FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2024037712> ?p ?o ?g. }

• W2024037712 endingPage "12516" @default.
• W2024037712 startingPage "12503" @default.
• W2024037712 abstract "N-MYC is a transcription factor that plays an important role in cellular survival in neuroblastoma, and amplification of the N-MYC oncogene is the primary adverse prognostic indicator for neuroblastoma. Focal adhesion kinase (FAK) is a survival factor that has been shown to be overexpressed in many types of human cancers. In this study, we investigated the role of N-MYC regulation of FAK expression in neuroblastoma. We first found a correlation between N-MYC and FAK expression in neuroblastoma. Real time quantitative PCR demonstrated an increase in FAK mRNA abundance in the N-MYC-amplified IMR-32 compared with the nonamplified SK-N-AS neuroblastoma cell lines. FAK protein expression also correlated positively with N-MYC expression in the N-MYC-amplified IMR-32 versus nonamplified SK-N-AS neuroblastoma cell lines. The same results were seen with the isogenic N-MYC+ (Tet–) and N-MYC– (Tet+) neuroblastoma cell lines. Promoter-reporter assays showed that activity of the FAK promoter was increased in the N-MYC-amplified IMR-32 cell line, in the N-MYC-transfected SK-N-AS nonamplified cell line, and in the isogenic N-MYC+ (Tet–) neuroblastoma cell lines compared with the nonamplified and N-MYC-nonexpressing cell lines. We also identified two N-MYC binding sites in the FAK promoter sequence and showed binding of N-MYC transcription factor to the FAK promoter through electrophoretic mobility shift, chromatin immunoprecipitation, and dual luciferase assays. Finally down-regulation of FAK expression in N-MYC-inducible neuroblastoma cell lines with FAK small interfering RNA or a dominant-negative FAK inhibitor (AdFAK-CD) significantly decreased viability and increased apoptosis in the N-MYC+ (Tet–) cells compared with the isogenic N-MYC– (Tet+) cells, demonstrating the biological significance of FAK overexpression in the N-MYC-expressing cell lines. This is the first report linking N-MYC and FAK in neuroblastoma, and it clearly demonstrates that N-MYC induces FAK expression. The results indicate that N-MYC regulation of FAK expression can control cellular functions in isogenic N-MYC–/+ (Tet+/–) neuroblastoma cell lines. N-MYC is a transcription factor that plays an important role in cellular survival in neuroblastoma, and amplification of the N-MYC oncogene is the primary adverse prognostic indicator for neuroblastoma. Focal adhesion kinase (FAK) is a survival factor that has been shown to be overexpressed in many types of human cancers. In this study, we investigated the role of N-MYC regulation of FAK expression in neuroblastoma. We first found a correlation between N-MYC and FAK expression in neuroblastoma. Real time quantitative PCR demonstrated an increase in FAK mRNA abundance in the N-MYC-amplified IMR-32 compared with the nonamplified SK-N-AS neuroblastoma cell lines. FAK protein expression also correlated positively with N-MYC expression in the N-MYC-amplified IMR-32 versus nonamplified SK-N-AS neuroblastoma cell lines. The same results were seen with the isogenic N-MYC+ (Tet–) and N-MYC– (Tet+) neuroblastoma cell lines. Promoter-reporter assays showed that activity of the FAK promoter was increased in the N-MYC-amplified IMR-32 cell line, in the N-MYC-transfected SK-N-AS nonamplified cell line, and in the isogenic N-MYC+ (Tet–) neuroblastoma cell lines compared with the nonamplified and N-MYC-nonexpressing cell lines. We also identified two N-MYC binding sites in the FAK promoter sequence and showed binding of N-MYC transcription factor to the FAK promoter through electrophoretic mobility shift, chromatin immunoprecipitation, and dual luciferase assays. Finally down-regulation of FAK expression in N-MYC-inducible neuroblastoma cell lines with FAK small interfering RNA or a dominant-negative FAK inhibitor (AdFAK-CD) significantly decreased viability and increased apoptosis in the N-MYC+ (Tet–) cells compared with the isogenic N-MYC– (Tet+) cells, demonstrating the biological significance of FAK overexpression in the N-MYC-expressing cell lines. This is the first report linking N-MYC and FAK in neuroblastoma, and it clearly demonstrates that N-MYC induces FAK expression. The results indicate that N-MYC regulation of FAK expression can control cellular functions in isogenic N-MYC–/+ (Tet+/–) neuroblastoma cell lines. N-MYC is a transcription factor important for the control of cellular differentiation and proliferation (1Queva C. Hurlin P.J. Foley K.P. Eisenmann R.N. Oncogene. 1998; 16: 967-977Crossref PubMed Scopus (111) Google Scholar, 2Luscher B. Larsson L.G. Oncogene. 1999; 18: 2955-2966Crossref PubMed Scopus (163) Google Scholar). It is normally expressed in the brain and peripheral nervous system (1Queva C. Hurlin P.J. Foley K.P. Eisenmann R.N. Oncogene. 1998; 16: 967-977Crossref PubMed Scopus (111) Google Scholar). N-MYC has been shown to influence the differentiation of neural crest cells. Early in mouse embryogenesis, N-MYC is present primarily in the migrating neural crest cells, but as the embryo matures, the expression of N-MYC becomes limited to those cells that are undergoing neuronal differentiation (3Wakamatsu Y. Watanabe Y. Nakamura H. Kondoh H. Development. 1997; 124: 1953-1962PubMed Google Scholar). Abnormal expression of N-MYC is most notably associated with the pediatric tumor of neural crest origin, neuroblastoma. Amplification of the N-MYC oncogene is the primary adverse prognostic indicator in human neuroblastoma (4Brodeur G.M. Seeger R.C. Schwab M. Varmus H.E. Bishop J.M. Science. 1984; 224: 1121-1124Crossref PubMed Scopus (1807) Google Scholar, 5Stanton L.W. Schwab M. Bishop J.M. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 1772-1776Crossref PubMed Scopus (132) Google Scholar). The level of N-MYC expression has been shown to correlate with the growth (6Negroni A. Scarpa S. Romeo A. Ferrari S. Modesti A. Raschella G. Cell Growth Differ. 1991; 2: 511-518PubMed Google Scholar, 7Schweigerer L. Breit S. Wenzel A. Tsunamoto K. Ludwig R. Schwab M. Cancer Res. 1990; 15: 4411-4416Google Scholar, 8Gross N. Miescher G. Beck D. Favre S. Beretta C. Int. J. Cancer. 1994; 59: 141-148Crossref PubMed Scopus (20) Google Scholar, 9Schmidt M.L. Salwen H.R. Manohar C.F. Ikegaki N. Cohn S.L. Cell Growth Differ. 1994; 5: 171-178PubMed Google Scholar) and invasiveness (10Goodman L.A. Liu B.C. Thiele C.J. Schmidt M.L. Cohn S.L. Yamashiro J.M. Pai D.S. Ikegaki N. Wada R.K. Clin. Exp. Metastasis. 1997; 15: 130-139Crossref PubMed Scopus (38) Google Scholar) of neuroblastoma cells, and transgenic mice with N-MYC overexpression develop spontaneous neuroblastoma tumors (11Weiss W.A. Aldape K. Mohapatra G. Feuerstein B.G. Bishop J.M. EMBO J. 1997; 16: 2985-2995Crossref PubMed Scopus (620) Google Scholar). In addition, down-regulation of N-MYC with antisense oligonucleotides leads to decreases in both cellular proliferation and in anchorage-independent growth in the neuroblastoma cells (6Negroni A. Scarpa S. Romeo A. Ferrari S. Modesti A. Raschella G. Cell Growth Differ. 1991; 2: 511-518PubMed Google Scholar, 9Schmidt M.L. Salwen H.R. Manohar C.F. Ikegaki N. Cohn S.L. Cell Growth Differ. 1994; 5: 171-178PubMed Google Scholar). Despite this information, the exact function and transcriptional gene targets of N-MYC in neuroblastoma are currently not well characterized (5Stanton L.W. Schwab M. Bishop J.M. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 1772-1776Crossref PubMed Scopus (132) Google Scholar).Focal adhesion kinase (FAK) 3The abbreviations used are: FAK, focal adhesion kinase; ChIP, chromatin immunoprecipitation; siRNA, small interfering RNA; EMSA, electrophoretic mobility shift assay; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Tet, tetracycline. 3The abbreviations used are: FAK, focal adhesion kinase; ChIP, chromatin immunoprecipitation; siRNA, small interfering RNA; EMSA, electrophoretic mobility shift assay; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Tet, tetracycline. is a nonreceptor cytoplasmic 125-kDa protein-tyrosine kinase. Initial studies revealed that both the transcription of FAK mRNA (12Xu L.H. Yang X.H. Bradham C.A. Brenner D.A. Baldwin A.S. Craven R.J. Cance W.G. J. Biol. Chem. 2000; 275: 30597-30604Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar) and the expression of FAK protein (13Xu L.H. Yang X.H. Craven R.J. Cance W.G. Cell Growth Differ. 1998; 9: 999-1005PubMed Google Scholar, 14Golubovskaya V.A. Gross S. Kaur A.S. Wilson R.I. Xu L.H. Yang X.H. Cance W.G. Mol. Cancer Res. 2003; 1: 755-764PubMed Google Scholar, 15Weiner T.M. Liu E.T. Craven R.J. Cance W.G. Lancet. 1993; 342: 1024-1025Abstract PubMed Scopus (311) Google Scholar, 16Weiner T.M. Liu E.T. Craven R.J. Cance W.G. Ann. Surg. Oncol. 1994; 1: 18-27Crossref PubMed Scopus (81) Google Scholar, 17Owens L.V. Xu L. Craven R.J. Dent G.A. Weiner T.M. Kornberg L. Liu E.T. Cance W.G. Cancer Res. 1995; 55: 2752-2755PubMed Google Scholar, 18Owens L.V. Xu L. Dent G.A. Yang X. Sturge G.C. Craven R.J. Cance W.G. Ann. Surg. Oncol. 1996; 3: 100-105Crossref PubMed Scopus (199) Google Scholar, 19Cance W.G. Harris J.E. Iacocca M.V. Roche E. Yang X. Chang J. Simkins S. Xu L. Clin. Cancer Res. 2000; 6: 2417-2423PubMed Google Scholar) are significantly increased in primary and metastatic breast, colon, and thyroid tumors compared with normal tissues and that these changes occur early in tumorigenesis. Real time PCR analysis of colorectal carcinoma and liver metastasis with matched normal colonic tissues demonstrated increased FAK mRNA abundance in the tumors and metastatic tissues compared with control tissues (20Lark A.L. Livasy C.A. Calvo B. Caskey L. Moore D.T. Yang X. Cance W.G. Clin. Cancer Res. 2003; 9: 215-222PubMed Google Scholar), suggesting that the increased FAK expression in human tumors occurs at the level of transcription. Recently the FAK promoter was cloned and characterized, and transcriptional regulation of the FAK promoter has been demonstrated (21Golubovskaya V. Kaur A. Cance W. Biochim. Biophys. Acta. 2004; 1678: 111-125Crossref PubMed Scopus (140) Google Scholar).FAK controls a number of cell signaling pathways including proliferation, viability, motility, and survival (22Schaller M.D. Borgman C.A. Cobb B.S. Vines R.R. Reynolds A.B. Parsons J.T. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5192-5196Crossref PubMed Scopus (1286) Google Scholar, 23Hanks S.K. Polte T.R. BioEssays. 1997; 19: 137-145Crossref PubMed Scopus (440) Google Scholar, 24Zachary I. Int. J. Biochem. Cell Biol. 1997; 29: 929-934Crossref PubMed Scopus (88) Google Scholar, 25Gabarra-Niecko V. Schaller M.D. Dunty J.M. Cancer Metastasis Rev. 2003; 22: 359-374Crossref PubMed Scopus (299) Google Scholar). The inhibition of FAK with antisense oligonucleotides has been shown to cause decreased growth in tumor cells (26Xu L.H. Owens L.V. Sturge G.C. Yang X. Liu E.T. Craven R.J. Cance W.G. Cell Growth Differ. 1996; 7: 413-418PubMed Google Scholar). In addition, FAK inhibition with a dominant-negative FAK protein (FAK-CD) inhibited cell growth in human melanoma cells (12Xu L.H. Yang X.H. Bradham C.A. Brenner D.A. Baldwin A.S. Craven R.J. Cance W.G. J. Biol. Chem. 2000; 275: 30597-30604Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar) and in human breast cancer cell lines (13Xu L.H. Yang X.H. Craven R.J. Cance W.G. Cell Growth Differ. 1998; 9: 999-1005PubMed Google Scholar, 27Golubovskaya V.M. Beviglia L. Xu L.H. Earp H.S. Craven R.J. Cance W. J. Biol. Chem. 2002; 277: 38978-38987Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar). Silencing FAK expression with small interfering RNAs resulted in decreased migration of lung cancer cells (28Han E.K. Mcgonigal T. Wang J. Giranda V.L. Luo Y. Anticancer Res. 2004; 24: 3899-3905PubMed Google Scholar) and glioblastoma cells (29Lipinski C.A. Tran N.L. Menashi E. Rohl C. Kloss J. Bay R.C. Berens M.E. Loftus J.C. Neoplasia. 2005; 7: 435-445Crossref PubMed Scopus (111) Google Scholar). Finally FAK silencing has been shown to lead to apoptosis in human fibroblasts (30Ryu S.J. Cho K.A. Oh Y.S. Park S.C. Apoptosis. 2006; 11: 303-313Crossref PubMed Scopus (27) Google Scholar) and ovarian cancer cells (31Halder J. Landen C.N. Lutgendorf S.K. Li Y. Jennings N.B. Fan D. Nelkin G.M. Schmandt R. Schaller M.D. Sood A.K. Clin. Cancer Res. 2005; 11: 8829-8836Crossref PubMed Scopus (95) Google Scholar).In the current study, we found significant expression of FAK mRNA and protein in neuroblastoma cell lines with N-MYC amplification and overexpression. These findings prompted us to investigate the binding of N-MYC to the FAK promoter and N-MYC regulation of FAK expression. Using the TRANSFAC (National Institutes of Health) (helixweb.nih.gov/transfac/index.html) and MatInspector (Genomatix Software GmbH) software, we analyzed the FAK promoter for the presence of N-MYC binding sites and found two potential sites: site 1 (–67 to –62) and site 2 (–181 to –176) in the P-280 region. By dual luciferase assays we showed that N-MYC-expressing and N-MYC-amplified neuroblastoma cells have increased FAK promoter activity compared with N-MYC-nonexpressing and N-MYC-nonamplified cell lines. We demonstrated that N-MYC binds to these sites both in vitro and in vivo by electrophoretic mobility shift assays (EMSAs) and chromatin immunoprecipitation (ChIP), respectively. Cellular viability studies showed that N-MYC+ (Tet–) cells have increased viability compared with their isogenic N-MYC– (Tet+) counterparts. In addition, inhibition of FAK expression in the N-MYC+/– (Tet–/+) isogenic cell lines with FAK siRNA or FAK dominant-negative AdFAK-CD (12Xu L.H. Yang X.H. Bradham C.A. Brenner D.A. Baldwin A.S. Craven R.J. Cance W.G. J. Biol. Chem. 2000; 275: 30597-30604Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar, 13Xu L.H. Yang X.H. Craven R.J. Cance W.G. Cell Growth Differ. 1998; 9: 999-1005PubMed Google Scholar, 27Golubovskaya V.M. Beviglia L. Xu L.H. Earp H.S. Craven R.J. Cance W. J. Biol. Chem. 2002; 277: 38978-38987Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar) resulted in a significant decrease in viability and a significant increase in apoptosis in the N-MYC+ (Tet–) cells compared with their N-MYC– (Tet+) isogenic counterparts. This is the first study to link N-MYC with FAK in neuroblastoma, and it clearly demonstrates that N-MYC increases FAK expression. The findings in these studies also show a biological advantage to the N-MYC regulation of FAK expression.EXPERIMENTAL PROCEDURESCells, Cell Culture, and Transfections—SK-N-AS, SK-N-DZ, and IMR-32 (32Ucar K. Seeger R.C. Challita P.M. Watanabe C.T. Yen T.L. Morgan J.P. Amado R. Chou E. McCallister T. Barber J.R. Jolly D.J. Reynolds C.P. Gangavalli R. Rosenblatt J.D. Cancer Gene Ther. 1995; 2: 171-181PubMed Google Scholar, 33Zhu X. Wimmer K. Kuick R. Lamb B.J. Motyka S. Jasty R. Castle V.P. Hanash S.M. Neoplasia. 2002; 4: 432-439Crossref PubMed Scopus (23) Google Scholar, 34Nguyen T. Hocker J.E. Thomas W. Smith S.A. Norris M.D. Haber M. Cheung B. Marshall G.M. Biochem. Biophys. Res. Commun. 2003; 302: 462-468Crossref PubMed Scopus (22) Google Scholar) neuroblastoma cells were maintained in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 1 μg/ml penicillin, and 1 μg/ml streptomycin. SK-N-BE(2) (33Zhu X. Wimmer K. Kuick R. Lamb B.J. Motyka S. Jasty R. Castle V.P. Hanash S.M. Neoplasia. 2002; 4: 432-439Crossref PubMed Scopus (23) Google Scholar, 34Nguyen T. Hocker J.E. Thomas W. Smith S.A. Norris M.D. Haber M. Cheung B. Marshall G.M. Biochem. Biophys. Res. Commun. 2003; 302: 462-468Crossref PubMed Scopus (22) Google Scholar) neuroblastoma cells were maintained in a 1:1 mixture of minimum Eagle's medium and Ham's F-12 medium with 10% fetal bovine serum, 1 μg/ml penicillin, and 1 μg/ml streptomycin. The Tet-off N-MYC+/– cell line (Tet-21/N or SHEP-21/N) was generously provided by Dr. S. L. Cohn (Northwestern University's Feinberg School of Medicine, Chicago, IL) with permission from Dr. M. Schwab (Deutsches Krebsforschungszentrum, Heidelberg, Germany) (35Lutz W. Stohr M. Schurmann J. Wenzel A. Lohr A. Schwab M. Oncogene. 1996; 13: 803-812PubMed Google Scholar). These cells were maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum, 1 μg/ml penicillin, and 1 μg/ml streptomycin and grown in the presence or absence of tetracycline (1 μg/ml) for 48–72 h for N-MYC– (Tet+) and N-MYC+ (Tet–) cells, respectively. Transfections of plasmids were done with Lipofectamine (Invitrogen) following the manufacturer's instructions. Equal amounts of DNA were used for each transfection.DNA Constructs—A plasmid encoding the N-MYC protein in a mammalian expression vector was produced by directional cloning of blunt end PCR products into a pcDNA 3.1D/V5-His-TOPO vector (Invitrogen). We used primers for cloning full-length N-MYC (5′-142CACCATGCCGAGCTGCTCCACGTCC) and 3′-end primer for the coexpression of V5 and His6 tags (5′-GCAAGTCCGAGCGTGTTCAATTTTC). All plasmids were sequenced at the Automated DNA Sequencing Facility at the University of Florida, and the expression of selected plasmids was analyzed after transfection into 293 cells with tag-specific and N-MYC-specific antibodies. FAK luciferase promoter constructs P-Basic, P-50, P-109, P-280, P-564, P-723, P-1020, and P-1173 were described in detail previously (21Golubovskaya V. Kaur A. Cance W. Biochim. Biophys. Acta. 2004; 1678: 111-125Crossref PubMed Scopus (140) Google Scholar) and used for dual luciferase promoter-reporter assays as described previously (21Golubovskaya V. Kaur A. Cance W. Biochim. Biophys. Acta. 2004; 1678: 111-125Crossref PubMed Scopus (140) Google Scholar).Antibodies and Reagents—Monoclonal anti-FAK (4.47) and clone NCM II 100 anti-N-MYC antibodies were obtained from Upstate Biotechnology and Calbiochem, respectively. Myc tag antibody (polyclonal, ChIP grade) was obtained from Abcam, Inc. Monoclonal anti-β-actin antibody was obtained from Santa Cruz Biotechnology. SK-N-BE(2) and Kelly neuroblastoma cell nuclear extracts were obtained from Active Motif, Inc.Western Blotting—Western blots were performed as described previously (36Golubovskaya V. Finch R. Cance W. J. Biochem. Mol. Biol. 2005; 280: 25008-25021Scopus (148) Google Scholar). Briefly antibodies to FAK (4.47, Upstate Biotechnology), N-MYC (Calbiochem), and β-actin (Santa Cruz Biotechnology) were used according to the manufacturers' recommended conditions. Molecular weight markers were used to confirm the expected size of the target proteins. Immunoblots were developed with chemiluminescence Renaissance reagent (PerkinElmer Life Sciences). Blots were stripped with stripping solution (Bio-Rad) at 37 °C for 15 min and then reprobed with selected antibodies. Immunoblotting with antibody to β-actin provided an internal control for equal protein loading.Real Time RT-PCR—Total cellular RNA was extracted utilizing the RNeasy kit (Qiagen) according to the manufacturer's instructions. For the first strand synthesis of cDNA, 5 μg of RNA was used in a 20-μl reaction mixture utilizing a cDNA Cycle kit (Invitrogen) according to the supplier's instructions. Resulting reverse transcription products were diluted 10 times and stored at –20 °C until later use. For TaqMan quantitative PCR, the following protocol was used. TaqMan PCR primers and probes for FAK and the housekeeping gene cyclophilin A were obtained from Applied Biosystems. Probes are labeled with a reporter dye, 6-carboxyfluorescein phosphoramidate at the 5′-end and with 6-carboxytetramethylrhodamine as a quencher dye at the 3′-end. TaqMan PCR was performed with 10 ng of cDNA in a 50-μl reaction volume containing TaqMan Universal PCR Master Mix using TaqMan gene expression assay (Applied Biosystems). Amplification was performed utilizing an ABI PRISM 7700 sequence detection system (Applied Biosystems). Cycling conditions were 50 °C for 2 min, 95 °C for 10 min followed by a 40-cycle amplification at 95 °C for 15 s, and 60 °C for 1 min. The ABI PRISM 7700 cycler software calculates a threshold cycle number (Ct) at which each PCR amplification reaches a significant threshold level. The threshold cycle number is proportional to the number of FAK RNA copies present in the reaction mixture. Experiments were repeated at least three times, and samples were analyzed in triplicate with cyclophilin A utilized as an internal control. Data were calculated utilizing the ΔΔCt method (37Winer J. Kwang C. Shackel I. Williams P.M. Anal. Biochem. 1999; 270: 41-49Crossref PubMed Scopus (1215) Google Scholar) and are reported as mean -fold change ± S.E.Luciferase Promoter-Reporter Constructs and Dual Luciferase Assay—Cells were plated in 6-well culture plates to ∼80% confluence 24 h prior to transfection. Transfection was performed with pGL3 plasmids (1 μg/well) using Lipofectamine (Invitrogen) transfection agent according to the manufacturer's protocol. A pRL-TK control vector containing the herpes simplex virus thymidine kinase promoter encoding Renilla luciferase resulting in its constitutive expression in the cells (21Golubovskaya V. Kaur A. Cance W. Biochim. Biophys. Acta. 2004; 1678: 111-125Crossref PubMed Scopus (140) Google Scholar) (Promega) was used for normalization of luciferase activity. The pRL-TK vector was used (0.1 μg/well) together with the pGL3 plasmids for co-transfection. The level of firefly luciferase activity was normalized to that of the Renilla luciferase activity in each experiment. For all experiments, cells were cultured for 48 h after transfection and lysed with 1× passive lysis buffer (Promega). Lysates were analyzed using the dual luciferase reporter assay system kit (Promega). Luminescence was measured on a TD20/20 luminometer (Turner Designs), and all experiments were performed at least in triplicate. Data are reported as mean -fold change in luciferase activity ± S.E.Site-directed Mutagenesis—Site-directed mutation of the potential N-MYC binding site on the FAK promoter was obtained with a QuikChange SL site-directed mutagenesis kit (Stratagene) according to the manufacturer's protocol. The oligonucleotides for the mutant N-MYC site (with 6 bases of the site deleted (underlined)) were the following: forward, 5′-GAGCCTAGCGGCGCGCTGGG(Δ6)CGGGGGCGGCGCGCATGCCC-3′; and reverse, 5′-GGGCATGCGCGCCGCCCCCG(Δ6)CCCAGCGCGCCGCTAGGCTC-3′. These were then utilized to construct pGL3 mutant plasmids as described previously (21Golubovskaya V. Kaur A. Cance W. Biochim. Biophys. Acta. 2004; 1678: 111-125Crossref PubMed Scopus (140) Google Scholar). All mutant plasmids were sequenced at the Automated DNA Sequencing Facility at the University of Florida.Chromatin Immunoprecipitation—Cells were cultured to 80% confluence and then rinsed with phosphate-buffered saline and cross-linked for 15 min at 37 °C in serum-free medium containing 1% formaldehyde. Cultures were washed, and cells were collected by scraping into phosphate-buffered saline containing protease inhibitors (0.2 mm phenylmethylsulfonyl fluoride and 1 μg/ml each of aprotinin, pepstatin B, and leupeptin). Cell pellets were resuspended in 1 ml of lysis buffer (1% SDS, 10 mm EDTA, and 50 mm Tris-HCl, pH 8.0) containing protease inhibitors and incubated on ice for 10 min. DNA was then sheared by sonication to an average size of 300–1000 bp, and samples were centrifuged. Supernatants (0.2 ml) were diluted 1:10 with ChIP Dilution Buffer (Upstate) and 0.01% SDS, 1.1% Triton X-100, 1.2 mm EDTA, 167 mm NaCl, and 16.7 mm Tris containing protease inhibitors, and 5% was set aside as input DNA. Samples were then precleared for immunoprecipitation by incubation with salmon sperm DNA/Protein A-agarose 50% slurry (Chromatin Immunoprecipitation ChIP Assay kit, Upstate) for 30 min with agitation at 4 °C. After the preclearing step, the supernatant fraction was incubated overnight at 4 °C with anti-N-MYC antibody (Calbiochem). For negative controls, no antibody or nonspecific antibody (Myc tag antibody, Abcam) was utilized for immunoprecipitation. The immunoprecipitated complexes were collected with salmon sperm DNA/Protein A-agarose slurry (Upstate) after 1 h of rotation at 4 °C. The collected Protein A-agarose·antibody·chromatin complex was washed three times for 5 min with Low Salt Immune Complex Wash Buffer (Chromatin Immunoprecipitation ChIP Assay Kit, Upstate), High Salt Immune Complex Wash Buffer (Chromatin Immunoprecipitation ChIP Assay Kit, Upstate), and Immune Complex Wash Buffer (Chromatin Immunoprecipitation ChIP Assay Kit, Upstate) and two times with Tris-EDTA buffer. The immune complexes were eluted from the antibody by incubating with 1% SDS and 0.1 mm NaHCO3 for 15 min at room temperature two times. To reverse the protein-DNA cross-links the combined eluates were heated with 0.2 m NaCl for 4 h. Samples of input starting DNA were made before the immunoprecipitation step by collecting the sonicated cell supernatant fraction in ChIP Dilution Buffer and reversing protein-DNA cross-links by adding 0.3 m in NaCl and incubating for 4 h at 65 °C. DNA was purified using phenol-chloroform extraction and ethanol extraction and used for PCR analysis. PCR analysis was performed to identify the binding of N-MYC to the FAK promoter with the following primers: forward, 5′-TCACTTCCTGCTTAAAGCCC-3′; and reverse, 5′-GGGACTTAGAAGTCCACTGG-3′. As a control, ChIP assay was also performed with the published telomerase promoter sequence (hTERT), and PCR was performed with the following primers: forward, 5′-AGTGGATTCGCGGGCACAGA-3′; and reverse, 5′-TTCCCACGTGCGCAGCAGGA-3′ (38Veldman T. Liu X. Yuan H. Schlegel R. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 8211-8216Crossref PubMed Scopus (204) Google Scholar).Electrophoretic Mobility Shift Assay—Nuclear extracts of SK-N-AS and N-MYC– (Tet+) cells were prepared with nuclear and cytoplasmic extraction reagents (NE-PER) (Pierce) according to the manufacturer's protocol. Nuclear extracts from SK-N-BE(2) and Kelly neuroblastoma cells (amplified copies of N-MYC) were obtained from Active Motif, Inc.The oligonucleotides used were the consensus E-box sequence with the sequence shown underlined (5′-GGAAGCAGACCACGTGCTCTGCTTCC-3′) (39Harris R.G. White E. Phillips E.S. Lillycrop K.A. J. Biol. Chem. 2002; 277: 34815-34825Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar), the focal adhesion kinase E-box N-MYC 1 sequence with the sequence shown underlined (5′-TGCCGCGCACGCGCGCGGGC-3′), and the focal adhesion kinase E-box N-MYC 2 sequence with the sequence shown underlined (5′-CGCTGGGCATGCGCGGGGGC-3′). Oligonucleotides were hybridized with complementary synthesized oligonucleotides and used in double-stranded form for labeling reactions. Oligonucleotides were labeled utilizing the biotin 3′-end DNA labeling kit from Pierce according to the manufacturer's instructions. The DNA binding reaction of biotin-labeled, double-stranded oligonucleotides with 3 μg of nuclear protein extracts was done at room temperature for 20 min according to the manufacturer's protocol. DNA·protein complexes were analyzed with Novex 6% DNA retardation gels (Invitrogen). Electrophoretic mobility shift assays were performed with the LightShift chemiluminescence kit from Pierce according to manufacturer's recommendations. Biotin-labeled DNA was then detected by chemiluminescence. For control of binding specificity, the reactions were performed with both an excess of cold probe and specific N-MYC antibody (Calbiochem).siRNA Transfection—Cells were plated on 96-well culture plates at a density of 5 × 103 cells/well and allowed to attach for 24 h. RNA interference for FAK included FAK siRNA (SMARTpool FAK reagent, Dharmacon, Inc.) and the following specific siRNA sequences to FAK: D-05 FAK siRNA, 5′-GAAGUUGGGUUGUCUAGAAUU-3′; and D-07 FAK siRNA, 5′-GGAAAUUGCUUUGAAGUUGUU-3′. Control siRNA included siCONTROL nontargeting siRNA (Dharmacon, Inc.) and GAPDH siRNA (SMARTpool GAPDH reagent, Dharmacon, Inc.). The cells were transfected with either FAK or control siRNA at 0.14 μm with Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. Cells were incubated 48–72 h after transfection and then used for experiments. FAK inhibition by siRNA was verified with Western blotting with FAK antibodies.Adenoviral Infections—Cells were plated at 5 × 103 cells/well into a 96-well culture plate and allowed to attach for 24 h. The cells were then infected with control AdGFP, AdLacZ, or dominant-negative FAK, AdFAK-CD (12Xu L.H. Yang X.H. Bradham C.A. Brenner D.A. Baldwin A.S. Craven R.J. Cance W.G. J. Biol. Chem. 2000; 275: 30597-30604Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar). The AdFAK-CD (analogous to FAK-related non-kinase) construct is an adenoviral construct that contains the carboxyl-terminal domain of FAK (FAK-CD). AdFAK-CD has been described previously in detail by Xu et al. (12Xu L.H. Yang X.H. Bradham C.A. Brenner D.A. Baldwin A.S. Craven R.J. Cance W.G. J. Biol. Chem. 2000; 275: 30597-30604Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar). FAK-CD is analogous to the FAK-related non-kinase molecule, which is known to decrease the phosphorylation of p125FAK. Adenoviral transduction of FAK-CD causes loss of cellular adhesion and viability and the loss of p125FAK from focal adhesions (12Xu L.H. Yang X.H. Bradham C.A. Brenner D.A. Baldwin A.S. Craven R.J. Cance W.G. J. Biol. Chem. 2000; 275: 30597-30604Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar). Optimal concentrations of virus were determined using AdGFP as described previously (12Xu L.H. Yang X.H. Bradham C.A. Brenner D.A. Baldwin A.S. Craven R.J. Cance W.G. J. Biol. Chem. 2000; 275: 30597-30604Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar, 40Kurenova E. Xu L.H. Yang X. Baldwin A.S. Craven R.J. Hanks S.K. Liu Z.G. Cance W.G. Mol. Cell. Biol. 2004; 24: 4361-4371Crossref PubMed Scopus (151) Google Scholar). We used" @default.
• W2024037712 created "2016-06-24" @default.
• W2024037712 creator A5003952522 @default.
• W2024037712 creator A5005203463 @default.
• W2024037712 creator A5016587804 @default.
• W2024037712 creator A5024475539 @default.
• W2024037712 creator A5052141297 @default.
• W2024037712 creator A5059982950 @default.
• W2024037712 creator A5065464694 @default.
• W2024037712 creator A5075780491 @default.
• W2024037712 creator A5080088331 @default.
• W2024037712 date "2007-04-01" @default.
• W2024037712 modified "2023-10-05" @default.
• W2024037712 title "N-MYC Regulates Focal Adhesion Kinase Expression in Human Neuroblastoma" @default.
• W2024037712 cites W1430273632 @default.
• W2024037712 cites W1970228357 @default.
• W2024037712 cites W1973552594 @default.
• W2024037712 cites W1975866732 @default.
• W2024037712 cites W1979933401 @default.
• W2024037712 cites W1983241347 @default.
• W2024037712 cites W1985961293 @default.
• W2024037712 cites W2004205790 @default.
• W2024037712 cites W2006145157 @default.
• W2024037712 cites W2006834821 @default.
• W2024037712 cites W2010616924 @default.
• W2024037712 cites W2012204975 @default.
• W2024037712 cites W2012799785 @default.
• W2024037712 cites W2024280594 @default.
• W2024037712 cites W2024412859 @default.
• W2024037712 cites W2025018535 @default.
• W2024037712 cites W2031994938 @default.
• W2024037712 cites W2034439216 @default.
• W2024037712 cites W2035662736 @default.
• W2024037712 cites W2040175805 @default.
• W2024037712 cites W2041031381 @default.
• W2024037712 cites W2044033792 @default.
• W2024037712 cites W2048655016 @default.
• W2024037712 cites W2048962618 @default.
• W2024037712 cites W2055165419 @default.
• W2024037712 cites W2064861580 @default.
• W2024037712 cites W2065611313 @default.
• W2024037712 cites W2066095080 @default.
• W2024037712 cites W2071250347 @default.
• W2024037712 cites W2072499623 @default.
• W2024037712 cites W2083309399 @default.
• W2024037712 cites W2085761836 @default.
• W2024037712 cites W2086345417 @default.
• W2024037712 cites W2088095172 @default.
• W2024037712 cites W2089083658 @default.
• W2024037712 cites W2091506455 @default.
• W2024037712 cites W2107379927 @default.
• W2024037712 cites W2111163639 @default.
• W2024037712 cites W2120483050 @default.
• W2024037712 cites W2126735009 @default.
• W2024037712 cites W2137710310 @default.
• W2024037712 cites W2155123104 @default.
• W2024037712 cites W2159695799 @default.
• W2024037712 cites W2160839395 @default.
• W2024037712 cites W2168828935 @default.
• W2024037712 cites W2205128017 @default.
• W2024037712 cites W2332311127 @default.
• W2024037712 cites W4236512674 @default.
• W2024037712 cites W66296664 @default.
• W2024037712 doi "https://doi.org/10.1074/jbc.m701450200" @default.
• W2024037712 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17327229" @default.
• W2024037712 hasPublicationYear "2007" @default.
• W2024037712 type Work @default.
• W2024037712 sameAs 2024037712 @default.
• W2024037712 citedByCount "67" @default.
• W2024037712 countsByYear W20240377122012 @default.
• W2024037712 countsByYear W20240377122013 @default.
• W2024037712 countsByYear W20240377122014 @default.
• W2024037712 countsByYear W20240377122015 @default.
• W2024037712 countsByYear W20240377122016 @default.
• W2024037712 countsByYear W20240377122017 @default.
• W2024037712 countsByYear W20240377122018 @default.
• W2024037712 countsByYear W20240377122019 @default.
• W2024037712 countsByYear W20240377122020 @default.
• W2024037712 countsByYear W20240377122021 @default.
• W2024037712 countsByYear W20240377122022 @default.
• W2024037712 countsByYear W20240377122023 @default.
• W2024037712 crossrefType "journal-article" @default.
• W2024037712 hasAuthorship W2024037712A5003952522 @default.
• W2024037712 hasAuthorship W2024037712A5005203463 @default.
• W2024037712 hasAuthorship W2024037712A5016587804 @default.
• W2024037712 hasAuthorship W2024037712A5024475539 @default.
• W2024037712 hasAuthorship W2024037712A5052141297 @default.
• W2024037712 hasAuthorship W2024037712A5059982950 @default.
• W2024037712 hasAuthorship W2024037712A5065464694 @default.
• W2024037712 hasAuthorship W2024037712A5075780491 @default.
• W2024037712 hasAuthorship W2024037712A5080088331 @default.
• W2024037712 hasBestOaLocation W20240377121 @default.
• W2024037712 hasConcept C108391706 @default.
• W2024037712 hasConcept C151166631 @default.
• W2024037712 hasConcept C184235292 @default.
• W2024037712 hasConcept C185592680 @default.
• W2024037712 hasConcept C2776715637 @default.
• W2024037712 hasConcept C2777956278 @default.

• next