FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023941144> ?p ?o ?g. }

• W2023941144 endingPage "5908" @default.
• W2023941144 startingPage "5902" @default.
• W2023941144 abstract "The histone acetyltransferase GCN5 acetylates nucleosomal histones to alter gene expression. How GCN5 gains entry into the nucleus of the cell has not been determined. We have mapped a six-amino acid motif (RKRVKR) that serves as a necessary and sufficient nuclear localization signal (NLS) for GCN5 in the protozoan pathogen Toxoplasma gondii (TgGCN5). Virtually nothing is known about nucleocytoplasmic transport in these parasites (phylum Apicomplexa), and this study marks the first demonstrated NLS delineated for members of the phylum. The TgGCN5 NLS has predictive value because it successfully identifies other nuclear proteins in three different apicomplexan genomic databases. Given the basic composition of the T. gondii NLS, we hypothesized that TgGCN5 physically interacts with importin-α, the main transport receptor in the importin/karyopherin nuclear import pathway. We cloned the importin-α gene from T. gondii (TgIMPα), which encodes a protein of 545 amino acids that possesses an importin-β-binding domain and armadillo/β-catenin-like repeats. In vitro co-immunoprecipitation experiments confirm that TgIMPα directly interacts with TgGCN5, but this interaction is abolished if the TgGCN5 NLS is deleted. Taken together, these data argue that TgGCN5 gains access to the parasite nucleus by interacting with TgIMPα. Bioinformatics analysis of the T. gondii genome reveals that other components of the importin pathway are present in the organism. This study demonstrates the utility of T. gondii as a model for the study of nucleocytoplasmic trafficking in early eukaryotic cells. The histone acetyltransferase GCN5 acetylates nucleosomal histones to alter gene expression. How GCN5 gains entry into the nucleus of the cell has not been determined. We have mapped a six-amino acid motif (RKRVKR) that serves as a necessary and sufficient nuclear localization signal (NLS) for GCN5 in the protozoan pathogen Toxoplasma gondii (TgGCN5). Virtually nothing is known about nucleocytoplasmic transport in these parasites (phylum Apicomplexa), and this study marks the first demonstrated NLS delineated for members of the phylum. The TgGCN5 NLS has predictive value because it successfully identifies other nuclear proteins in three different apicomplexan genomic databases. Given the basic composition of the T. gondii NLS, we hypothesized that TgGCN5 physically interacts with importin-α, the main transport receptor in the importin/karyopherin nuclear import pathway. We cloned the importin-α gene from T. gondii (TgIMPα), which encodes a protein of 545 amino acids that possesses an importin-β-binding domain and armadillo/β-catenin-like repeats. In vitro co-immunoprecipitation experiments confirm that TgIMPα directly interacts with TgGCN5, but this interaction is abolished if the TgGCN5 NLS is deleted. Taken together, these data argue that TgGCN5 gains access to the parasite nucleus by interacting with TgIMPα. Bioinformatics analysis of the T. gondii genome reveals that other components of the importin pathway are present in the organism. This study demonstrates the utility of T. gondii as a model for the study of nucleocytoplasmic trafficking in early eukaryotic cells. Eukaryotic DNA is highly compacted in chromatin, which is largely comprised of histone proteins. Once thought to play only a scaffolding role, histones are now recognized as a critical component of gene regulation and epigenetic inheritance. Many chromatin remodeling complexes contain histone-modifying enzymes that alter the nucleosomal structure and modulate the expressed genome (1Sterner D.E. Berger S.L. Microbiol. Mol. Biol. Rev. 2000; 64: 435-459Crossref PubMed Scopus (1398) Google Scholar, 2Roth S.Y. Denu J.M. Allis C.D. Annu. Rev. Biochem. 2001; 70: 81-120Crossref PubMed Scopus (1595) Google Scholar). GCN5, originally described as a transcriptional adapter in yeast (3Georgakopoulos T. Thireos G. EMBO J. 1992; 11: 4145-4152Crossref PubMed Scopus (254) Google Scholar), was later discovered to be a histone acetyltransferase (HAT) 1The abbreviations used are: HAT, histone acetyltransferase; NLS, nuclear localization signal; βgal, β-galactosidase; contig, group of overlapping clones.1The abbreviations used are: HAT, histone acetyltransferase; NLS, nuclear localization signal; βgal, β-galactosidase; contig, group of overlapping clones. (4Brownell J.E. Zhou J. Ranalli T. Kobayashi R. Edmondson D.G. Roth S.Y. Allis C.D. Cell. 1996; 84: 843-851Abstract Full Text Full Text PDF PubMed Scopus (1282) Google Scholar). HATs covalently modify chromatin by acetylating specific lysine residues within the N-terminal tails of histones, thereby attenuating the nucleosome-DNA interaction. GCN5 and the related HAT, P/CAF (p300/CBP-associating factor), are critical for growth and development in mice (5Yamauchi T. Yamauchi J. Kuwata T. Tamura T. Yamashita T. Bae N. Westphal H. Ozato K. Nakatani Y. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 11303-11306Crossref PubMed Scopus (187) Google Scholar, 6Xu W. Edmondson D.G. Evrard Y.A. Wakamiya M. Behringer R.R. Roth S.Y. Nat. Genet. 2000; 26: 229-232Crossref PubMed Scopus (209) Google Scholar) and plants (7Vlachonasios K.E. Thomashow M.F. Triezenberg S.J. Plant Cell. 2003; 15: 626-638Crossref PubMed Scopus (249) Google Scholar). Although much study has been invested in the gene regulatory functions of GCN5s, little attention has been directed at resolving how the HAT gets into the cell nucleus. One study suggests that P/CAF requires importin-α for nuclear localization, but the precise mechanism of the interaction was not determined (8Kohler M. Speck C. Christiansen M. Bischoff F.R. Prehn S. Haller H. Gorlich D. Hartmann E. Mol. Cell. Biol. 1999; 19: 7782-7791Crossref PubMed Google Scholar). Importin-α proteins serve as adaptors that bind both the nuclear-destined cargo protein and importin-β. Importin-α recognizes a nuclear localization signal (NLS) on the cargo, which is typically a mono- or bi-partite cluster of basic amino acids (9Gorlich D. Kutay U. Annu. Rev. Cell Dev. Biol. 1999; 15: 607-660Crossref PubMed Scopus (1668) Google Scholar). Importin-β is capable of binding nucleoporins, thus escorting the importin-α-importin-β-cargo complex to the nuclear pore. RanGDP and nuclear transport factor 2 are involved in translocation of the ternary complex through the nuclear pore, whereupon RCC1 exchanges GDP with GTP to dissociate the cargo (10Bischoff F.R. Ponstingl H. Nature. 1991; 354: 80-82Crossref PubMed Scopus (539) Google Scholar, 11Gorlich D. Pante N. Kutay U. Aebi U. Bischoff F.R. EMBO J. 1996; 15: 5584-5594Crossref PubMed Scopus (532) Google Scholar). RanGTP recycles importin-β, and importin-α is exported back to the cytoplasm by a distinct importin-β homologue, cellular apoptosis susceptibility protein (12Kutay U. Bischoff F.R. Kostka S. Kraft R. Gorlich D. Cell. 1997; 90: 1061-1071Abstract Full Text Full Text PDF PubMed Scopus (502) Google Scholar). Exceptions exist to this generalized pathway, such as the ability of importin-β to translocate cargo without importin-α (13Palmeri D. Malim M.H. Mol. Cell. Biol. 1999; 19: 1218-1225Crossref PubMed Google Scholar) and the presence of transportin, a distant relative of importin-β that recognizes nonclassical (M9) NLSs (14Pollard V.W. Michael W.M. Nakielny S. Siomi M.C. Wang F. Dreyfuss G. Cell. 1996; 86: 985-994Abstract Full Text Full Text PDF PubMed Scopus (578) Google Scholar). The GCN5 HAT identified in the protozoal parasite Toxoplasma gondii (phylum Apicomplexa) revealed unexpected features, most notably an N-terminal “extension” that is unusually long (820 amino acids) for an early eukaryote (15Sullivan Jr., W.J. Smith II, C.K. Gene (Amst.). 2000; 242: 193-200Crossref PubMed Scopus (32) Google Scholar). Early eukaryotes including yeast and the fellow alveolate protist Tetrahymena possess a short N-terminal domain of <100 residues (4Brownell J.E. Zhou J. Ranalli T. Kobayashi R. Edmondson D.G. Roth S.Y. Allis C.D. Cell. 1996; 84: 843-851Abstract Full Text Full Text PDF PubMed Scopus (1282) Google Scholar). The N-terminal extension in plant GCN5s range from 150 to 250 amino acids and have little homology to each other or other HATs (16Bhat R.A. Riehl M. Santandrea G. Velasco R. Slocombe S. Donn G. Steinbiss H.H. Thompson R.D. Becker H.A. Plant J. 2003; 33: 455-469Crossref PubMed Scopus (32) Google Scholar). Metazoan GCN5 family members contain N-terminal extensions of ∼500 residues, and they are fairly similar in composition (17Smith E.R. Belote J.M. Schiltz R.L. Yang X.J. Moore P.A. Berger S.L. Nakatani Y. Allis C.D. Nucleic Acids Res. 1998; 26: 2948-2954Crossref PubMed Scopus (92) Google Scholar, 18Xu W. Edmondson D.G. Roth S.Y. Mol. Cell. Biol. 1998; 18: 5659-5669Crossref PubMed Scopus (136) Google Scholar). TgGCN5 contains the second longest N-terminal extension of all GCN5 HATs described to date, the longest (1126 amino acids) having recently been noted in another apicomplexan, Plasmodium falciparum (19Fan Q. An L. Cui L. Eukaryot. Cell. 2004; 3: 264-276Crossref PubMed Scopus (88) Google Scholar), the causative agent of severe malaria. Interestingly, the lengthy N-terminal extensions present in these apicomplexan GCN5s bear no similarity to each other or any known protein and are devoid of known protein motifs. We hypothesized that at least one role for the N-terminal extension may be nuclear localization. Consistent with this hypothesis is the recent observation that maize GCN5 needs its N-terminal extension to access the nucleus; however, the precise NLS was not mapped (16Bhat R.A. Riehl M. Santandrea G. Velasco R. Slocombe S. Donn G. Steinbiss H.H. Thompson R.D. Becker H.A. Plant J. 2003; 33: 455-469Crossref PubMed Scopus (32) Google Scholar). Understanding GCN5 and how it enters the parasite nucleus is significant for a number of reasons. T. gondii can cause congenital birth defects and is an important opportunistic pathogen in AIDS and immunosuppressed patients (20Hermanns B. Brunn A. Schwarz E.R. Sachweh J.S. Seipelt I. Schroder J.M. Vogel U. Schoendube F.A. Buettner R. Pathol. Res. Pract. 2001; 197: 211-215Crossref PubMed Scopus (22) Google Scholar, 21Seeber F. Curr. Drug Targets Immune Endocr. Metabol. Disord. 2003; 3: 99-109Crossref PubMed Scopus (63) Google Scholar, 22Wong S.Y. Remington J.S. AIDS. 1993; 7: 299-316Crossref PubMed Scopus (159) Google Scholar). Blocking transcription factors from entering the parasite nucleus will subvert parasite differentiation and other processes essential for its survival. Novel elements found in parasite transcription factors and/or the nuclear import pathway may be exploited in the design of more selective therapeutic agents. Additionally, the study of these pathways in protozoa provides a unique perspective on how these systems evolved in early eukaryotic cells. Here we report the use of T. gondii GCN5 (TgGCN5) as a tool to investigate the understudied area of nuclear trafficking in protozoan parasites. We have mapped the first NLS to be identified and validated for any apicomplexan protein and in the process defined a function of the long N-terminal extension of TgGCN5. We demonstrate the predictive value of this NLS by identifying other nuclear proteins from the T. gondii genome as well as two additional apicomplexan databases. We have also characterized a T. gondii importin-α orthologue (TgIMPα) and demonstrated that this nuclear receptor interacts with TgGCN5 via the NLS that we have elucidated. Knowledge that GCN5 family HATs are translocated to the nucleus by the importin pathway may be useful in developing therapies that prevent this factor from modulating transcription in eukaryotic cells. Parasite Culture and Methods—T. gondii tachyzoites were cultivated in human foreskin fibroblast cells and transfected by electroporation as previously described (23Roos D.S. Sullivan W.J. Striepen B. Bohne W. Donald R.G. Methods. 1997; 13: 112-122Crossref PubMed Scopus (59) Google Scholar). The RHΔHXGPRT clone and pminiHXGPRT vector were obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, National Institutes of Health, from Dr. David Roos (24Pfefferkorn E.R. Borotz S.E. Exp. Parasitol. 1994; 79: 374-382Crossref PubMed Scopus (52) Google Scholar, 25Roos D.S. Donald R.G. Morrissette N.S. Moulton A.L. Methods Cell Biol. 1994; 45: 27-63Crossref PubMed Scopus (508) Google Scholar, 26Donald R.G. Carter D. Ullman B. Roos D.S. J. Biol. Chem. 1996; 271: 14010-14019Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar). RHΔHXGPRT were grown in culture medium supplemented with 320 μg/ml 6-thioxanthine (Sigma). Mycophenolic acid at 25 μg/ml plus xanthine at 50 μg/ml (Sigma) were used to select for parasites transfected with pminiHXGPRT-derived vectors. Plasmids—All of the constructs for immunolocalization were based on a T. gondii expression vector that was built into pminiHXGPRT. The T. gondii TUB1 promoter was amplified from ptubP30-GFP/sagCAT (27Striepen B. He C.Y. Matrajt M. Soldati D. Roos D.S. Mol. Biochem. Parasitol. 1998; 92: 325-338Crossref PubMed Scopus (164) Google Scholar) using primers 1 and 2 (all of the primer sequences are listed in Table I). These primers incorporate a BamHI site on the 5′ end of the PCR product and a polylinker region at the 3′ end containing sites for BglII, NdeI, EcoRV, and AvrII. The 3′-untranslated region of T. gondii dihydrofolate reductase was amplified using these primers 3 and 4. The resulting PCR product contained AvrII and NotI sites that were digested for a three-piece ligation with the TUB1 amplicon above (cut with BamHI and AvrII) and the pminiHXGPRT vector (cut with BamHI and NotI). We have designated this expression construct as ptubXFLAG::HX, the X representing where the gene of interest is to be installed (Fig. 1). It is important to note that although a C-terminal FLAG tag option is available in this vector, it was used only for the βgal construct. An N-terminal FLAG tag was fused to TgGCN5 sequences to be tested for localization as outlined below.Table IPrimers used in PCRs detailed under “Experimental Procedures” F denotes FLAG epitope tag sequence (5′-GACTACAAGGACGACGACGACAAG).NumberPrimer sequence (5′-3′)1GGATCCACACACTTCGTGCAGCATGTGCCCC2CCTAGGATATCATATGAGATCTAAAAGGGAATTCAAGAAAAAATGCC3CCTAGG(F)GAAGCTGCCCGTCTCTCGTTTTCC4TGGCGGCCGCTCTAGACCTAGTGGATCG5CATATGAAAATG(F)GAGACTGTCGAAGTGCCTGCATTCCTCG6CATATGAAAATG(F)AAAGGCGCTCCAACAGGTCTGGGG7CATATGAAAATG(F)AGGAAGCGTGTGAAGCGCGAGTGGGC8CATATGAAAATG(F)GAGTGGGCAAGTGGAGGTCGACTGGAGC9AGATCTAAAATGGTCGTTTTACAACGTCGTGACTGG10AGATCTAAAATGAGGAAGCGTGTGAAGCGCGTCGTTTTACAACGTCGTGA11CCTAGGTCAGAAACTCCCGAGAGCCTCGACC12CATATGGAGACTGTCGAAGTGCCTGCATTCCTCG13CATATGGAGTGGGCAAGTGGAGGTCGACTGG14CCCGGGTCAGAAACTCCCGAGAGCCTCGACCTTGG15GCTAGCGCTCTGTCCGCTGTCTCCATCCCTTGACG16GCTAGCGAGTGGGCAAGTGGAGGTCGACTGGAGC17CATATGGAGCGCAAGTTGGCCGATCGTCGATCG18CCCGGGCTACTGGCCGAAGTTGAAGCCTCCCTGAGG Open table in a new tab Primers 5–10 are the sense primers used in conjunction with the antisense primer 11 to create the various FLAG-tagged forms of TgGCN5 or βgal. All of the inserts were ligated into ptubXFLAG::HX at the NdeI and AvrII sites except the βgal constructs, which used BlgII and AvrII. Prior to electroporation, ∼50 μg of plasmid DNA was linearized using NotI. For the production of in vitro translated protein, pGADT7 and pGBKT7 vectors were used (Clontech). Full-length TgGCN5 and TgGCN5 lacking the first 99 amino acids (Δ99TgGCN5) were ligated into the pGBKT7 vector using the NdeI and XmaI sites. Sense primers 12 and 13 were used with antisense primer 14 to amplify inserts encoding full-length TgGCN5 and Δ99TgGCN5, respectively. ΔNLS-TgGCN5 was generated by a ligation of three DNA fragments. (i) The first piece encoded TgGCN5 amino acids 1–93 and was amplified using the primer 12 and 15, the latter of which contains a NheI site. (ii) The second fragment encoded amino acids 100–1169 and was generated with primer 16 (contains a NheI site) and primer 14 (contains a XmaI site). (iii) The third piece was pGBKT7 digested with NdeI and XmaI. The resulting vector encodes a form of TgGCN5 in which RKRVKR is replaced by AS (encoded by the NheI site). TgIMPα was ligated into pGADT7 in frame with the N-terminal hemagglutinin tag using NdeI and XmaI sites, and the insert was generated by PCR using the primers 17 and 18. All of the PCRs were conducted with the proofreading DNA polymerase Pfu Ultra™ (Stratagene). DNA sequencing was performed at the Indiana University Biochemistry Biotechnology Facility (Indiana University School of Medicine, Indianapolis, IN). Molecular Methods—T. gondii mRNA was isolated from ∼2 × 108 tachyzoites using Poly(A)Pure™ (Ambion). Tachyzoites were allowed to completely lyse the host cell monolayer and were passed through a 3.0-μm filter to exclude residual host cell debris. mRNA was treated with DNase prior to Northern blotting, which was performed using standard methods (28Sambrook J. Russell D. Irwin N. Hanssen K. Molecular Cloning: A Laboratory Manual. 3rd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY2001Google Scholar). A cDNA-derived probe representing the final 2.3 kb of TgGCN5 was labeled with [32P]dATP (PerkinElmer Life Sciences) using random primers and a Prime-A-Gene® kit (Promega). Reverse transcription-PCRs were carried out using the SuperScript II™ One-Step reverse transcription-PCR system (Invitrogen). The rapid amplification of cDNA ends was performed using an Invitrogen GeneRacer™ kit. Sequencing alignments and phylogeny trees (neighbor joining method) were generated using AlignX, a component of Vector NTI Advance 9.0 (Informax). Protein motif searches were performed using the Pfam data base (version 14.0; pfam.wustl.edu/) and/or PROSITE data base (version 18.35; us.expasy.org/prosite/). Immunofluorescence Assays—12-Well plates containing confluent human foreskin fibroblast cells grown on glass coverslips were infected with parasites. The cultures were fixed 18–24 h post-infection with ice-cold methanol at -20 °C for 10 min and blocked with phosphate-buffered saline containing 3% Fraction-V bovine serum albumin (Sigma), 5% goat serum (Invitrogen), and 1% fish gelatin (Sigma) for 1 h at 25 °C. Polyclonal anti-FLAG (Sigma) was used at 1:1000 in 3% bovine serum albumin in phosphate-buffered saline for 1 h at 25 °C followed by anti-rabbit Alexa 488 (Molecular Probes) at 1:1000 in 3% bovine serum albumin in phosphate-buffered saline for 1 h in the dark at 25 °C. 4′,6′-Diamino-2-phenylindole (Molecular Probes) was used at 0.3 μm for 5 min in the dark at 25 °C. Coverslips were mounted using 50% glycerol containing Mowiol 4–88 (Calbiochem) and DABCO (Sigma) to retard photobleaching. The slides were viewed with a Leica DMLB scope with a 100× HCX Plan Apo oil immersion objective. The images were captured using a monochrome SPOT-RTSE (model 12) camera and Spot Diagnostic software 4.0.9 and pseudocolored using Adobe Photoshop 7.0. TgGCN5 Antisera—A PCR-derived fragment encoding a portion of the C-terminal end of TgGCN5 (amino acids 976–1169) was ligated into pET19b (Novagen) to create an in-frame fusion to the N-terminal polyhistidine tag. Following transfection into BL21(DE3) Escherichia coli, recombinant protein was induced by adding 1.0 mm isopropyl β-d-thiogalactopyranoside for 3 h at 37 °C and purified by virtue of a nickel-nitrilotriacetic acid-agarose column (Qiagen) under native conditions. The purified protein was used as antigen to produce polyclonal antisera in rabbit (Pocono Rabbit Farms & Laboratories, Canadensis, PA). The resulting antisera recognizes <0.1 μg of recombinant antigen at a dilution of 1:10000, whereas prebleed sera is nonreactive (data not shown). Co-immunoprecipitation Experiments—In vitro translated proteins representing full-length TgGCN5, Δ99TgGCN5, ΔNLS-TgGCN5, and hemagglutinin-tagged TgIMPα were generated using the TnT® coupled reticulocyte lysate system (Promega) in the presence of Redivue™ l-[35S]methionine (Amersham Biosciences) and RNase Out (Invitrogen). 50-μl reaction mixtures were assembled and incubated as described by manufacturer. Co-immunoprecipitations were performed using 20 μl of a TgGCN5-derived construct combined with 20 μl of TgIMPα and mixed at 25 °C for 1 h. 1 μl of TgGCN5 polyclonal antisera or 10 μl of polyclonal anti-hemagglutinin (Santa Cruz) was added and mixed for 1 h at 25 °C. 10 μl of EZ-View protein A-agarose slurry (Sigma) was applied, and the reaction mixture was allowed to incubate at 25 °C for 1 h. Agarose was washed five times with 200 μl of Buffer 1 and twice with 300 μl of Buffer 2 from the MatchMaker co-immunoprecipitation kit (Clontech). Bound proteins were eluted in NuPAGE loading dye containing 5.0% β-mercaptoethanol and resolved on NuPAGE Bis-Tris SDS gels (Invitrogen). The gels were fixed in an aqueous solution of 5% isopropanol and 5% glacial acetic acid overnight and rinsed in running distilled water for 1 h. The gels were incubated in Autoflour (National Diagnostics) for 2 h, dried, and processed for autoradiography. Full-length TgGCN5 Localizes to Parasite Nucleus—TgGCN5 was initially described as a 474-amino acid protein, as deduced from a 2.3-kb cDNA clone isolated from a library screen (29Hettmann C. Soldati D. Nucleic Acids Res. 1999; 27: 4344-4352Crossref PubMed Scopus (36) Google Scholar). Our parallel cloning of TgGCN5 suggested that the open reading frame is much larger, encoding a protein of 1169 amino acids (15Sullivan Jr., W.J. Smith II, C.K. Gene (Amst.). 2000; 242: 193-200Crossref PubMed Scopus (32) Google Scholar). To verify the message length and determine whether alternatively spliced variants of TgGCN5 are produced, we performed Northern analysis. The probe used was a cDNA-derived sequence corresponding to the 2.3-kb portion previously reported, which is shared between both predicted transcripts. The result clarifies that only one transcript of ∼5.6 kb exists in T. gondii (Fig. 2). The size of the transcript is consistent with the longer version of the gene and predicts a 5′-untranslated region of 1.3 kb. To resolve the 5′ end of the TgGCN5 message, 5′ rapid amplification of cDNA ends was performed. Two amplicons were produced, indicating transcriptional start sites at -1101 and -1316 nucleotides from our proposed translational start. The 215-nucleotide difference between the two putative transcriptional starts is not resolvable on the Northern. A recombinant version of the previously reported 474-amino acid version of TgGCN5 (corresponding to amino acids 697–1169 of full-length TgGCN5) fused to a c-Myc epitope accumulated in the parasite cytoplasm, an unexpected localization for a GCN5 family member HAT (29Hettmann C. Soldati D. Nucleic Acids Res. 1999; 27: 4344-4352Crossref PubMed Scopus (36) Google Scholar). To test whether the additional N-terminal sequence alters localization to the parasite nucleus, full-length TgGCN5 and a truncated version lacking the N-terminal extension (amino acids 1–697) tagged with a FLAG epitope were expressed in the parasites (FLAGTgGCN5 and flagΔNTTgGCN5, respectively). Immunofluorescence assays using anti-FLAG demonstrate that the N-terminal extension is indeed required for nuclear localization of TgGCN5 (Fig. 3). In addition to nuclear DNA, 4′,6′-diamino-2-phenylindole also stains the 35-kb extrachromosal element housed in the apicoplast. We did not observe any form of TgGCN5 trafficking to the apicoplast organelle. Mapping the Nuclear Localization Signal (NLS) of TgGCN5—Protein motif searches of the TgGCN5 sequence revealed a putative bipartite NLS at amino acid positions 488–505 (15Sullivan Jr., W.J. Smith II, C.K. Gene (Amst.). 2000; 242: 193-200Crossref PubMed Scopus (32) Google Scholar). However, removal of this 18-amino acid motif from full-length TgGCN5 fused to a C-terminal green fluorescent protein tag did not subvert nuclear localization. 2W. J. Sullivan, Jr. and B. Striepen, unpublished observations. Therefore, a series of mapping constructs were designed to identify the region responsible for targeting TgGCN5 to the parasite nucleus. After several truncation studies (data not shown), the region involved in nuclear localization was narrowed to be between amino acids 58 and 120. Visual inspection of this region revealed a hexapeptide enriched with basic residues beginning at residue 94. NLSs often contain basic amino acids and average 6–8 residues in length (30Boulikas T. J. Cell. Biochem. 1994; 55: 32-58Crossref PubMed Scopus (174) Google Scholar). As shown in Fig. 4, FLAG-tagged TgGCN5 lacking the first 99 residues (FLAGΔ99TgGCN5) does not enter the parasite nucleus. However, when only the first 93 residues are removed (FLAGΔ93TgGCN5), the resulting protein is no longer restricted from the parasite nucleus. This demonstrates that the hexapeptide RKRVKR (amino acids 94–99) is required for the nuclear localization of TgGCN5. To verify whether the hexapeptide is a complete and sufficient NLS, RKRVRK was fused to the N terminus of E. coli βgal for expression in T. gondii. The FLAG epitope tag was moved to the C-terminal end of the βgal fusion proteins to ensure that the FLAG-NLS chimeric sequence was not responsible for nuclear localization. βgalFLAG is excluded from the parasite nucleus unless fused to the TgGCN5 NLS (Fig. 5). The homogenous staining of the parasites expressing NLS-βgal is likely due to saturation of the nuclear trafficking pathway or a strong nuclear export sequence present in βgal. Taken together, these studies show that RKRVKR is a necessary and sufficient NLS. Bioinformatics Screen for Proteins Harboring the TgGCN5 NLS—RKRVKR is a rare form of a monopartite NLS conforming to the θθθXθθ type described in Boulikas (30Boulikas T. J. Cell. Biochem. 1994; 55: 32-58Crossref PubMed Scopus (174) Google Scholar), where θ denotes a lysine or arginine. With the recent completion of multiple apicomplexan genome sequencing projects, knowledge of NLS motifs would prove valuable in characterizing parasite genes of unknown function. Bioinformatics searches using the TgGCN5 NLS against predicted proteins in ToxoDB.org (Release 3.0) revealed no exact matches, save TgGCN5 itself. However, when RKRXKR is used, 25 potential hits emerged using the TgTigrScan set of predicted proteins (Table II). For example, TgTigrScan_3884 is undoubtedly a DNA polymerase and contains a similar motif, RKRTKR, which may contribute to its nuclear compartmentalization. TgTigrScan_2877, 5941, 6704, and 7743 and several more contain predicted zinc fingers that are indigenous to many nuclear transcription factors. TgTigrScan_4179 contains RKRKKR and is a probable nuclear ribonucleoprotein, harboring an RNA recognition motif. Although these predictions are encouraging, they remain to be confirmed in vivo. It is also worth mentioning that NLSs may be more a matter of charge than an orderly configuration of precise amino acid residues (31Dingwall C. Laskey R.A. Trends Biochem. Sci. 1991; 16: 478-481Abstract Full Text PDF PubMed Scopus (1711) Google Scholar). Thus, permutations of the TgGCN5 NLS (e.g. (R/K)(R/K)X(R/K)(R/K)(R/K)) are likely to be found in other nuclear proteins in apicomplexa.Table IIPredictive value of the TgGCN5 NLS in apicomplexaDB identifierSearch resultPredicted homology/motifsToxoplasmaTgTigrScan_3884RKRTKRDNA polymerase X familyTgTigrScan_2877RKRDKRZinc fingerTgTigrScan_5941RKRGKRZinc fingerTgTigrScan_6704RKRMKRZinc fingerTgTigrScan_7743RKRRKRZinc fingerTgTigrScan_4179RKRKKRRNA recognition motifPlasmodiumPY07179KRKNKKHistone deacetylase domainPF10_0175RKKRKKtRNA pseudouridylate synthasePF10_0362KKKMKKDNA polymerase B familyPFC0425wRKRNKRPHD fingersCryptosporidiumCpEST_AA224688RKRNKRHistone 2BCpEST_AA253596KKKRRKPutative nucleolar protein Open table in a new tab T. gondii Possesses an Importin-α Homologue—Nuclear proteins harboring a NLS rich in basic residues typically interact with members of the importin (also known as karyopherin) family of proteins, particularly importin-α (30Boulikas T. J. Cell. Biochem. 1994; 55: 32-58Crossref PubMed Scopus (174) Google Scholar, 32Chook Y.M. Blobel G. Curr. Opin. Struct. Biol. 2001; 11: 703-715Crossref PubMed Scopus (421) Google Scholar). The T. gondii database (Release 2.1) was screened for sequences encoding possible importin-α homologues using the BLAST algorithm and text queries. The contig Tgg_7395 (corresponding to Tgg_994532 in Release 3.0) exhibited a high degree of similarity to importin-α proteins from other species. Primers designed to the genomic sequence data were employed to obtain the fulllength cDNA for T. gondii importin-α (TgIMPα, AY267540). Based on the results of the cDNA sequence, we have deduced that the ∼9.5-kb TgIMPα genomic locus is comprised of 11 exons and 10 introns. TgIMPα possesses an open reading frame of 1638 nucleotides with a consensus start ATG (33Kozak M. J. Cell Biol. 1991; 115: 887-903Crossref PubMed Scopus (1451) Google Scholar) that is preceded by an inframe stop codon -156 nucleotides upstream. The deduced 545-amino acid sequence has a calculated molecular mass of ∼60 kDa and shows unequivocal similarity to orthologues present in other eukaryotic organisms, especially the fellow apicomplexan parasite P. falciparum (34Mohmmed A. Kishore S. Dasaradhi P.V. Patra K. Malhotra P. Chauhan V.S. Mol. Biochem. Parasitol. 2003; 127: 199-203Crossref PubMed Scopus (9) Google Scholar). Apicomplexan IMPα proteins harbor the well conserved importin-β-binding domain and armadillo/β-catenin-like repeats (35Herold A. Truant R. Wiegand H. Cullen B.R. J. Cell Biol. 1998; 143: 309-318Crossref PubMed Scopus (107) Google Scholar) (Fig. 6A). Additionally, they contain the leucine-rich nuclear export signal within the final armadillo/β-catenin-like repeat that is required to recycle importin-α back to the cytoplasm (36Kobe B. Nat. Struct. Biol." @default.
• W2023941144 created "2016-06-24" @default.
• W2023941144 creator A5029428993 @default.
• W2023941144 creator A5089378249 @default.
• W2023941144 date "2005-02-01" @default.
• W2023941144 modified "2023-09-29" @default.
• W2023941144 title "Histone Acetylase GCN5 Enters the Nucleus via Importin-α in Protozoan Parasite Toxoplasma gondii" @default.
• W2023941144 cites W1481682126 @default.
• W2023941144 cites W1503329918 @default.
• W2023941144 cites W1846296194 @default.
• W2023941144 cites W1848001398 @default.
• W2023941144 cites W1870505444 @default.
• W2023941144 cites W1964343317 @default.
• W2023941144 cites W1967965128 @default.
• W2023941144 cites W1973253404 @default.
• W2023941144 cites W1978798894 @default.
• W2023941144 cites W1991018390 @default.
• W2023941144 cites W1992665460 @default.
• W2023941144 cites W1992771067 @default.
• W2023941144 cites W1999952815 @default.
• W2023941144 cites W2008133000 @default.
• W2023941144 cites W2013253155 @default.
• W2023941144 cites W2017470930 @default.
• W2023941144 cites W2019817639 @default.
• W2023941144 cites W2030219349 @default.
• W2023941144 cites W2034893389 @default.
• W2023941144 cites W2040029052 @default.
• W2023941144 cites W2046994088 @default.
• W2023941144 cites W2049661143 @default.
• W2023941144 cites W2051948296 @default.
• W2023941144 cites W2056875794 @default.
• W2023941144 cites W2067030969 @default.
• W2023941144 cites W2073695321 @default.
• W2023941144 cites W2076368732 @default.
• W2023941144 cites W2078682062 @default.
• W2023941144 cites W2084728469 @default.
• W2023941144 cites W2086725260 @default.
• W2023941144 cites W2092101619 @default.
• W2023941144 cites W2095783710 @default.
• W2023941144 cites W2096501714 @default.
• W2023941144 cites W2106526289 @default.
• W2023941144 cites W2115978467 @default.
• W2023941144 cites W2130590402 @default.
• W2023941144 cites W2134345368 @default.
• W2023941144 cites W2140596845 @default.
• W2023941144 cites W2154695838 @default.
• W2023941144 cites W2154883764 @default.
• W2023941144 cites W2160496162 @default.
• W2023941144 cites W2165306451 @default.
• W2023941144 cites W2172088410 @default.
• W2023941144 cites W346149210 @default.
• W2023941144 cites W4233036449 @default.
• W2023941144 doi "https://doi.org/10.1074/jbc.m410656200" @default.
• W2023941144 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15591057" @default.
• W2023941144 hasPublicationYear "2005" @default.
• W2023941144 type Work @default.
• W2023941144 sameAs 2023941144 @default.
• W2023941144 citedByCount "48" @default.
• W2023941144 countsByYear W20239411442012 @default.
• W2023941144 countsByYear W20239411442013 @default.
• W2023941144 countsByYear W20239411442014 @default.
• W2023941144 countsByYear W20239411442015 @default.
• W2023941144 countsByYear W20239411442016 @default.
• W2023941144 countsByYear W20239411442017 @default.
• W2023941144 countsByYear W20239411442018 @default.
• W2023941144 countsByYear W20239411442019 @default.
• W2023941144 countsByYear W20239411442020 @default.
• W2023941144 countsByYear W20239411442021 @default.
• W2023941144 countsByYear W20239411442022 @default.
• W2023941144 countsByYear W20239411442023 @default.
• W2023941144 crossrefType "journal-article" @default.
• W2023941144 hasAuthorship W2023941144A5029428993 @default.
• W2023941144 hasAuthorship W2023941144A5089378249 @default.
• W2023941144 hasBestOaLocation W20239411441 @default.
• W2023941144 hasConcept C133882971 @default.
• W2023941144 hasConcept C136764020 @default.
• W2023941144 hasConcept C159047783 @default.
• W2023941144 hasConcept C159654299 @default.
• W2023941144 hasConcept C185592680 @default.
• W2023941144 hasConcept C2778128430 @default.
• W2023941144 hasConcept C2778566189 @default.
• W2023941144 hasConcept C2780114586 @default.
• W2023941144 hasConcept C2780723820 @default.
• W2023941144 hasConcept C3019792204 @default.
• W2023941144 hasConcept C41008148 @default.
• W2023941144 hasConcept C54355233 @default.
• W2023941144 hasConcept C59157529 @default.
• W2023941144 hasConcept C71928629 @default.
• W2023941144 hasConcept C86803240 @default.
• W2023941144 hasConcept C89423630 @default.
• W2023941144 hasConcept C95444343 @default.
• W2023941144 hasConceptScore W2023941144C133882971 @default.
• W2023941144 hasConceptScore W2023941144C136764020 @default.
• W2023941144 hasConceptScore W2023941144C159047783 @default.
• W2023941144 hasConceptScore W2023941144C159654299 @default.
• W2023941144 hasConceptScore W2023941144C185592680 @default.
• W2023941144 hasConceptScore W2023941144C2778128430 @default.
• W2023941144 hasConceptScore W2023941144C2778566189 @default.

• next