FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2023950025> ?p ?o ?g. }

• W2023950025 endingPage "38196" @default.
• W2023950025 startingPage "38189" @default.
• W2023950025 abstract "The MDM2 oncoprotein has transforming potential that can be activated by overexpression, and it represents a critical regulator of the p53 tumor suppressor protein. To identify other factors with a potential role in influencing the expression and/or function of MDM2, we utilized a yeast two-hybrid screening protocol. Here we report that MDM2 physically interacts with a structurally related protein termed MDMX. The results obtained in these studies provide evidence that C-terminal RING finger domains, contained within both of these proteins, play an important role in mediating the association between MDM2 and MDMX. The interaction of these proteins interferes with MDM2 degradation, leading to an increase in the steady-state levels of MDM2. MDMX also inhibits MDM2-mediated p53 degradation, with subsequent accumulation of p53. Taken together, these data indicate that MDMX has the potential to regulate the expression and function of the MDM2 oncoprotein. The MDM2 oncoprotein has transforming potential that can be activated by overexpression, and it represents a critical regulator of the p53 tumor suppressor protein. To identify other factors with a potential role in influencing the expression and/or function of MDM2, we utilized a yeast two-hybrid screening protocol. Here we report that MDM2 physically interacts with a structurally related protein termed MDMX. The results obtained in these studies provide evidence that C-terminal RING finger domains, contained within both of these proteins, play an important role in mediating the association between MDM2 and MDMX. The interaction of these proteins interferes with MDM2 degradation, leading to an increase in the steady-state levels of MDM2. MDMX also inhibits MDM2-mediated p53 degradation, with subsequent accumulation of p53. Taken together, these data indicate that MDMX has the potential to regulate the expression and function of the MDM2 oncoprotein. ubiquitin-protein isopeptide ligase amino acids immunoprecipitation polymerase chain reaction polyacrylamide gel electrophoresis 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside activation domain binding domain An accumulating number of observations have implicated aberrant expression of the MDM2 oncogene in the pathogenesis of human neoplasias. This mammalian gene has transforming potential that can be activated by overexpression (1Fakharzadeh S.S. Trusko S.P. George D.L. EMBO J. 1991; 10: 1565-1569Crossref PubMed Scopus (627) Google Scholar, 2Finlay C.A. Mol. Cell. Biol. 1993; 13: 301-306Crossref PubMed Scopus (310) Google Scholar). Originally identified as a gene amplified and overexpressed in a spontaneously transformed mouse 3T3 cell line (3Cahilly-Snyder L. Yang-Feng T. Francke U. George D.L. Somatic Cell Mol. Genet. 1987; 13: 235-244Crossref PubMed Scopus (305) Google Scholar), MDM2 is now known to be amplified in a variety of human tumors, particularly soft tissue sarcomas (4Oliner J.D. Kinzler K.W. Meltzer P.S. George D.L. Vogelstein B. Nature. 1992; 358: 80-83Crossref PubMed Scopus (1802) Google Scholar, 5Leach F.S. Tokino T. Meltzer P. Burrell M. Oliner J.D. Smith S. Hill D.E. Sidransky D. Kinzler K.W. Vogelstein B. Cancer Res. 1993; 53: 2231-2234PubMed Google Scholar, 6Cordon-Cardo C. Latres E. Drobnjak M. Oliva M.R. Pollack D. Woodruff J.M. Marechal V. Chen J. Brennan M.F. Levine A.J. Cancer Res. 1994; 54: 794-799PubMed Google Scholar, 7Momand J. Jung D. Wilczynski S. Niland J. Nucleic Acids Res. 1998; 26: 3453-3459Crossref PubMed Scopus (822) Google Scholar). Additionally, there are several cases reported of tumor cells having an elevated expression of MDM2 that results from mechanisms other than gene amplification, including enhanced translation of MDM2transcripts (8Landers J.E. Haines D.S. Strauss III, J.F. George D.L. Oncogene. 1994; 9: 2745-2750PubMed Google Scholar, 9Landers J.E. Cassel S.L. George D.L. Cancer Res. 1997; 57: 3562-3568PubMed Google Scholar, 10Capoulade C. Bressac-de Paillerets B. Lefrere I. Ronsin M. Feunteun J. Tursz T. Wiels J. Oncogene. 1998; 16: 1603-1610Crossref PubMed Scopus (116) Google Scholar). The MDM2 gene encodes a key negative regulator of the p53 tumor suppressor protein, and the role of MDM2 overexpression in cell transformation has been attributed, at least in part, to its disruption of the biological activities of p53 (11Piette J. Neel H. Marechal V. Oncogene. 1997; 15: 1001-1010Crossref PubMed Scopus (240) Google Scholar, 12Freedman D.A. Levine A.J. Cancer Res. 1999; 59: 1-7PubMed Google Scholar). MDM2 tightly associates with the N-terminal region of the p53 protein, inhibiting the trans-activation and G1 growth arrest functions of p53 (13Momand J. Zambetti G.P. Olson D.C. George D. Levine A.J. Cell. 1992; 69: 1237-1245Abstract Full Text PDF PubMed Scopus (2792) Google Scholar, 14Oliner J.D. Pietenpol J.A. Thiagalingam S. Gyuris J. Kinzler K.W. Vogelstein B. Nature. 1993; 362: 857-860Crossref PubMed Scopus (1307) Google Scholar, 15Chen C.Y. Oliner J.D. Zhan Q. Fornace Jr., A.J. Vogelstein B. Kastan M.B. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2684-2688Crossref PubMed Scopus (290) Google Scholar, 16Chen J. Wu X. Lin J. Levine A.J. Mol. Cell. Biol. 1996; 16: 2445-2452Crossref PubMed Scopus (333) Google Scholar). Moreover, binding of MDM2 targets p53 for rapid degradation via the ubiquitin-proteasome pathway (17Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3720) Google Scholar, 18Kubbutat M.H. Jones S.N. Vousden K.H. Nature. 1997; 387: 299-303Crossref PubMed Scopus (2847) Google Scholar). In recent reports, evidence has been obtained suggesting that MDM2 can function as an E31 ubiquitin ligase and is responsible for targeting both itself, and p53, for degradation (19Honda R. Tanaka H. Yasuda H. FEBS Lett. 1997; 420: 25-27Crossref PubMed Scopus (1603) Google Scholar,20Honda R. Yasuda H. EMBO J. 1999; 18: 22-27Crossref PubMed Scopus (614) Google Scholar). Interestingly, the MDM2 gene itself is a transcriptional target of p53. When activated as a transcription factor, p53 binds to a promoter region within the first intron of theMDM2 gene and up-regulates its expression (21Barak Y. Juven T. Haffner R. Oren M. EMBO J. 1993; 12: 461-468Crossref PubMed Scopus (1178) Google Scholar, 22Juven T. Barak Y. Zauberman A. George D.L. Oren M. Oncogene. 1993; 8: 3411-3416PubMed Google Scholar, 23Wu X. Bayle J.H. Olson D. Levine A.J. Genes Dev. 1993; 7: 1126-1132Crossref PubMed Scopus (1642) Google Scholar, 24Zauberman A. Flusberg D. Haupt Y. Barak Y. Oren M. Nucleic Acids Res. 1995; 23: 2584-2592Crossref PubMed Scopus (256) Google Scholar). Thus, there is evidence for an autoregulatory feedback loop involving the expression and function of MDM2 and p53 (23Wu X. Bayle J.H. Olson D. Levine A.J. Genes Dev. 1993; 7: 1126-1132Crossref PubMed Scopus (1642) Google Scholar). Although the best characterized activities of MDM2 concern its functional interactions with p53, MDM2 also associates with other proteins. Some of these include E2F1 (25Martin K. Trouche D. Hagemeier C. Sorensen T.S. La Thangue N.B. Kouzarides T. Nature. 1995; 375: 691-694Crossref PubMed Scopus (452) Google Scholar), pRb (26Xiao Z.X. Chen J. Levine A.J. Modjtahedi N. Xing J. Sellers W.R. Livingston D.M. Nature. 1995; 375: 694-698Crossref PubMed Scopus (573) Google Scholar), and p300 (27Grossman S.R. Perez M. Kung A.L. Joseph M. Mansur C. Xiao Z.X. Kumar S. Howley P.M. Livingston D.M. Mol. Cell. 1998; 2: 405-415Abstract Full Text Full Text PDF PubMed Scopus (361) Google Scholar). Such interactions could contribute to the transforming potential of MDM2 or may be concerned with modulating MDM2 function. Recently, a link between MDM2 and yet another tumor suppressor protein, p14ARF (p19ARF in mouse) was identified. An important consequence of complex formation with p14ARF is an abrogation of the ability of MDM2 to mediate p53 degradation and to inhibit the trans-activation function of p53 (28Pomerantz J. Schreiber-Agus N. Liegeois N.J. Silverman A. Alland L. Chin L. Potes J. Chen K. Orlow I. Lee H.W. Cordon-Cardo C. DePinho R.A. Cell. 1998; 92: 713-723Abstract Full Text Full Text PDF PubMed Scopus (1334) Google Scholar, 29Zhang Y. Xiong Y. Yarbrough W.G. Cell. 1998; 92: 725-734Abstract Full Text Full Text PDF PubMed Scopus (1404) Google Scholar, 30Weber J.D. Taylor L.J. Roussel M.F. Sherr C.J. Bar-Sagi D. Nat. Cell Biol. 1999; 1: 20-26Crossref PubMed Scopus (803) Google Scholar). As illustrated by such examples, the identification of novel MDM2-interacting proteins would be expected to offer new clues to understand better the biological activities and/or regulation of the MDM2 oncoprotein. Toward that goal, we sought to identify cellular proteins that physically associate with MDM2. In initiating these studies, we noted that MDM2 contains several conserved structural motifs that likely are important for its biological activities (1Fakharzadeh S.S. Trusko S.P. George D.L. EMBO J. 1991; 10: 1565-1569Crossref PubMed Scopus (627) Google Scholar). In addition to the N-terminal p53-binding domain, MDM2 has a central acidic domain, a putative nuclear localization signal, and a nuclear export signal. The C-terminal region of the MDM2 protein contains two cysteine-rich elements, classified as a C4 zinc finger domain and a C3HC4 RING finger (31Boddy M.N. Freemont P.S. Borden K.L. Trends Biochem. Sci. 1994; 19: 198-199Abstract Full Text PDF PubMed Scopus (84) Google Scholar). Recent investigations directly implicate certain zinc finger and RING finger domains in mediating protein-protein interactions or the formation of multiprotein complexes (32Borden K.L. Freemont P.S. Curr. Opin. Struct. Biol. 1996; 6: 395-401Crossref PubMed Scopus (418) Google Scholar, 33Saurin A.J. Borden K.L. Boddy M.N. Freemont P.S. Trends Biochem. Sci. 1996; 21: 208-214Abstract Full Text PDF PubMed Scopus (613) Google Scholar). To test whether the C-terminal segment of the MDM2 protein, comprising the zinc finger and RING finger motifs, also might participate in complex formation with other proteins, we carried out a yeast two-hybrid screening assay. As described in this report, we have identified an interaction between MDM2 and a structurally related protein, MDMX (34Shvarts A. Steegenga W.T. Riteco N. van Laar T. Dekker P. Bazuine M. van Ham R.C. van der Houven van Oordt W. Hateboer G. van der Eb A.J. Jochemsen A.G. EMBO J. 1996; 15: 5349-5357Crossref PubMed Scopus (519) Google Scholar, 35Shvarts A. Bazuine M. Dekker P. Ramos Y.F. Steegenga W.T. Merckx G. van Ham R.C. van der Houven van Oordt W. van der Eb A.J. Jochemsen A.G. Genomics. 1997; 43: 34-42Crossref PubMed Scopus (124) Google Scholar). Our data indicate that the RING finger domains contained within both of these proteins are necessary to mediate this interaction. Notably, complex formation between MDM2 and MDMX leads to a stabilization of MDM2, resulting in an elevation of steady-state levels of MDM2 protein. MDMX also interferes with MDM2-mediated degradation of p53, resulting in an increase in p53 protein levels. The data presented here suggest a role for MDMX in the regulation of MDM2 expression and have implications for understanding the cellular functions of the MDM2 oncoprotein. A DNA fragment encoding the C-terminal 215 amino acid (aa) residues of human MDM2 was fused in-frame with the yeast GAL4 DNA binding domain in the pBD-GAL4 Cam phagemid vector (Stratagene) to create the hybrid bait protein. A randomly primed cDNA library was constructed in the pAD-GAL4 phagemid (Stratagene) using poly(A)+ RNA isolated from human thymus (CLONTECH). The bait and target plasmids were co-transformed into YRG-2 yeast cells. Colonies with plasmid DNA encoding target proteins that interact with the bait protein are identified by transcription of the HIS3 andlacZ reporter genes integrated into the genome of the yeast host. Approximately 3 × 106 transformants were screened for colonies that would grow on media lacking tryptophan (Trp), leucine (Leu), and histidine (His). To confirm the presence of interacting proteins, positive transformants were assayed for expression of the lacZ reporter gene using an X-gal filter assay for detection of β-galactosidase activity. Typically, blue coloration of colonies appeared within 1–3 h of incubation of the filter in the lacZ/X-gal buffer at 30 °C. To verify further protein-protein interactions, plasmid DNA was rescued from positive colonies and re-transformed into YRG-2 yeast cells with the MDM2 bait plasmid. Nucleotide sequence analysis was carried out to characterize the target DNA of positive colonies. A full-length humanMDMX cDNA fragment encoding aa 1–490 was generated by a random hexamer-primed reverse transcription reaction using human kidney RNA (CLONTECH) followed by PCR using forward and reverse primers containing the first and last coding triplets of the human MDMX cDNA. All nucleotide and aa sequence numbers for MDMX primer design relate to the first ATG coding triplet as number 1 (35Shvarts A. Bazuine M. Dekker P. Ramos Y.F. Steegenga W.T. Merckx G. van Ham R.C. van der Houven van Oordt W. van der Eb A.J. Jochemsen A.G. Genomics. 1997; 43: 34-42Crossref PubMed Scopus (124) Google Scholar). The 5′ primer included an XhoI site, and the 3′ primer included a BamHI site for subsequent cloning reactions. This PCR product was cloned into the TOPO PCR 2.1 vector (Invitrogen) to generate the MDMX plasmid termed pCK4; the DNA sequence was verified, and this clone was used as a template to generate additional MDMX constructs, as described below. DNA fragments encoding full-length MDMX andMDMX lacking the C-terminal 59 aa (MDMX without RING) were both cloned into the yeast phagemid vector pAD-GAL4 by including into the oligonucleotide primers 5′ SrfI and 3′ SalI restriction sites. The 5′ and 3′ primers for the full-lengthMDMX construct included sequences representing the first ATG codon and last (stop) codon, respectively. For the MDMX without RING construct, the 5′ primer included sequences for the first ATG codon, and the 3′ primer included MDMX coding sequence up to base pair 1290. For the MDMX-(101–490)-Myc construct, the 5′ primer included the sequences for an internal ATG at aa residue 101, and the 3′ primer included the last (stop) codon of the MDMX cDNA. To generate the MDMX mammalian expression plasmid MDMX-Myc, a C-terminal Myc epitope tag was added to the MDMX coding sequence by using a BamHI-XhoI restriction digest to release the insert from plasmid pCK4; the released insert was subcloned into the pcDNA 3.1(−)Myc His A mammalian expression vector (Invitrogen). An N-terminally Myc-tagged MDMXconstruct was constructed by introducing the sequence of a Myc epitope (5′ GAGGAGCAGAAGTTGATCTCCGAGGAGGATCTCCTC 3′) into theHindIII-BamHI site of the pcDNA 3.1(+) vector (Invitrogen). The full coding region and stop codon of the humanMDMX gene was generated by reverse transcriptase-PCR reactions using human kidney RNA. The 5′ primer included aBamHI site, and the 3′ primer included an XhoI site to facilitate cloning the MDMX sequence in-frame with the Myc tag in the pcDNA 3.1(+) vector. A FLAG epitope tag (5′ CCTGTCATCGTCGTCCTTGTAGTC 3′) was added to the C terminus ofMDMX by PCR of the MDMX construct pCK4, using 5′ and 3′ PCR primers that included a BamHI restriction site. The PCR product was cloned into the BamHI site of the mammalian expression vector CMV-NeoBam. The MDMX-(1–153)-Myc construct was generated by XhoI-EcoRV digestion of the MDMX-Myc plasmid; the MDMX insert DNA fragment was reinserted directionally into the XhoI-EcoRV site of pcDNA 3.1(−)Myc His A. The MDMX-(1–392)-Myc construct was generated by EcoRI digestion of pCK4; the MDMXinsert DNA fragment was reinserted into the EcoRI site of pcDNA 3.1(−)Myc His B (Invitrogen). The S-MDM2 and p53-SN3 constructs in the CMV-NeoBam mammalian expression vector have been described previously (8Landers J.E. Haines D.S. Strauss III, J.F. George D.L. Oncogene. 1994; 9: 2745-2750PubMed Google Scholar, 9Landers J.E. Cassel S.L. George D.L. Cancer Res. 1997; 57: 3562-3568PubMed Google Scholar). TheMDM2, pBD-GAL4 yeast two-hybrid plasmids termed MDM2 full, MR1, MR2, and MDM2 without p53, were all generated by PCR using the human S-MDM2 construct as a template. The 5′ and 3′ primers included an EcoRI site and SrfI site, respectively, to facilitate cloning into the yeast pBD-GAL4 vector. TheMDM2 sequences within the 5′ PCR primers for MDM2 without p53, MR1, and MR2 started at base pair 306, 828, and 1047, respectively, to generate these N-terminally truncated forms of MDM2. In each case, the 3′ primer included the MDM2 stop codon. The MDM2 without RING yeast plasmid construct was generated by SalI digestion of the MDM2 full plasmid; the digest product was then self-ligated following gel purification. Point mutants of MDM2 or MDMX were generated using the Altered Sites II in vitro mutagenesis system (Promega). Monoclonal antibodies anti-MDM2 IF2 and anti-p53 DO-1 were obtained from Calbiochem. Anti-MDM2 monoclonal antibody 2A10 was a kind gift from Dr. Arnold Levine. Monoclonal antibody anti-Myc 9E10 and rabbit polyclonal antibody to p53 (p53fl393) were obtained from Santa Cruz Biotechnology or from Calbiochem. Anti-FLAG M2 and anti-β-actin AC-15 were obtained from Sigma. MDM2 and MDMX-Myc expression constructs were individually transcribed and translated in the presence or absence of [35S]methionine using the T7-coupled reticulocyte lysate system (TNT; Promega). Following a 2-h incubation at 30 °C, the protein synthesis inhibitor cycloheximide was added to the reactions (100 μg/ml final concentration) that were then incubated for an additional 10 min at room temperature. MDM2 and MDMX-Myc in vitro translation products were combined together and incubated for 30 min at 30 °C. Following the addition of 450 μl of dilution buffer (0.5% Nonidet P-40, 150 mmNaCl, 50 mm Tris-Cl, pH 8, 5 mm EDTA) and 1–3 μg of the appropriate antibodies to each binding reaction, the samples were incubated for 1 h at 4 °C with mixing. To isolate immunocomplexes, 30 μl of a protein A/protein G-agarose bead mix (Life Technologies, Inc.) was added, and reactions were incubated for another 30 min at 4 °C with mixing. Following this incubation, the beads were pelleted by centrifugation, washed three times in washing buffer (0.7 m NaCl, 0.5% Nonidet P-40, 5 mmEDTA, pH 8, 50 mm Tris-Cl, pH 8), and one time in phosphate-buffered saline. After washing, pelleted beads were resuspended in 50 μl of SDS sample loading buffer and boiled 5 min. Denatured proteins released into the supernatant were resolved by SDS-10% polyacrylamide gel electrophoresis (PAGE) and visualized by exposure to x-ray film after fluorography. H1299 lung adenocarcinoma cells (p53 null) and JEG-3 choriocarcinoma cells (wild-type p53) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotics. H1299 cell transfections were carried out using the Lipotaxi reagent according to guidelines of the manufacturer (Stratagene) or by a standard calcium phosphate precipitation protocol. In all transfections the total amount of each vector was equalized, as was the total amount of DNA. Approximately 24–48 h post-transfection, the cells were harvested and lysed (1% Nonidet P-40, 250 mm NaCl, 5 mm EDTA, 50 mm Tris-Cl, pH 7.4, supplemented with the protease inhibitors aprotinin and leupeptin). DNA was transfected into JEG-3 cells using the calcium phosphate precipitation protocol. At 48 h post-transfection, the cells were harvested and lysed. To examine the relative stability of MDM2 protein, H1299 cells were transfected as described above. At 48 h post-transfection, fresh media containing cycloheximide (75 μg/ml final concentration) were added. The cells were harvested at various time points, and cell lysates were subjected to Western blot analysis. For Northern blot analysis, total cellular RNA from transfected H1299 cells was isolated using RNA Isolator (Genosys). Samples (10 μg) were resolved on formaldehyde-agarose gels and transferred to nitrocellulose as described previously (36Murphy M. Pykett M.J. Harnish P. Zang K.D. George D.L. Cell Growth Differ. 1993; 4: 715-722PubMed Google Scholar). Probes were radiolabeled with32P using random primers (Prime-It-II, Stratagene). For immunoprecipitation assays, cell lysates (approximately 1–3 mg of protein) were incubated with 1–3 μg of the appropriate antibody and lysis buffer (final volume, 500 μl) for 1 h at 4 °C with mixing. Following the addition of 40 μl of a protein A/protein G-agarose bead mix, the reactions were incubated for 30 min at 4 °C with mixing. The beads were washed twice in RIPA buffer (1% Triton X-100, 150 mm NaCl, 50 mm Tris-Cl, pH 7.4, 0.1% SDS, 1% sodium deoxycholate), resuspended in 50 μl of SDS sample loading buffer, and boiled for 5 min. The immunoprecipitates were separated by SDS-PAGE and transferred to nitrocellulose membranes (Schleicher & Schuell). For immunoblotting experiments, 50–75-μg samples of total cellular lysate in SDS loading buffer were separated by 7.5–10% SDS-PAGE. Western blot analysis was performed using an enhanced chemiluminescence system (ECL, Amersham Pharmacia Biotech). To identify cellular proteins that interact with MDM2, a yeast two-hybrid screen was employed. The C-terminal 215 aa of MDM2, including the zinc finger region and the RING finger domain, were fused to the GAL4 DNA-binding domain (BD). As detailed under “Experimental Procedures,” this construct was used as bait to screen a randomly primed human thymus cDNA library that was fused to the GAL4 transcriptional activation domain (AD) (Fig. 1 A). From a screen of approximately 3 × 106 yeast transformants, 47 colonies scored as positive for reporter gene activity (His+LacZ+). Of these, the first eight were chosen for further analysis; all scored positive in secondary screening assays, indicating an interaction with the GAL4 BD-MDM2 fusion protein. DNA sequence analysis revealed that each of the rescued cDNAs from the positive clones were derived from the human MDMX gene (Fig. 1 B). The remaining 39 His+LacZ+ colonies all hybridized positively to a radioactively labeled MDMX probe in colony-lift assays. The MDMX protein was identified in a screen for proteins that bind to the tumor suppressor p53 (34Shvarts A. Steegenga W.T. Riteco N. van Laar T. Dekker P. Bazuine M. van Ham R.C. van der Houven van Oordt W. Hateboer G. van der Eb A.J. Jochemsen A.G. EMBO J. 1996; 15: 5349-5357Crossref PubMed Scopus (519) Google Scholar, 35Shvarts A. Bazuine M. Dekker P. Ramos Y.F. Steegenga W.T. Merckx G. van Ham R.C. van der Houven van Oordt W. van der Eb A.J. Jochemsen A.G. Genomics. 1997; 43: 34-42Crossref PubMed Scopus (124) Google Scholar). Interestingly, it exhibits high structural homology to MDM2. Overall, MDM2 and MDMX exhibit 32.6% amino acid sequence identity; the greatest conservation resides within the N-terminal (50.5%) and C-terminal (31.4%) portions of the two proteins. The N-terminal regions include the p53-binding domains, and the C-terminal regions of these proteins contain the putative metal-binding, zinc finger, and RING finger, domains. As indicated by the results of our yeast two-hybrid screen (Fig. 1), the C-terminal regions of the MDM2 and MDMX proteins likely play an important role in their interaction. In particular, a polypeptide containing only the last 77 aa residues of MDMX, which includes the RING domain, is capable of interaction with MDM2 (Fig. 1 B). For MDM2, a slightly larger polypeptide that includes both the zinc finger and RING finger domains (aa 276–491) is required for interaction with MDMX (Fig. 1 A and Fig. 2 A). The yeast two-hybrid assays were extended to test further the importance of the C-terminal protein domains in the MDMX-MDM2 interaction. The results (Fig. 2) demonstrated that full-length versions of the MDM2 and MDMX proteins can interact in yeast cells. In addition, deletion of the N-terminal p53-binding region, or the central acidic domain, of MDM2 did not interfere with MDM2-MDMX interactions. However, a truncated MDM2 protein, lacking the C-terminal 49 aa residues, failed to interact with MDMX (Fig. 2 A). Deletion of the C-terminal 59 aa residues of MDMX also resulted in a loss of interaction of the two proteins. Evidence suggests that the C-terminal region of MDM2 binds two molecules of zinc in an interleaved fashion (37Lai Z. Freedman D.A. Levine A.J. McLendon G.L. Biochemistry. 1998; 37: 17005-17015Crossref PubMed Scopus (40) Google Scholar). To examine more specifically the role of the RING domain in MDM2-MDMX interaction, we therefore introduced mutations at conserved cysteine residues implicated in this metal ligation. MDM2 proteins containing a single mutation (C441G or C478R) or a double mutation (C438G,C441G or C475Y,C478R) within the RING domain failed to interact with MDMX (Fig. 2 A). Mutation of a threonine residue (T455A) that is located within the RING domain, but does not seem to be involved in metal ligation (37Lai Z. Freedman D.A. Levine A.J. McLendon G.L. Biochemistry. 1998; 37: 17005-17015Crossref PubMed Scopus (40) Google Scholar), did not disrupt the ability of MDM2 and MDMX to associate (Fig. 2 A). The introduction of either a single mutation (C437G) or a double mutation (C437G,C440G) within the RING domain of MDMX also disrupted interaction with MDM2 (Fig. 2 B). It should be noted that both MDM2 and MDMX proteins containing such point mutations, and those with the C-terminal deletions noted above, still retained the ability to associate with p53 protein in this yeast two-hybrid system (data not shown). Taken together, these results indicate that the RING finger domain of MDM2 is necessary for interaction with MDMX; in contrast, the RING domain of MDMX likely is both necessary and sufficient for binding to MDM2. Interestingly, we have found no evidence for homo-oligomerization of either the MDMX or MDM2 proteins (data not shown). This result lends additional support to the specificity of the RING-RING interaction between MDM2 and MDMX. The MDM2-MDMX interaction also was detected in a cell-free system. Full-length MDMX, containing a c-Myc epitope tag (MDMX-Myc), and full-length MDM2 were individually produced by translation in a rabbit reticulocyte lysate system. The MDMX and MDM2 proteins are very similar in size (85–95 kDa; Fig. 3, lanes 1 and2). Thus, to ensure accurate identification of the proteins, co-immunoprecipitation reactions were carried out following the35S labeling of only one of the proteins per reaction.35S-Labeled MDMX-Myc protein was incubated with unlabeled MDM2 to allow complex formation, and the reactions were immunoprecipitated with anti-MDM2 antibody. The 35S-labeled MDMX-Myc protein is clearly detectable in these immunocomplexes (Fig. 3, lane 3). Consistent results were obtained when35S-labeled MDM2 protein was incubated with unlabeled MDMX-Myc followed by immunoprecipitation with anti-Myc antibody; the presence of 35S-labeled MDM2 in the immunoprecipitates is illustrated in Fig. 3, lane 4. In contrast, there was no evidence for cross-reaction between the anti-MDM2 antibody and MDMX-Myc (Fig. 3, lane 5) or between the anti-Myc antibody and MDM2 (Fig. 3, lane 6). These results suggest that MDM2 and MDMX interact directly. MDM2-MDMX binding was assessed in mammalian cells following transient transfection analysis. Mammalian expression plasmids encoding either a Myc-tagged MDMX protein or MDM2 protein were transfected into H1299 human lung carcinoma cells, either separately or together. Cell extracts were analyzed by IP-Western blot analysis. For the co-transfected cells, immunoprecipitation with anti-MDM2 antibodies, followed by immunoblot analysis using an antibody to the Myc-epitope tag, identified MDMX-Myc bound to MDM2 (Fig. 4, lane 1). The MDMX-Myc protein was detected in these immunocomplexes when the cell lysates were immunoprecipitated using two different antibodies to MDM2 (2A10 and IF2), either together (Fig. 4, lane 1) or individually (data not shown). Similarly, when lysates from the co-transfected cells were immunoprecipitated with anti-Myc antibody, Western blot analysis consistently revealed the presence of MDM2 proteins in the immunocomplexes (Fig. 4, lane 6). To examine the association of endogenous MDM2 with transfected MDMX protein, we repeated the IP-Western analyses using JEG-3 choriocarcinoma cells, which have elevated levels of endogenous MDM2 protein (8Landers J.E. Haines D.S. Strauss III, J.F. George D.L. Oncogene. 1994; 9: 2745-2750PubMed Google Scholar). The JEG-3 cells were transfected with either a Myc-tagged MDMX expression vector, a FLAG-tagged MDMX expression vector, or with empty vector. Cell lysates were immunoprecipitated using anti-Myc antibody, anti-FLAG antibody, or a control antibody (anti-rabbit IgG). In these experiments, the interaction of MDMX with endogenous MDM2 was readily detectable. The endogenous MDM2 protein in the JEG-3 cells co-precipitated with MDMX-Myc using the anti-Myc antibody (Fig. 4 B, lane 1) and with MDMX-FLAG using the anti-FLAG antibody (Fig. 4 B, lane 3). In control assays where JEG-3 cells were transfected with empty vector alone, MDM2 was not precipitated using anti-Myc, anti-FLAG, or anti-rabbit IgG antibodies (Fig. 4 B, lanes 5–7). In summary, these data demonstrate that the MDM2 and MDMX proteins can interact in mammalian cells. During the course of these studies, we noted that co-transfection of theMDM2 and MDMX-myc expression plasmids resulted in a reproducible and significant increase in the steady-state level of MDM2 protein. An example of this can be seen in Fig. 4 A(compare lanes 8 and 9). This result suggested that MDMX may be modulating MDM2 expression. To assess further this possibility, H1299 cells were co-transfected with a constant amount ofMDM2 plasmid and increasing amounts of MDMX-mycplasmid. Steady-state MDM2 prot" @default.
• W2023950025 created "2016-06-24" @default.
• W2023950025 creator A5015092350 @default.
• W2023950025 creator A5045103400 @default.
• W2023950025 creator A5082814338 @default.
• W2023950025 creator A5084045642 @default.
• W2023950025 date "1999-12-01" @default.
• W2023950025 modified "2023-10-16" @default.
• W2023950025 title "Stabilization of the MDM2 Oncoprotein by Interaction with the Structurally Related MDMX Protein" @default.
• W2023950025 cites W1479721949 @default.
• W2023950025 cites W1560780012 @default.
• W2023950025 cites W1576330810 @default.
• W2023950025 cites W1591281137 @default.
• W2023950025 cites W1592021885 @default.
• W2023950025 cites W1856360008 @default.
• W2023950025 cites W1965173366 @default.
• W2023950025 cites W1969044026 @default.
• W2023950025 cites W1973904343 @default.
• W2023950025 cites W1975277357 @default.
• W2023950025 cites W1983751803 @default.
• W2023950025 cites W1986512406 @default.
• W2023950025 cites W1993864973 @default.
• W2023950025 cites W1995254238 @default.
• W2023950025 cites W1997068466 @default.
• W2023950025 cites W2007249806 @default.
• W2023950025 cites W2023578962 @default.
• W2023950025 cites W2028210102 @default.
• W2023950025 cites W2034177818 @default.
• W2023950025 cites W2036587414 @default.
• W2023950025 cites W2039463309 @default.
• W2023950025 cites W2056530510 @default.
• W2023950025 cites W2058737236 @default.
• W2023950025 cites W2060447208 @default.
• W2023950025 cites W2062612693 @default.
• W2023950025 cites W2063877452 @default.
• W2023950025 cites W2064018568 @default.
• W2023950025 cites W2082979850 @default.
• W2023950025 cites W2087393141 @default.
• W2023950025 cites W2091151265 @default.
• W2023950025 cites W2097447643 @default.
• W2023950025 cites W2099907467 @default.
• W2023950025 cites W2102544634 @default.
• W2023950025 cites W2114103020 @default.
• W2023950025 cites W2119250041 @default.
• W2023950025 cites W2149703879 @default.
• W2023950025 cites W2170494099 @default.
• W2023950025 cites W2322489293 @default.
• W2023950025 doi "https://doi.org/10.1074/jbc.274.53.38189" @default.
• W2023950025 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10608892" @default.
• W2023950025 hasPublicationYear "1999" @default.
• W2023950025 type Work @default.
• W2023950025 sameAs 2023950025 @default.
• W2023950025 citedByCount "265" @default.
• W2023950025 countsByYear W20239500252012 @default.
• W2023950025 countsByYear W20239500252013 @default.
• W2023950025 countsByYear W20239500252014 @default.
• W2023950025 countsByYear W20239500252015 @default.
• W2023950025 countsByYear W20239500252016 @default.
• W2023950025 countsByYear W20239500252017 @default.
• W2023950025 countsByYear W20239500252018 @default.
• W2023950025 countsByYear W20239500252019 @default.
• W2023950025 countsByYear W20239500252020 @default.
• W2023950025 countsByYear W20239500252021 @default.
• W2023950025 countsByYear W20239500252022 @default.
• W2023950025 countsByYear W20239500252023 @default.
• W2023950025 crossrefType "journal-article" @default.
• W2023950025 hasAuthorship W2023950025A5015092350 @default.
• W2023950025 hasAuthorship W2023950025A5045103400 @default.
• W2023950025 hasAuthorship W2023950025A5082814338 @default.
• W2023950025 hasAuthorship W2023950025A5084045642 @default.
• W2023950025 hasBestOaLocation W20239500251 @default.
• W2023950025 hasConcept C104317684 @default.
• W2023950025 hasConcept C11804247 @default.
• W2023950025 hasConcept C12554922 @default.
• W2023950025 hasConcept C185592680 @default.
• W2023950025 hasConcept C2776192174 @default.
• W2023950025 hasConcept C2777221213 @default.
• W2023950025 hasConcept C55493867 @default.
• W2023950025 hasConcept C70721500 @default.
• W2023950025 hasConcept C86803240 @default.
• W2023950025 hasConcept C95444343 @default.
• W2023950025 hasConceptScore W2023950025C104317684 @default.
• W2023950025 hasConceptScore W2023950025C11804247 @default.
• W2023950025 hasConceptScore W2023950025C12554922 @default.
• W2023950025 hasConceptScore W2023950025C185592680 @default.
• W2023950025 hasConceptScore W2023950025C2776192174 @default.
• W2023950025 hasConceptScore W2023950025C2777221213 @default.
• W2023950025 hasConceptScore W2023950025C55493867 @default.
• W2023950025 hasConceptScore W2023950025C70721500 @default.
• W2023950025 hasConceptScore W2023950025C86803240 @default.
• W2023950025 hasConceptScore W2023950025C95444343 @default.
• W2023950025 hasIssue "53" @default.
• W2023950025 hasLocation W20239500251 @default.
• W2023950025 hasOpenAccess W2023950025 @default.
• W2023950025 hasPrimaryLocation W20239500251 @default.
• W2023950025 hasRelatedWork W1981067307 @default.
• W2023950025 hasRelatedWork W2030430397 @default.
• W2023950025 hasRelatedWork W2072238097 @default.

• next