FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2024012002> ?p ?o ?g. }

• W2024012002 endingPage "14666" @default.
• W2024012002 startingPage "14659" @default.
• W2024012002 abstract "Glucosinolates are natural plant products gaining increasing interest as cancer-preventing agents and crop protectants. Similar to cyanogenic glucosides, glucosinolates are derived from amino acids and have aldoximes as intermediates. We report cloning and characterization of cytochrome P450 CYP79A2 involved in aldoxime formation in the glucosinolate-producing Arabidopsis thaliana L. The CYP79A2 cDNA was cloned by polymerase chain reaction, and CYP79A2 was functionally expressed in Escherichia coli. Characterization of the recombinant protein shows that CYP79A2 is an N-hydroxylase convertingl-phenylalanine into phenylacetaldoxime, the precursor of benzylglucosinolate. Transgenic A. thaliana constitutively expressing CYP79A2 accumulate high levels of benzylglucosinolate. CYP79A2 expressed in E. coli has a K mof 6.7 μmol liter−1 for l-phenylalanine. Neither l-tyrosine, l-tryptophan,l-methionine, nor dl-homophenylalanine are metabolized by CYP79A2, indicating that the enzyme has a narrow substrate specificity. CYP79A2 is the first enzyme shown to catalyze the conversion of an amino acid to the aldoxime in the biosynthesis of glucosinolates. Our data provide the first conclusive evidence that evolutionarily conserved cytochromes P450 catalyze this step common for the biosynthetic pathways of glucosinolates and cyanogenic glucosides. This strongly indicates that the biosynthesis of glucosinolates has evolved based on a cyanogenic predisposition. Glucosinolates are natural plant products gaining increasing interest as cancer-preventing agents and crop protectants. Similar to cyanogenic glucosides, glucosinolates are derived from amino acids and have aldoximes as intermediates. We report cloning and characterization of cytochrome P450 CYP79A2 involved in aldoxime formation in the glucosinolate-producing Arabidopsis thaliana L. The CYP79A2 cDNA was cloned by polymerase chain reaction, and CYP79A2 was functionally expressed in Escherichia coli. Characterization of the recombinant protein shows that CYP79A2 is an N-hydroxylase convertingl-phenylalanine into phenylacetaldoxime, the precursor of benzylglucosinolate. Transgenic A. thaliana constitutively expressing CYP79A2 accumulate high levels of benzylglucosinolate. CYP79A2 expressed in E. coli has a K mof 6.7 μmol liter−1 for l-phenylalanine. Neither l-tyrosine, l-tryptophan,l-methionine, nor dl-homophenylalanine are metabolized by CYP79A2, indicating that the enzyme has a narrow substrate specificity. CYP79A2 is the first enzyme shown to catalyze the conversion of an amino acid to the aldoxime in the biosynthesis of glucosinolates. Our data provide the first conclusive evidence that evolutionarily conserved cytochromes P450 catalyze this step common for the biosynthetic pathways of glucosinolates and cyanogenic glucosides. This strongly indicates that the biosynthesis of glucosinolates has evolved based on a cyanogenic predisposition. cauliflower mosaic virus 35S Arabidopsis Biological Resource Center gas chromatography-mass spectrometry polymerase chain reaction high pressure liquid chromatography Glucosinolates are amino acid-derived, secondary plant products containing a sulfate and a thioglucose moiety. Glucosinolates are found throughout the order Capparales, which includes agriculturally important crops of the Brassicaceae family such as oilseed rape and Brassica forages and vegetables, and the model plant Arabidopsis thaliana L. Upon tissue damage, glucosinolates are rapidly hydrolyzed to biologically active degradation products by the thioglucosidase myrosinase (EC 3.2.3.1). Glucosinolates or rather their degradation products defend plants against insect and fungal attack (1.Fenwick G.R. Heaney R.K. Mullin W.J. Crit. Rev. Food. Sci. Nutr. 1983; 18: 123-201Crossref PubMed Scopus (1187) Google Scholar, 2.Chew F.S. Cutler H.G. Biologically Active Natural Products. American Chemical Society, Washington, D.C.1988: 155-181Google Scholar) and serve as attractants to insects that are specialized feeders on Brassicaceae (3.Stadler E. Entomol. Exp. Appl. 1978; 24: 711-720Crossref Scopus (53) Google Scholar). The degradation products have toxic as well as protective effects in higher animals and humans (1.Fenwick G.R. Heaney R.K. Mullin W.J. Crit. Rev. Food. Sci. Nutr. 1983; 18: 123-201Crossref PubMed Scopus (1187) Google Scholar). Antinutritional effects such as growth retardation caused by consumption of large amounts of rape seed meal have an economic impact, as they restrict the use of this protein-rich animal feed. Anticarcinogenic activity has been documented by pharmacological studies for several degradation products of glucosinolates, e.g. for sulforaphane, a degradation product of 4-methylsulfinylbutylglucosinolate from broccoli sprouts (4.Zhang Y. Talalay P. Cho C.G. Posner G.H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 2399-2403Crossref PubMed Scopus (1513) Google Scholar). Metabolic engineering of the biosynthetic pathways of glucosinolates would open the possibility to tissue-specifically regulate and optimize the level of individual glucosinolates to improve the nutritional value of a given crop. To date, more than 100 different glucosinolates have been identified. They are grouped into aliphatic, aromatic, and indolyl glucosinolates, depending on whether they are derived from aliphatic amino acids, phenylalanine and tyrosine, or tryptophan. The amino acid often undergoes a series of chain elongations prior to entering the biosynthetic pathway, and the glucosinolate product is often subject to secondary modifications such as hydroxylations, methylations, and oxidations, giving rise to the structural diversity of glucosinolates.A. thaliana cv. Columbia has been shown to contain 23 different glucosinolates derived from tryptophan, the chain-elongated phenylalanine homologue homophenylalanine, and several chain-elongated methionine homologues (5.Hogge L.R. Reed D.W. Underhill E.W. Haughn G.W. J. Chromatogr. 1988; 26: 551-556Google Scholar). Although not many genes of the glucosinolate biosynthetic pathway have been identified, many of the intermediates and some of the enzymes involved are known. In vivo biosynthetic studies have previously shown that N-hydroxyamino acids, aldoximes, thiohydroximates, and desulfoglucosinolates are precursors of glucosinolates (for review, see Ref. 6.Halkier B.A. Ikan R. Naturally Occurring Glycosides: Chemistry, Distribution and Biological Properties. John Wiley & Sons Ltd., Chichester, United Kingdom1999: 193-223Google Scholar). The enzymes catalyzing the last two steps in the pathway, UDPG:thiohydroximate glucosyltransferase (EC 2.4.1.-) and 3′-phosphoadenosine 5′-phosphosulfate:desulfoglucosinolate sulfotransferase (EC 2.8.2.-), have been purified and shown to be nonspecific with respect to the nature of the side chain (7.Glendening T.M. Poulton J.E. Plant Physiol. 1988; 86: 319-321Crossref PubMed Google Scholar, 8.Jain J.C. GrootWassink J.W.D. Kolenovsky A.D. Underhill E.W. Phytochemistry. 1990; 29: 1425-1428Crossref Scopus (19) Google Scholar, 9.Reed D.W. Davin L. Jain J.C. DeLuca V. Nelson L. Underhill E.W. Arch. Biochem. Biophys. 1993; 305: 526-532Crossref PubMed Scopus (28) Google Scholar, 10.Guo L. Poulton J.E. Phytochemistry. 1994; 36: 1133-1138Crossref Scopus (15) Google Scholar). The sulfur-donating enzyme has not been characterized, but feeding experiments suggest that cysteine is the sulfur donor (11.Matsuo M. Chem. Pharm. Bull. 1968; 16: 1128-1129Crossref PubMed Scopus (6) Google Scholar). The nature of the enzymes catalyzing the conversion of amino acids to aldoximes has been the subject of many discussions. Independent biochemical studies have indicated that three different enzyme systems are involved in this step, namely cytochrome P450-dependent monooxygenases, flavin-containing monooxygenases, and peroxidases (12.Du L. Halkier B.A. Trends Plant Sci. 1997; 2: 425-431Abstract Full Text PDF Google Scholar). The aromatic amino acids (tyrosine and phenylalanine) are converted to the corresponding aldoximes by cytochrome P450-dependent monooxygenases in microsomes isolated from Sinapis alba L., Tropaeolum majus L., and Carica papaya L. (13.Du L. Lykkesfeldt J. Olsen C.E. Halkier B.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 12505-12509Crossref PubMed Scopus (66) Google Scholar, 14.Du L. Halkier B.A. Plant Physiol. 1996; 111: 831-837Crossref PubMed Scopus (36) Google Scholar, 15.Bennett R.N. Kiddle G. Wallsgrove R.M. Phytochemistry. 1997; 45: 59-66Crossref Scopus (68) Google Scholar, 16.Bennett R.N. Kiddle G. Wallsgrove R.M. Plant Physiol. 1997; 114: 1283-1291Crossref PubMed Scopus (25) Google Scholar). Conversion of homophenylalanine and chain elongated methionine homologues into the corresponding aldoximes by microsomal preparations ofBrassica spp. and S. alba has been shown to be cytochrome P450-independent and suggested to be catalyzed by flavin-containing monooxygenases (16.Bennett R.N. Kiddle G. Wallsgrove R.M. Plant Physiol. 1997; 114: 1283-1291Crossref PubMed Scopus (25) Google Scholar, 17.Bennett R. Donald A. Dawson G. Hick A. Wallsgrove R. Plant Physiol. 1993; 102: 1307-1312Crossref PubMed Scopus (29) Google Scholar, 18.Bennett R.N. Hick A.J. Dawson G.W. Wallsgrove R.M. Plant Physiol. 1995; 109: 299-305Crossref PubMed Scopus (28) Google Scholar, 19.Bennett R.N. Kiddle G. Hick A.J. Dawson G.W. Wallsgrove R.M. Plant Cell Environ. 1996; 19: 801-812Crossref Scopus (36) Google Scholar). The formation of indole-3-acetaldoxime from tryptophan in the biosynthesis of indoleglucosinolates has been shown to be catalyzed by a plasma membrane-bound peroxidase in microsomes from Chinese cabbage (Brassica campestris ssp. pekinensis) (20.Ludwig-Müller J. Hilgenberg W. Physiol. Plant. 1988; 74: 240-250Crossref Scopus (80) Google Scholar). In the biosynthesis of cyanogenic glucosides, cytochromes P450 of the CYP79 family catalyze the formation of aldoximes from amino acids (21.Sibbesen O. Koch B. Halkier B.A. Møller B.L. J. Biol. Chem. 1995; 270: 3506-3511Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar, 22.Koch B. Sibbesen O. Halkier B.A. Møller B.L. Arch. Biochem. Biophys. 1995; 323: 177-186Crossref PubMed Scopus (111) Google Scholar, 23.Nielsen, J. S., and Møller, B. L. (2000) Plant Physiol., in pressGoogle Scholar, 24.Andersen M.D. Busk P.K. Svendsen I. Møller B.L. J. Biol. Chem. 2000; 275: 1966-1975Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar). Several CYP79 homologues have previously been identified in glucosinolate-producing plants (25.Bak S. Nielsen H.L. Halkier B.A. Plant Mol. Biol. 1998; 38: 725-734Crossref PubMed Scopus (94) Google Scholar), but their function has never been determined. In the present paper, we report cloning and functional expression of the cytochrome P450 CYP79A2 from A. thaliana. We show that CYP79A2 catalyzes the conversion ofl-phenylalanine to phenylacetaldoxime and that transgenicA. thaliana expressing CYP79A2 under control of CaMV35S1 promoter accumulate high levels of benzylglucosinolate. Our data are consistent with the involvement of CYP79A2 in the biosynthesis of benzylglucosinolate inA. thaliana. The following PCR primers (Fig. 1) were designed from the genomic CYP79A2 sequence (GenBank accession no. AB010692; Arabidopsis thaliana L. cv. Columbia) (added restriction sites are underlined, sequence encoding CYP17A is indicated by italics): A2F1 (5′-GTGCATATGCTTGACTCCACCCCAATG), A2R1 (5′-ATGCATTTTTCTAGTAATCTTTACGCTC), A2F2 (5′-CGTGAATTCCATATGCTCGCGTTTATTATAGGTTTGC), A2R2 (5′-CGGAAGCTTATTAGGTTGGATACACATGT), A2R3 (5′-CGTCACTTGTGCTTTGATCTCTTC), A2F3 (5′-GAACTAATGTTGGCGACGGTTGAT), A2FX1 (5′-CGTGAATTCCATATG GCTCTGTTATTAGCAGTTTTTCTCGCGTTTATTATAGGTTTG), A2FX2 (5′-CGTGAATTCCATATG GCTCTGTTATTAGCAGTTTTTCTTCTTCTTGCATTAACTATG), A2R4 (5′-CATCTCGAGTCTTCTTCCACTGCTCTCCTT), A2FX3 (5′-TTAATCGGAAACCTACC). In addition, the following primers were used: 17AF (5′-CGTGAATTCCATATG GCTCTGTTATTAGCTGTT), A1R (5′-GGGCCACGGCACGGGACC). PCR was performed on phage DNA representing 2.5 × 107 plaque-forming units of theA. thaliana L. (cv. Wassilewskija) silique cDNA library CD4–12 (kindly provided by Dr. Linda A. Castle and Dr. David W. Meinke, Department of Botany, Oklohoma State University, Stillwater, OK, and ABRC) using primers A2F1/A2R1. PCR reactions were set up in a total volume of 50 μl in Expand HF buffer with 1.5 mmMgCl2 (Roche Molecular Biochemicals) supplemented with 200 μm dNTPs, 50 pmol of each primer, and 5% (v/v) Me2SO. After incubation of the reactions at 97 °C for 3 min, 2.6 units of Expand High Fidelity PCR system (Roche Molecular Biochemicals) were added and 35 cycles of 90 s at 95 °C, 60 s at 65 °C, 120 s at 70 °C were run. 0.5 μl of the reaction were subjected to nested PCR with primers A2F2/A2R2 using the same PCR conditions. PCR fragments of the expected size were excised from an agarose gel and cloned intoEcoRI/HindIII-digested pYX223 (R&D Systems), and the inserts of 10 clones derived from two nested PCR reactions were sequenced. Sequencing was performed using a Thermo Sequence fluorescent-labeled primer cycle sequencing kit (7-deaza-dGTP) (Amersham Pharmacia Biotech) and analyzed on an ALF-Express DNA sequencer (Amersham Pharmacia Biotech). Sequence computer analysis was done with programs of the GCG Wisconsin sequence analysis package. The GAP program was used with a gap creation penalty of 8 and a gap extension penalty of 2 to compare pairs of sequences. The splice site prediction was done using NetPlantGene (26.Hebsgaard S.M. Korning P.G. Tolstrup N. Engelbrecht J. Rouze P. Brunak S. Nucleic Acids Res. 1996; 24: 3439-3452Crossref PubMed Scopus (653) Google Scholar). Expression constructs were derived from a CYP79A2 cDNA, which had been obtained by fusion of the two CYP79A2 exons generated from genomic DNA of Arabidopsis thaliana L. The two exons were amplified by PCR with primers A2F2/A2R3 and A2F3/A2R2, respectively, using 1.25 units of Pwo polymerase (Roche Molecular Biochemicals) and 4 μg of template DNA. PCR reactions were set up in a total volume of 50 μl in Pwo polymerase PCR buffer with 2 mm MgSO4 (Roche Molecular Biochemicals) supplemented with 200 μm dNTPs, 50 pmol of each primer, and 5 (v/v) % Me2SO. After incubation of the reactions at 94 °C for 3 min, 30 PCR cycles of 20 s at 94 °C, 10 s at 60 °C, and 30 s at 72 °C were run. After digestion of the PCR fragments with EcoRI (exon 1) and HindIII (exon 2), the blunt ends generated with primers A2R3 and A2F3 andPwo polymerase were phosphorylated with T4 polynucleotide kinase (New England Biolabs). The two exons were then ligated intoEcoRI/HindIII-digested pYX223. The cloned cDNA was sequenced to exclude incorporation of PCR errors. Four expression constructs (Fig. 2) were made in the expression vector pSP19g10L (Ref. 27.Barnes H. Methods Enzymol. 1996; 272: 3-14Crossref PubMed Google Scholar; kindly provided by Dr. Henry Barnes, Synthetic Genetics/Immune Complex Inc., San Diego, CA): 79A2 (“native”), 17A(1–8)79A2 (“modified”), 17A(1–8)79A2Δ(1–8)(“truncated-modified”), and 17A(1–8)79A1(25–74)79A2Δ(1–40) (“chimeric”) (79A2: CYP79A2; 17A(1–8): modified N terminus of CYP17A, MALLLAVF (Ref. 28.Barnes H. Arlotto M.P. Watermann M.R. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 5597-5601Crossref PubMed Scopus (539) Google Scholar); 79A1(25–74): amino acids 25–74 of CYP79A1 (Ref. 22.Koch B. Sibbesen O. Halkier B.A. Møller B.L. Arch. Biochem. Biophys. 1995; 323: 177-186Crossref PubMed Scopus (111) Google Scholar)). The N-terminal modifications were introduced by generating PCR fragments from the ATG start codon to the PstI site of the CYP79A2 cDNA (Fig. 1). These fragments were ligated with the PstI/HindIII fragment of theCYP79A2 cDNA (Fig. 1) andEcoRI/HindIII-digested pYX223. For the modified and the truncated modified CYP79A2, primers A2FX1/A2R4 and A2FX2/A2R4, respectively, were used. The fusion with the N terminus of CYP79A1 was made by blunt-end ligation of a PCR fragment generated from theCYP79A1Δ(1–25) bov cDNA (29.Halkier B.A. Nielsen H. Koch B. Møller B.L. Arch. Biochem. Biophys. 1995; 322: 369-377Crossref PubMed Scopus (85) Google Scholar) with primers 17AF/A1R with a PCR fragment generated from the CYP79A2cDNA with primers A2FX3/A2R4. PCR products were cloned and sequenced to exclude incorporation of PCR errors. The differentCYP79A2 cDNAs were excised from pYX223 by digestion withNdeI and HindIII and ligated intoNdeI/HindIII-digested pSP19g10L. E. coli cells of strain JM109 transformed with the expression constructs were grown overnight in LB medium supplemented with 100 μg ml−1ampicillin and used to inoculate 100 ml of modified TB medium containing 50 μg ml−1 ampicillin, 1 mmthiamine, 75 μg ml−1 δ-aminolevulinic acid, and 1 mm isopropyl-β-d-thiogalactoside (28.Barnes H. Arlotto M.P. Watermann M.R. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 5597-5601Crossref PubMed Scopus (539) Google Scholar). The cells were grown at 28 °C for 65 h at 125 rpm. Cells from 75 ml of culture were pelleted and resuspended in buffer composed of 0.1m Tris-HCl, pH 7.6, 0.5 mm EDTA, 250 mm sucrose, and 250 μm phenylmethylsulfonyl fluoride. Lysozyme was added to a final concentration of 100 μg ml−1. After incubation for 30 min at 4 °C, magnesium acetate was added to a final concentration of 10 mm. Spheroplasts were pelleted, resuspended in 5 ml of buffer composed of 10 mm Tris-HCl, pH 7.5, 14 mm magnesium acetate, and 60 mm potassium acetate, pH 7.4, and homogenized in a Potter-Elvehjem homogenizer. After DNase and RNase treatment, glycerol was added to a final concentration of 29%. Temperature-induced Triton X-114 phase partitioning was performed as described previously (29.Halkier B.A. Nielsen H. Koch B. Møller B.L. Arch. Biochem. Biophys. 1995; 322: 369-377Crossref PubMed Scopus (85) Google Scholar). The Triton X-114-rich phase was analyzed by SDS-polyacrylamide gel electrophoresis. Fe2+·COversus Fe2+ difference spectroscopy (30.Omura T. Sato R. J. Biol. Chem. 1964; 239: 2370-2378Abstract Full Text PDF PubMed Google Scholar) was performed on 100 μl of E. coli spheroplasts resuspended in 900 μl of buffer containing 50 mm KPi, pH 7.5, 2 mm EDTA, 20% (v/v) glycerol, 0.2% (v/v) Triton X-100, and a few grains of sodium dithionite. The solubilizate was distributed between two cuvettes, and a base line was recorded between 400 and 500 nm on a SLM Aminco DW-2000 TM spectrophotometer (SLM Instruments, Urbana, IL). The sample cuvette was flushed with CO for 1 min, and the difference spectrum was recorded. The amount of functional cytochrome P450 was estimated, based on an absorption coefficient of 91 l mmol−1 cm−1. The activity of CYP79A2 was measured in E. coli spheroplasts reconstituted with NADPH:cytochrome P450 oxidoreductase purified from Sorghum bicolor (L.) Moench as described previously (21.Sibbesen O. Koch B. Halkier B.A. Møller B.L. J. Biol. Chem. 1995; 270: 3506-3511Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar). In a typical enzyme assay, 5 μl of spheroplasts and 4 μl of NADPH:cytochrome P450 reductase (equivalent to 0.04 units defined as 1 μmol of cytochrome c min−1) were incubated with 3.3 μml-[U-14C]phenylalanine (453 mCi mmol−1) in buffer containing 30 mmKPi, pH 7.5, 4 mm NADPH, 3 mmreduced glutathione, 0.042% (v/v) Tween 80, and 1 mg ml−1l-α-dilauroyl phosphatidylcholine in a total volume of 30 μl. To study substrate specificity, 3.7 μml-[U-14C]tyrosine (449 mCi mmol−1), 0.1 mml-[methyl-14C]methionine (56 mCi mmol−1), and 1 mml-[5-3H]tryptophan (33 Ci mmol−1), respectively, were used instead ofl-[U-14C]phenylalanine. After incubation at 26 °C for 4 h, half of the reaction mixture was analyzed by thin layer chromatography on Silica Gel 60 F254 sheets (Merck) using toluene:ethyl acetate (5:1, v/v) as eluent. Radioactive bands (14C) were visualized and quantified by STORM 840 PhosphorImager (Molecular Dynamics, Sunnyvale, CA). Radioactive bands (3H) were visualized by autoradiography. Product formation from l-[U-14C]phenylalanine was linear with time within the first 2 h of incubation as determined using time points 30 min, 1 h, 2 h, and 6 h. For estimation of K m and V maxvalues, reaction mixtures were incubated for 2 h at 26 °C. For GC-MS analysis, 450 μl of reaction mixture containing 33 μml-phenylalanine (Sigma) or 33 μm homophenylalanine were incubated for 4 h at 26 °C and extracted twice with a total volume of 600 μl of chloroform (Normapur, May and Baker). The organic phases were combined and evaporated to dryness. The residue was dissolved in 15 μl of chloroform and analyzed by GC-MS. GC-MS analysis was performed on an HP5890 Series II gas chromatograph directly coupled to a Jeol JMS-AX505W mass spectrometer. An SGE column (BPX5, 25 m × 0.25 mm, 0.25-μm film thickness) was used (head pressure 100 kilopascals, splitless injection). The oven temperature program was as follows: 80 °C for 3 min, 80 °C to 180 °C at 5 °C min−1, 180 °C to 300 °C at 20 °C min−1, 300 °C for 10 min. The ion source was run in EI mode (70 eV) at 200 °C. The retention times of the (E)- and (Z)-isomers of phenylacetaldoxime were 12.43 and 13.06 min. The two isomers had identical fragmentation patterns withm/z 135, 117, and 91 as the most prominent peaks. Radiolabeled amino acids were purchased from Amersham Pharmacia Biotech. Homophenylalanine and 3-phenylpropanaldoxime were kindly provided by Prof. John A. Pickett (IACR Rothamsted, Rothamsted, United Kingdom), and phenylacetaldoxime (mixture of the (E)- and (Z)-isomers) was a gift from Dr. Jens Lykkesfeldt (KVL, Copenhagen, Denmark). A. thaliana L. cv. Columbia was used for all experiments. Plants were grown in a controlled-environment Arabidopsis Chamber (Percival AR-60 I, Boone, IA) at a photosynthetic flux of 100–120 μmol of photons m−2 s−1, 20 °C, and 70% relative humidity. The photoperiod was 12 h for plants used for transformation and 8 h for plants used for biochemical analysis. For expression of CYP79A2 under control of the CaMV35S promoter inA. thaliana, the native full-length CYP79A2cDNA was introduced into EcoRI/KpnI-digested pRT101 (31.Töpfer R. Matzeit V. Gronenborn B. Schell J. Steinbiss H.H. Nucleic Acids Res. 1987; 15: 5890Crossref PubMed Scopus (407) Google Scholar) via several subcloning steps. The expression cassette was excised by HindIII digestion and transferred to pPZP111 (32.Hajdukiewicz P. Svab Z. Maliga P. Plant Mol. Biol. 1994; 25: 989-994Crossref PubMed Scopus (1328) Google Scholar). Agrobacterium tumefaciens strain C58 (33.Zambryski P. Genetello C. Leemans J. Van Montagu M. Schell J. EMBO J. 1983; 2: 2143-2150Crossref PubMed Google Scholar) transformed with this construct was used for plant transformation by floral dip (34.Clough S.J. Bent A.F. Plant J. 1998; 16: 735-743Crossref PubMed Google Scholar) using 0.005% (v/v) Silwet L-77 and 5% (w/v) sucrose in 10 mm MgCl2. Seeds were germinated on Murashige and Skoog medium supplemented with 50 μg ml−1 kanamycin, 2% (w/v) sucrose, and 0.9% (w/v) agar. Transformants were selected after 2 weeks and transferred to soil. Rosette leaves (five to eight leaves of different age from each plant) were harvested from 6-week-old plants (nine transgenic plants and three wild-type plants), immediately frozen in liquid nitrogen and freeze-dried for 48 h. Desulfoglucosinolates were analyzed as described in Ref. 35.Sørensen H. Shahidi F. Canola and Rapeseed: Production, Chemistry, Nutrition and Processing Technology. Van Nostrand Reinhold, New York1990: 149-172Crossref Google Scholar. Briefly, freeze-dried material (2–5 mg) was homogenized in 3.5 ml of boiling 70% (v/v) methanol by a Polytron homogenizer for 1 min, 10 μl of internal standard (5 mm p-hydroxybenzylglucosinolate; Bioraf Denmark) were added, and homogenization was continued for another 1 min. Plant material was pelleted, and the pellet was re-extracted with 3.5 ml of boiling 70% (v/v) methanol for 1 min using a Polytron homogenizer. Plant material was pelleted, washed in 3.5 ml of 70% (v/v) methanol, and centrifuged. The supernatants were pooled and loaded on a DEAE-Sephadex A-25 (Amersham Pharmacia Biotech) column equilibrated as follows; 25 mg of DEAE-Sephadex A-25 were swollen overnight in 1 ml of 0.5 macetate buffer, pH 5, packed into a 5-ml pipette tip, and washed with 1 ml of water. The plant extract was loaded, and the column was washed with 2 ml of 70% (v/v) methanol, 2 ml of water, and 0.5 ml of 0.02m acetate buffer, pH 5. Helix pomatia sulfatase (type H-1, Sigma; 0.1 ml, 2.5 mg ml−1 in 0.02m acetate buffer, pH 5) were applied, and the column was left at room temperature for 16 h. Elution was carried out with 2 ml of water. The eluate was dried in vacuo, the residue dissolved in 150 μl of water, and 100 μl were subjected to HPLC on a Shimadzu LC-10A Tvp equipped with a Supelcosil LC-ABZ 59142 C18 column (25 cm × 4.6 mm, 5 mm; Supelco) and a SPD-M10AVP photodiode array detector (Shimadzu). The flow rate was 1 ml min−1. Elution with water for 2 min was followed by elution with a linear gradient from 0% to 60% methanol in water (48 min), a linear gradient from 60% to 100% methanol in water (3 min), and with 100% methanol (3 min). The assignment of peaks was based on retention times and UV spectra compared with standard compounds. Glucosinolates were quantified in relation to the internal standard and by use of the response factors as described previously (36.Buchner R. Wathelet J.P. Glucosinolates in Rapeseed: Analytical Aspects. Martinus Nijhoff Publishers, Kluwer Academic Publishers Group, Dordrecht, The Netherlands1987: 50-58Google Scholar, 37.Haughn G.W. Davin L. Giblin M. Underhill E.W. Plant Physiol. 1991; 97: 217-226Crossref PubMed Scopus (135) Google Scholar). In the analysis of rosette leaves, the term “total glucosinolate content” refers to the molar amount of the five major glucosinolates (4-methylsulfinylbutylglucosinolate, 4-methylthiobutylglucosinolate, 8-methylsulfinyloctylglucosinolate, indol-3-ylmethylglucosinolate, and 4-methoxyindol-3-ylglucosinolate), which account for 85% of the glucosinolate content in rosette leaves of wild-type A. thaliana (37.Haughn G.W. Davin L. Giblin M. Underhill E.W. Plant Physiol. 1991; 97: 217-226Crossref PubMed Scopus (135) Google Scholar) and benzylglucosinolate. The glucosinolate content of seeds harvested from T1 plants 10, 13, and 14 was analyzed and compared with the glucosinolate content of wild-type seeds. Twelve to thirty milligrams of seeds were extracted and subjected to HPLC analysis as described above (with the exception that lyophilization of the tissue was omitted). In the analysis of seeds, the term total glucosinolate content refers to the molar amount of the 10 major glucosinolates (3-hydroxypropylglucosinolate, 4-hydroxybutylglucosinolate, 4-methylsulfinylbutylglucosinolate, 4-methylthiobutylglucosinolate, 8-methylsulfinyloctylglucosinolate, 7-methylthioheptylglucosinolate, 8-methylthiooctylglucosinolate, indol-3-ylmethylglucosinolate, 3-benzoyloxypropylglucosinolate, and 4-benzoyloxybutylglucosinolate), which account for more than 90% of the glucosinolate content in seeds of wild-type A. thaliana(37.Haughn G.W. Davin L. Giblin M. Underhill E.W. Plant Physiol. 1991; 97: 217-226Crossref PubMed Scopus (135) Google Scholar) and benzylglucosinolate. CYP79A2 (GenBank accession no. AB010692 (11,000–13,200 region)) is one of severalCYP79 homologues identified in the genome of A. thaliana. According to a computer-aided splice site prediction (26.Hebsgaard S.M. Korning P.G. Tolstrup N. Engelbrecht J. Rouze P. Brunak S. Nucleic Acids Res. 1996; 24: 3439-3452Crossref PubMed Scopus (653) Google Scholar), CYP79A2 contains one intron. This intron, which is characteristic for A-type cytochromes P450 (38.Paquette, S. M., Bak, S., and Feyereisen, R. (2000) DNA Cell Biol., in pressGoogle Scholar), is shared by all members of the CYP79 family known to date. Although it is the only intron in CYP79A2, CYP79B2 andCYP79B3, other members of the CYP79 family have one or two additional introns. This may suggest that CYP79A2is one of the ancient members of the family. Using a PCR approach, we have isolated a full-length CYP79A2 cDNA from anA. thaliana silique cDNA library. The sequence of the cDNA confirmed the splice site prediction (Fig.1). The reading frame of theCYP79A2 cDNA has two potential ATG start codons, one positioned 15 base pairs downstream of a stop codon in the 5′-untranslated region and another one 15 base pairs further downstream. We have used a cDNA starting with the second ATG codon for all further studies. This cDNA encodes a protein of 523 amino acids, which has 64% similarity and 53% identity to CYP79A1 involved in the biosynthesis of the cyanogenic glucoside dhurrin (22.Koch B. Sibbesen O. Halkier B.A. Møller B.L. Arch. Biochem. Biophys. 1995; 323: 177-186Crossref PubMed Scopus (111) Google Scholar). PCR amplification of a full-length CYP79A2 cDNA from the silique cDNA library required a total of 70 PCR cycles resulting in incorporation of PCR errors. PCR errors at different positions were verified by sequencing of 10 different cloned PCR products, each of which contained at least a single PCR error. Consequently, these cDNAs were not suitable for expression of the protein. PCR amplification of fragments of the CYP79A2 cDNA from theA. thaliana λPRL2 cDNA library (CD4–7 (Ref. 39.D'Alessio J.M. Bebee R. Hartley J.L. Noon M.C. Polayes D. Focus. 1992; 14: 76-79Google Scholar), kindly provided by ABRC) and an A. thaliana whole plant library (Stratagene, 937010) was unsuccessful. This may indicate that the CYP79A2 mRNA is expressed at very low levels. An alternative approach, in which the two exons of the CYP79A2gene were directly PCR-amplified from genomic DNA by relatively few PCR cycles, was applied to clone the CYP79A2 cDNA for protein expression. The property of Pwo polymerase not to add nucleotides to the ends of the PCR product enabled blunt end" @default.
• W2024012002 created "2016-06-24" @default.
• W2024012002 creator A5025475871 @default.
• W2024012002 creator A5042051787 @default.
• W2024012002 date "2000-05-01" @default.
• W2024012002 modified "2023-10-17" @default.
• W2024012002 title "Cytochrome P450 CYP79A2 from Arabidopsis thaliana L. Catalyzes the Conversion of l-Phenylalanine to Phenylacetaldoxime in the Biosynthesis of Benzylglucosinolate" @default.
• W2024012002 cites W1485053222 @default.
• W2024012002 cites W1501460217 @default.
• W2024012002 cites W1501985924 @default.
• W2024012002 cites W1607385190 @default.
• W2024012002 cites W1899760671 @default.
• W2024012002 cites W193914404 @default.
• W2024012002 cites W1951469402 @default.
• W2024012002 cites W1967077010 @default.
• W2024012002 cites W1969084272 @default.
• W2024012002 cites W1990206995 @default.
• W2024012002 cites W1992848865 @default.
• W2024012002 cites W1993597465 @default.
• W2024012002 cites W1998068136 @default.
• W2024012002 cites W2007253437 @default.
• W2024012002 cites W2014558437 @default.
• W2024012002 cites W2017004008 @default.
• W2024012002 cites W2021842042 @default.
• W2024012002 cites W2023209546 @default.
• W2024012002 cites W2025054234 @default.
• W2024012002 cites W2026952659 @default.
• W2024012002 cites W2028016714 @default.
• W2024012002 cites W2029993142 @default.
• W2024012002 cites W2030786725 @default.
• W2024012002 cites W2034064856 @default.
• W2024012002 cites W2041550216 @default.
• W2024012002 cites W2043766198 @default.
• W2024012002 cites W2048082777 @default.
• W2024012002 cites W2050084526 @default.
• W2024012002 cites W2053108602 @default.
• W2024012002 cites W2057547465 @default.
• W2024012002 cites W2062253979 @default.
• W2024012002 cites W2062894009 @default.
• W2024012002 cites W2071905031 @default.
• W2024012002 cites W2074151184 @default.
• W2024012002 cites W2103414939 @default.
• W2024012002 cites W2116122104 @default.
• W2024012002 cites W2116278670 @default.
• W2024012002 cites W2124494060 @default.
• W2024012002 cites W2140828400 @default.
• W2024012002 cites W2144885757 @default.
• W2024012002 cites W2327928239 @default.
• W2024012002 cites W2328538327 @default.
• W2024012002 cites W296793759 @default.
• W2024012002 cites W4318599336 @default.
• W2024012002 doi "https://doi.org/10.1074/jbc.275.19.14659" @default.
• W2024012002 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10799553" @default.
• W2024012002 hasPublicationYear "2000" @default.
• W2024012002 type Work @default.
• W2024012002 sameAs 2024012002 @default.
• W2024012002 citedByCount "237" @default.
• W2024012002 countsByYear W20240120022012 @default.
• W2024012002 countsByYear W20240120022013 @default.
• W2024012002 countsByYear W20240120022014 @default.
• W2024012002 countsByYear W20240120022015 @default.
• W2024012002 countsByYear W20240120022016 @default.
• W2024012002 countsByYear W20240120022017 @default.
• W2024012002 countsByYear W20240120022018 @default.
• W2024012002 countsByYear W20240120022019 @default.
• W2024012002 countsByYear W20240120022020 @default.
• W2024012002 countsByYear W20240120022021 @default.
• W2024012002 countsByYear W20240120022022 @default.
• W2024012002 countsByYear W20240120022023 @default.
• W2024012002 crossrefType "journal-article" @default.
• W2024012002 hasAuthorship W2024012002A5025475871 @default.
• W2024012002 hasAuthorship W2024012002A5042051787 @default.
• W2024012002 hasBestOaLocation W20240120021 @default.
• W2024012002 hasConcept C104317684 @default.
• W2024012002 hasConcept C143065580 @default.
• W2024012002 hasConcept C181199279 @default.
• W2024012002 hasConcept C185592680 @default.
• W2024012002 hasConcept C2775988993 @default.
• W2024012002 hasConcept C2777431362 @default.
• W2024012002 hasConcept C515207424 @default.
• W2024012002 hasConcept C526171541 @default.
• W2024012002 hasConcept C553450214 @default.
• W2024012002 hasConcept C55493867 @default.
• W2024012002 hasConcept C71240020 @default.
• W2024012002 hasConceptScore W2024012002C104317684 @default.
• W2024012002 hasConceptScore W2024012002C143065580 @default.
• W2024012002 hasConceptScore W2024012002C181199279 @default.
• W2024012002 hasConceptScore W2024012002C185592680 @default.
• W2024012002 hasConceptScore W2024012002C2775988993 @default.
• W2024012002 hasConceptScore W2024012002C2777431362 @default.
• W2024012002 hasConceptScore W2024012002C515207424 @default.
• W2024012002 hasConceptScore W2024012002C526171541 @default.
• W2024012002 hasConceptScore W2024012002C553450214 @default.
• W2024012002 hasConceptScore W2024012002C55493867 @default.
• W2024012002 hasConceptScore W2024012002C71240020 @default.
• W2024012002 hasIssue "19" @default.
• W2024012002 hasLocation W20240120021 @default.
• W2024012002 hasOpenAccess W2024012002 @default.

• next