FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2024447233> ?p ?o ?g. }

• W2024447233 endingPage "3747" @default.
• W2024447233 startingPage "3736" @default.
• W2024447233 abstract "Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3‘ → 5‘ direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5‘-terminus using PyBOP/HOBt chemistry. The stability of (DNA)2·DNG−H triplexes and DNA·DNG−H duplexes formed by DNG and DNG−Hoechst 33258 (DNG−H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5‘-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3‘, respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5‘-terminus of the DNG enhances the (DNA)2·DNG−H triplex stability by a ΔTm of 13 °C. The fluorescence emission studies of (DNA)2·DNG−H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)2·DNG triplex stability by 11 °C, whereas (DNA)2·DNG−H triplex stability was decreased by 23 °C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5−6 °C. Upon hybridization of DNG−Hoechst conjugates with the 30-mer ssDNA, the DNA·DNG−H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA·DNG minor groove, and the duplex stability was enhanced by ΔTm of 7 °C. The stability of (DNA)2·DNG triplexes and DNA·DNG duplexes is independent of pH, whereas the stability of (DNA)2·DNG−H triplexes decreases with increase in pH." @default.
• W2024447233 created "2016-06-24" @default.
• W2024447233 creator A5038960546 @default.
• W2024447233 creator A5040471810 @default.
• W2024447233 date "2004-03-01" @default.
• W2024447233 modified "2023-10-17" @default.
• W2024447233 title "Solid-Phase Synthesis of Positively Charged Deoxynucleic Guanidine (DNG) Tethering a Hoechst 33258 Analogue: Triplex and Duplex Stabilization by Simultaneous Minor Groove Binding" @default.
• W2024447233 cites W1511465838 @default.
• W2024447233 cites W1963254480 @default.
• W2024447233 cites W1970650788 @default.
• W2024447233 cites W1973050196 @default.
• W2024447233 cites W1975978095 @default.
• W2024447233 cites W1982839912 @default.
• W2024447233 cites W1990722553 @default.
• W2024447233 cites W1994627170 @default.
• W2024447233 cites W1996991816 @default.
• W2024447233 cites W2001199233 @default.
• W2024447233 cites W2001349528 @default.
• W2024447233 cites W2001701885 @default.
• W2024447233 cites W2008128810 @default.
• W2024447233 cites W2008629363 @default.
• W2024447233 cites W2011970310 @default.
• W2024447233 cites W2012351316 @default.
• W2024447233 cites W2013473845 @default.
• W2024447233 cites W2013484060 @default.
• W2024447233 cites W2015014732 @default.
• W2024447233 cites W2015275462 @default.
• W2024447233 cites W2015400683 @default.
• W2024447233 cites W2019178034 @default.
• W2024447233 cites W2019441376 @default.
• W2024447233 cites W2020387486 @default.
• W2024447233 cites W2020633726 @default.
• W2024447233 cites W2021728535 @default.
• W2024447233 cites W2023989330 @default.
• W2024447233 cites W2025352464 @default.
• W2024447233 cites W2025996235 @default.
• W2024447233 cites W2027714893 @default.
• W2024447233 cites W2030407288 @default.
• W2024447233 cites W2030599765 @default.
• W2024447233 cites W2031571440 @default.
• W2024447233 cites W2033741944 @default.
• W2024447233 cites W2035068905 @default.
• W2024447233 cites W2035485234 @default.
• W2024447233 cites W2035760808 @default.
• W2024447233 cites W2037482347 @default.
• W2024447233 cites W2037547063 @default.
• W2024447233 cites W2037757616 @default.
• W2024447233 cites W2043981787 @default.
• W2024447233 cites W2044103171 @default.
• W2024447233 cites W2045106623 @default.
• W2024447233 cites W2045653120 @default.
• W2024447233 cites W2045923548 @default.
• W2024447233 cites W2047209080 @default.
• W2024447233 cites W2053138556 @default.
• W2024447233 cites W2056716048 @default.
• W2024447233 cites W2065207842 @default.
• W2024447233 cites W2066907096 @default.
• W2024447233 cites W2070005055 @default.
• W2024447233 cites W2070945608 @default.
• W2024447233 cites W2071153916 @default.
• W2024447233 cites W2071733659 @default.
• W2024447233 cites W2076533513 @default.
• W2024447233 cites W2082369082 @default.
• W2024447233 cites W2086299962 @default.
• W2024447233 cites W2086378252 @default.
• W2024447233 cites W2087535871 @default.
• W2024447233 cites W2088380621 @default.
• W2024447233 cites W2090056319 @default.
• W2024447233 cites W2092975717 @default.
• W2024447233 cites W2094345240 @default.
• W2024447233 cites W2094412953 @default.
• W2024447233 cites W2098272169 @default.
• W2024447233 cites W2106858736 @default.
• W2024447233 cites W2117701946 @default.
• W2024447233 cites W2118636857 @default.
• W2024447233 cites W2121637148 @default.
• W2024447233 cites W2129242502 @default.
• W2024447233 cites W2130384627 @default.
• W2024447233 cites W2132230404 @default.
• W2024447233 cites W2138645530 @default.
• W2024447233 cites W2145868219 @default.
• W2024447233 cites W2146226340 @default.
• W2024447233 cites W2165090578 @default.
• W2024447233 cites W2165598929 @default.
• W2024447233 cites W2326493716 @default.
• W2024447233 cites W2885978694 @default.
• W2024447233 cites W2953219521 @default.
• W2024447233 cites W4249829561 @default.
• W2024447233 doi "https://doi.org/10.1021/ja031557s" @default.
• W2024447233 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15038726" @default.
• W2024447233 hasPublicationYear "2004" @default.
• W2024447233 type Work @default.
• W2024447233 sameAs 2024447233 @default.
• W2024447233 citedByCount "26" @default.
• W2024447233 countsByYear W20244472332012 @default.
• W2024447233 countsByYear W20244472332013 @default.
• W2024447233 countsByYear W20244472332015 @default.
• W2024447233 countsByYear W20244472332016 @default.

• next