboring plasmid pGST-ClfA-(500–559) were grown, and the rGST-ClfA-(500–559) protein was purified on a glutathione-Sepharose column as described previously (7Nı́ Eidhin D. Perkins S. François P. Vaudaux P. Höök M. Foster T.J. Mol. Microbiol. 1998; 30: 245-257Crossref PubMed Scopus (327) Google Scholar). Polyclonal Abs to rGST-ClfA-(500–559) were prepared by immunizing a New Zealand White rabbit subcutaneously with 50 μg of the recombinant protein emulsified with an equal volume of Freund's complete adjuvant. The rabbit was boosted twice over a period of 1 month with the same amount of antigen in Freund's incomplete adjuvant. The immunoglobulins were precipitated with 25% ammonium sulfate, and IgG was purified by affinity chromatography on a protein A-Sepharose 4B column (Amersham Pharmacia Biotech). SDS-polyacrylamide gel electrophoresis was performed by standard methods (32Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207538) Google Scholar). Proteins were visualized on gels by Coomassie Brilliant Blue R-250 staining. S. aureus cell wall proteins were prepared from stabilized protoplasts by digestion with lysostaphin (Ambicin L recombinant lysostaphin, Applied Microbiology) as described previously (23Hartford O. François P. Vaudaux P. Foster T.J. Mol. Microbiol. 1997; 25: 1065-1076Crossref PubMed Scopus (119) Google Scholar). For the Western immunoblot assay, released cell wall-associated proteins were transferred to polyvinylidene difluoride membranes (Roche Molecular Biochemicals) using a semidry system (Bio-Rad) as described previously (23Hartford O. François P. Vaudaux P. Foster T.J. Mol. Microbiol. 1997; 25: 1065-1076Crossref PubMed Scopus (119) Google Scholar). Remaining protein-binding sites were blocked by incubating the membranes in 5% (w/v) nonfat dry milk in Tris-buffered saline (TBS; 10 mmTris-HCl and 150 mm NaCl, pH 7.4) for 18 h at 4 °C. The ClfA proteins were detected with rabbit anti-rClfA-(40–559) polyclonal Abs (diluted 1:1000 in blocking reagent), followed by horseradish peroxidase (HRP)-conjugated protein A (diluted 1:500 in blocking reagent; Sigma). Bound protein A was detected by enhanced chemiluminescence (New England Biolabs Inc.). For the Western ligand affinity blot assay, the recombinant ClfA proteins were transferred to a polyvinylidene difluoride membrane, and the membranes were incubated with blocking reagent as described above. The membranes were then incubated with HRP-conjugated human Fg (10 μg/ml in blocking reagent), and bound protein was visualized by enhanced chemiluminescence. Human Fg (Calbiochem) was conjugated to HRP according to the manufacturer's instructions (Pierce). Bacterial cell immunoblot assays were performed as described previously (33Hartford O. McDevitt D. Foster T.J. Microbiology (Read.). 1999; 145: 2497-2505Crossref PubMed Scopus (28) Google Scholar) using S. aureus cultures grown in trypticase soy broth for 15 h at 37 °C with aeration. S. aureus strains were grown in trypticase soy broth for 15 h at 37 °C with aeration, harvested by centrifugation at 3000 × g for 10 min, and washed with phosphate-buffered saline (PBS; Oxoid Ltd.). A suspension of ∼4 × 108 colony-forming units in a 20-μl volume was added to 50 μl of 2-fold serial dilutions of human Fg (starting at 1 mg/ml) in the wells of a microtiter plate. The reciprocal of the highest dilution of Fg giving clumping after 5 min was defined as the titer. S. aureus strains were grown in trypticase soy broth for 15 h at 37 °C with aeration, harvested by centrifugation at 3000 × g, and washed with PBS. For the inhibition of bacterial adherence by the anti-rGST-ClfA-(500–559) polyclonal Abs, 2-fold serial dilutions of purified IgG in PBS were preincubated with strain DU5873 cells (∼5 × 107 colony-forming units) with shaking for 2 h at room temperature. Strain DU5873 (a protein A-deficient mutant of strain Newman) was used in this assay to prevent the nonimmune reaction between IgG and protein A. The cells were then transferred to wells in a microtiter plate (Sarstedt, Inc.) coated with human Fg (500 ng/well), and bacterial adherence was measured using crystal violet staining as described previously (23Hartford O. François P. Vaudaux P. Foster T.J. Mol. Microbiol. 1997; 25: 1065-1076Crossref PubMed Scopus (119) Google Scholar). Polyclonal Abs raised against a recombinant form of the Fg-binding region of ClfB (rGST-ClfB-(45–542)) were used as a control in this assay (7Nı́ Eidhin D. Perkins S. François P. Vaudaux P. Höök M. Foster T.J. Mol. Microbiol. 1998; 30: 245-257Crossref PubMed Scopus (327) Google Scholar). Measurement of the relative adherence of strain DU5941 (∼1 × 108 colony-forming units), expressing wild-type and mutant ClfA proteins, to immobilized human Fg was also performed using crystal violet staining as described previously (23Hartford O. François P. Vaudaux P. Foster T.J. Mol. Microbiol. 1997; 25: 1065-1076Crossref PubMed Scopus (119) Google Scholar). For the Ab inhibition studies, a recombinant His-tagged protein composed of the entire A region of ClfA, called rClfA-(40–559), was used (previously called Clf40 (20O'Connell D.P. Nanavaty T. McDevitt D. Gurusiddappa S. Höök M. Foster T.J. J. Biol. Chem. 1998; 273: 6821-6829Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar)) (see Fig. 1). The wells of microtiter plates were coated with 1 μg of human Fg (Enzyme Research Laboratories) for 18 h at 4 °C. After washing with TBS, the wells were blocked with 5% (w/v) bovine serum albumin (BSA) in TBS for 2 h at room temperature and then washed again with TBS containing 0.05% Tween 20 (TBS-T). The rClfA-(40–559) protein (10 nm) was preincubated with increasing concentrations of the polyclonal Abs in TBS containing 0.1% BSA for 1 h at room temperature. The samples were then added to the Fg-coated wells for 1 h at room temperature. The wells were washed with TBS-T, and bound protein was detected with an anti-His tag monoclonal antibody" @default.
• W2023705783 created "2016-06-24" @default.
• W2023705783 creator A5003945619 @default.
• W2023705783 creator A5041092376 @default.
• W2023705783 creator A5042138300 @default.
• W2023705783 creator A5062527254 @default.
• W2023705783 date "2001-01-01" @default.
• W2023705783 modified "2023-10-18" @default.
• W2023705783 title "Identification of Residues in the Staphylococcus aureus Fibrinogen-binding MSCRAMM Clumping Factor A (ClfA) That Are Important for Ligand Binding" @default.
• W2023705783 cites W1502280728 @default.
• W2023705783 cites W1502559266 @default.
• W2023705783 cites W1524999431 @default.
• W2023705783 cites W1563804761 @default.
• W2023705783 cites W1585648374 @default.
• W2023705783 cites W1592752082 @default.
• W2023705783 cites W1851584058 @default.
• W2023705783 cites W1937983078 @default.
• W2023705783 cites W1966070420 @default.
• W2023705783 cites W1969632860 @default.
• W2023705783 cites W1983198197 @default.
• W2023705783 cites W1988529525 @default.
• W2023705783 cites W1995105203 @default.
• W2023705783 cites W1996223704 @default.
• W2023705783 cites W2014088046 @default.
• W2023705783 cites W2015531372 @default.
• W2023705783 cites W2027657428 @default.
• W2023705783 cites W2030904449 @default.
• W2023705783 cites W2033099498 @default.
• W2023705783 cites W2039128987 @default.
• W2023705783 cites W2039939341 @default.
• W2023705783 cites W2040823934 @default.
• W2023705783 cites W2063609296 @default.
• W2023705783 cites W2065129970 @default.
• W2023705783 cites W2087967982 @default.
• W2023705783 cites W2092162118 @default.
• W2023705783 cites W2100837269 @default.
• W2023705783 cites W2105271250 @default.
• W2023705783 cites W2110190915 @default.
• W2023705783 cites W2112955530 @default.
• W2023705783 cites W2119237104 @default.
• W2023705783 cites W2141362383 @default.
• W2023705783 cites W2145788629 @default.
• W2023705783 cites W2176472482 @default.
• W2023705783 cites W4239828932 @default.
• W2023705783 cites W4253957035 @default.
• W2023705783 doi "https://doi.org/10.1074/jbc.m007979200" @default.
• W2023705783 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11044451" @default.
• W2023705783 hasPublicationYear "2001" @default.
• W2023705783 type Work @default.
• W2023705783 sameAs 2023705783 @default.
• W2023705783 citedByCount "69" @default.
• W2023705783 countsByYear W20237057832012 @default.
• W2023705783 countsByYear W20237057832013 @default.
• W2023705783 countsByYear W20237057832014 @default.
• W2023705783 countsByYear W20237057832015 @default.
• W2023705783 countsByYear W20237057832016 @default.
• W2023705783 countsByYear W20237057832017 @default.
• W2023705783 countsByYear W20237057832018 @default.
• W2023705783 countsByYear W20237057832019 @default.
• W2023705783 countsByYear W20237057832020 @default.
• W2023705783 countsByYear W20237057832021 @default.
• W2023705783 countsByYear W20237057832022 @default.
• W2023705783 crossrefType "journal-article" @default.
• W2023705783 hasAuthorship W2023705783A5003945619 @default.
• W2023705783 hasAuthorship W2023705783A5041092376 @default.
• W2023705783 hasAuthorship W2023705783A5042138300 @default.
• W2023705783 hasAuthorship W2023705783A5062527254 @default.
• W2023705783 hasBestOaLocation W20237057831 @default.
• W2023705783 hasConcept C116569031 @default.
• W2023705783 hasConcept C116834253 @default.
• W2023705783 hasConcept C170493617 @default.
• W2023705783 hasConcept C185592680 @default.
• W2023705783 hasConcept C2779036427 @default.
• W2023705783 hasConcept C2779288629 @default.
• W2023705783 hasConcept C2779489039 @default.
• W2023705783 hasConcept C523546767 @default.
• W2023705783 hasConcept C54355233 @default.
• W2023705783 hasConcept C55493867 @default.
• W2023705783 hasConcept C59822182 @default.
• W2023705783 hasConcept C86803240 @default.
• W2023705783 hasConcept C89423630 @default.
• W2023705783 hasConceptScore W2023705783C116569031 @default.
• W2023705783 hasConceptScore W2023705783C116834253 @default.
• W2023705783 hasConceptScore W2023705783C170493617 @default.
• W2023705783 hasConceptScore W2023705783C185592680 @default.
• W2023705783 hasConceptScore W2023705783C2779036427 @default.
• W2023705783 hasConceptScore W2023705783C2779288629 @default.
• W2023705783 hasConceptScore W2023705783C2779489039 @default.
• W2023705783 hasConceptScore W2023705783C523546767 @default.
• W2023705783 hasConceptScore W2023705783C54355233 @default.
• W2023705783 hasConceptScore W2023705783C55493867 @default.
• W2023705783 hasConceptScore W2023705783C59822182 @default.
• W2023705783 hasConceptScore W2023705783C86803240 @default.
• W2023705783 hasConceptScore W2023705783C89423630 @default.
• W2023705783 hasIssue "4" @default.
• W2023705783 hasLocation W20237057831 @default.
• W2023705783 hasLocation W20237057832 @default.
• W2023705783 hasOpenAccess W2023705783 @default.

• next