FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2024543323> ?p ?o ?g. }

• W2024543323 endingPage "6221" @default.
• W2024543323 startingPage "6209" @default.
• W2024543323 abstract "Plk1 (Polo-like kinase 1) has been documented as a critical regulator of many mitotic events. However, increasing evidence supports the notion that Plk1 might also have functions outside of mitosis. Using biochemical fractionation and RNA interference approaches, we found that Plk1 was required for both G1/S and G2/M phases and that DNA topoisomerase IIα (topoIIα) was a potential target for Plk1 in both interphase and mitosis. Plk1 phosphorylates Ser1337 and Ser1524 of topoIIα. Overexpression of an unphosphorylatable topoIIα mutant led to S phase arrest, suggesting that Plk1-associated phosphorylation first occurs in S phase. Moreover, overexpression of the unphosphorylatable topoIIα mutant activated the ATM/R-dependent DNA damage checkpoint, probably due to reduced catalytic activity of topoIIα, and resulted in accumulation of catenated DNA. Finally, we showed that wild type topoIIα, but not the unphosphorylatable mutant, was able to rescue topoIIα depletion-induced defects in sister chromatid segregation, indicating that Plk1-associated phosphorylation is essential for the functions of topoIIα in mitosis. Plk1 (Polo-like kinase 1) has been documented as a critical regulator of many mitotic events. However, increasing evidence supports the notion that Plk1 might also have functions outside of mitosis. Using biochemical fractionation and RNA interference approaches, we found that Plk1 was required for both G1/S and G2/M phases and that DNA topoisomerase IIα (topoIIα) was a potential target for Plk1 in both interphase and mitosis. Plk1 phosphorylates Ser1337 and Ser1524 of topoIIα. Overexpression of an unphosphorylatable topoIIα mutant led to S phase arrest, suggesting that Plk1-associated phosphorylation first occurs in S phase. Moreover, overexpression of the unphosphorylatable topoIIα mutant activated the ATM/R-dependent DNA damage checkpoint, probably due to reduced catalytic activity of topoIIα, and resulted in accumulation of catenated DNA. Finally, we showed that wild type topoIIα, but not the unphosphorylatable mutant, was able to rescue topoIIα depletion-induced defects in sister chromatid segregation, indicating that Plk1-associated phosphorylation is essential for the functions of topoIIα in mitosis. The cell cycle entails a series of macromolecular events that lead to cell division and the production of two daughter cells, each maintaining genetic information identical to that of the parental cell. DNA replication occurs during the S phase of the cell cycle and the duplicated chromosomes are distributed into two daughter cells during mitosis or the M phase. Precise temporal control of the cell cycle ensures a high fidelity of chromosome duplication/segregation, which occurs only when all covalent DNA links between replicated sister chromatids have been removed. The enzyme that decatenates covalently interlinked DNA molecules to disentangle intertwined chromosomes is DNA topoisomerase II (1Nitiss J.L. Biochim. Biophys. Acta. 1998; 1400: 63-81Crossref PubMed Scopus (312) Google Scholar). There are two known isoforms of DNA topoisomerase II in mammalian cells, topoIIα 2The abbreviations used are:topoIIαDNA topoisomerase IIαtopoIIβDNA topoisomerase IIβIFimmunofluorescenceIPimmunoprecipitationRNAiRNA interferencePBSphosphate-buffered salineGFPgreen fluorescent proteinWTwild typeDAPI4′,6′-diamidino-2-phenylinodolekDNAkinetoplast DNAFACSfluorescence-activated cell sortingBrdUrdbromodeoxyuridineaaamino acid(s)ATMataxia telangiectasia-mutatedATRATM and Rad3-related. and topoIIβ (1Nitiss J.L. Biochim. Biophys. Acta. 1998; 1400: 63-81Crossref PubMed Scopus (312) Google Scholar). It has been shown that the two isoforms are differentially regulated during cell cycle progression. Although the level of topoIIβ remains fairly constant across different phases of the cell cycle, topoIIα levels rise significantly in S phase, peak in G2/M phase, and then fall rapidly following mitosis (2Isaacs R.J. Davies S.L. Sandri M.I. Redwood C. Wells N.J. Hickson I.D. Biochim. Biophys. Acta. 1998; 1400: 121-137Crossref PubMed Scopus (185) Google Scholar). In addition, the phosphorylation of topoIIα and topoIIβ is also regulated throughout the cell cycle. Mammalian topoIIα and topoIIβ are hyperphosphorylated at mitosis, and several M phase-specific phosphorylation sites have been identified (2Isaacs R.J. Davies S.L. Sandri M.I. Redwood C. Wells N.J. Hickson I.D. Biochim. Biophys. Acta. 1998; 1400: 121-137Crossref PubMed Scopus (185) Google Scholar). In Chinese hamster ovary cells, distinct topoII phosphorylation sites have been observed in mitosis and interphase (3Burden D.A. Sullivan D.M. Biochemistry. 1994; 33: 14651-14655Crossref PubMed Scopus (36) Google Scholar). DNA topoisomerase IIα DNA topoisomerase IIβ immunofluorescence immunoprecipitation RNA interference phosphate-buffered saline green fluorescent protein wild type 4′,6′-diamidino-2-phenylinodole kinetoplast DNA fluorescence-activated cell sorting bromodeoxyuridine amino acid(s) ataxia telangiectasia-mutated ATM and Rad3-related. The role of phosphorylation in regulating topoIIα has been the subject of several publications, but no consistent pattern has emerged (2Isaacs R.J. Davies S.L. Sandri M.I. Redwood C. Wells N.J. Hickson I.D. Biochim. Biophys. Acta. 1998; 1400: 121-137Crossref PubMed Scopus (185) Google Scholar). In Drosophila, topoIIα was phosphorylated by a number of protein kinases, including casein kinase II, protein kinase C, and Cdc2 kinase. In all cases, phosphorylation stimulated enzyme activity (4Corbett A.H. Fernald A.W. Osheroff N. Biochemistry. 1993; 32: 2090-2097Crossref PubMed Scopus (56) Google Scholar). In budding yeast, it was reported that dephosphorylation of topoIIα resulted in a loss of catalytic activity, suggesting that at least some phosphorylation was required for its activity (5Cardenas M.E. Gasser S.M. J. Cell Sci. 1993; 104: 219-225PubMed Google Scholar). However, studies with mammalian topoIIα yielded conflicting results. In one study, dephosphorylation of topoIIα by λ-phosphatase treatment had essentially no effect on its decatenation activity (6Escargueil A.E. Plisov S.Y. Filhol O. Cochet C. Larsen A.K. J. Biol. Chem. 2000; 275: 34710-34718Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). In a separate study, by mutating serine to alanine, Chikamori and colleagues showed that phosphorylation at Ser1106 in topoIIα positively regulated its enzymatic activity, and a kinase likely to be responsible for the phosphorylation was casein kinase II (7Chikamori K. Grabowski D.R. Kinter M. Willard B.B. Yadav S. Aebersold R.H. Bukowski R.M. Hickson I.D. Andersen A.H. Ganapathi R. Ganapathi M.K. J. Biol. Chem. 2003; 278: 12696-12702Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). In addition to cyclin-dependent kinases, Plk1 (Polo-like kinase 1) has also emerged as a key regulator involved in many cell cycle-related events, such as centrosome maturation, bipolar spindle formation, and cytokinesis (8Vugt van M.A. Medema R.H. Oncogene. 2005; 24: 2844-2859Crossref PubMed Scopus (240) Google Scholar, 9Barr F.A. Sillje H.H. Nigg E.A. Nat. Rev. Mol. Cell Biol. 2004; 5: 429-440Crossref PubMed Scopus (913) Google Scholar). Sufficient evidence also indicates that Plk1 plays a critical role in chromosome segregation at the onset of anaphase. In budding yeast, Cdc5-associated phosphorylation of cohesin subunit Scc1 strongly enhances its cleavage by separase, which leads to sister chromatid separation (10Alexandru G. Uhlmann F. Mechtler K. Poupart M.A. Nasmyth K. Cell. 2001; 105: 459-472Abstract Full Text Full Text PDF PubMed Scopus (310) Google Scholar). Using depletion experiments, Plx1, the Plk1 homolog in Xenopus, was shown to be required for cohesin displacement from chromosome arms in a phosphorylation-dependent manner (11Sumara I. Vorlaufer E. Stukenberg P.T. Kelm O. Redemann N. Nigg E.A. Peters J.M. Mol. Cell. 2002; 9: 515-525Abstract Full Text Full Text PDF PubMed Scopus (378) Google Scholar). In human cells, cohesin depletion-induced mitotic delay can be rescued by inhibition of topoII, suggesting that the accumulation of catenations by topoII inhibition in preseparated sister chromatids may overcome the reduced tension arising from cohesin depletion (12Toyoda Y. Yanagida M. Mol. Biol. Cell. 2006; 17: 2287-2302Crossref PubMed Scopus (86) Google Scholar). Similarly, Plk1-associated phosphorylation of PICH, a centromere protein, also causes it to dissociate from chromatid arms to centromeres and lead to the formation of DNA threads connecting sister kinetochores. Remarkably, these PICH-positive threads are exacerbated by the inhibition of topoII or cohesin, suggesting that they represent stretched centromeric chromatin (13Baumann C. Korner R. Hofmann K. Nigg E.A. Cell. 2007; 128: 101-114Abstract Full Text Full Text PDF PubMed Scopus (260) Google Scholar). The data accumulated so far are consistent with the model that topoII may act in the last step of sister kinetochore separation (13Baumann C. Korner R. Hofmann K. Nigg E.A. Cell. 2007; 128: 101-114Abstract Full Text Full Text PDF PubMed Scopus (260) Google Scholar). In this paper, we show that topoIIα is also a Plk1 substrate both in vitro and in vivo, and the essential topoIIα functions during cell cycle progression might be regulated by Plk1-associated phosphorylation. Reagents—The phosphohistone H3 antibody (06-570) and Cdc2 antibody (06-923) were from Upstate Biotechnology, Inc. The rabbit antibodies against TopoIIα and TopoIIβ were obtained from TopoGene. The mouse Plk1 antibody was ordered from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The Ki-67 antibody was purchased from BD Transduction Laboratories. Vector Construction—To specifically deplete endogenous topoIIα in mammalian cells, plasmid pBS/U6-topoIIα was constructed as previously described (14Liu X. Erikson R.L. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 5789-5794Crossref PubMed Scopus (437) Google Scholar). The targeting sequence of human topoIIα (accession number NM_001067) was GGTGAAGTTTAAGGCCCAAG, corresponding to 1242–1261 of the coding region relative to the first nucleotide of the start codon. Plasmid pBS/U6-topoIIα-1st half (sense strand) was used as a control vector. This control vector produces RNA that cannot form a hairpin structure to generate interfering RNA (RNAi). Plasmid pBS/U6-Plk1 was previously described (14Liu X. Erikson R.L. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 5789-5794Crossref PubMed Scopus (437) Google Scholar). Cell Culture and Synchronization—HeLa, U2OS, and hTERT-RPE1 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal bovine serum, 100 units ml-1 penicillin, and 100 units ml-1 streptomycin at 37 °C in 8% CO2. To synchronize HeLa cells, cells were treated with 2.5 mm thymidine for 16 h, released for 8 h, and then treated with thymidine a second time for 16 h. After two washes with phosphate-buffered saline (PBS), cells were cultured for different times as indicated in each experiment and harvested. Based on our experience, cells enter S phase after 4 h of release and accumulate in G2 phase after 8 h of release into normal medium. Most cells arrest at mitosis after 12 h of release in the presence of 100 ng ml-1 of nocodazole, and 13.5 h of release in the absence of nocodazole results in at least 50% of cells at telophase/cytokinesis. Alternatively, cells were treated with 0.3 mm mimosine for 20 h, 4 mm hydroxyurea for 24 h, or 200 ng ml-1 nocodazole for 12 h to arrest at G1, S, or M phase, respectively. DNA Transfections—For phenotype analysis of gene depletion in randomly growing cells, HeLa cells were co-transfected with pBS/U6-topoIIα or pBS/U6-Plk1 and pBabe-puro at a ratio of 8:1 using GenePorter reagents. After 2 days of selection for transfection-positive cells with 2 μg ml-1 puromycin, floating cells were washed away with PBS, and the attached cells were incubated until harvesting for phenotypic analysis. To deplete topoIIα in well synchronized cells, cells were treated with thymidine for 16 h, co-transfected with pBS/U6-topoIIα and pBabe-puro, incubated for 8 h, and blocked with the second dose of thymidine in the presence of puromycin for 20 h. After synchronization/selection, the floating cells were removed, and the remaining cells were released into fresh medium for different times. To rescue the topoIIα depletion-induced phenotypes, cells growing on coverslips were co-transfected with pBS/U6-topoIIα and RNAi-resistant GFP-topoIIα (WT or Plk1 unphosphorylatable mutant) at a ratio of 5:1 and subjected to the thymidine block. Upon release into fresh medium for different times, cells were stained with 4′,6′-diamidino-2-phenylinodole (DAPI), and GFP-positive cells were analyzed. Isolation of Nuclear and Chromosome-binding Fractions—Cytosolic, nuclear, and chromosome-binding fractions from cell lysates were prepared by using a Qproteome nuclear protein kit (Qiagen). Briefly, harvested cells were resuspended in lysis buffer supplemented with detergent solution NP. After centrifugation for 5 min, the supernatant was collected as the cytoplasmic fraction. The nuclei pellet was resuspended in nuclear protein lysis buffer NL and centrifuged for 5 min. After removing the supernatant, the nuclear pellet was resuspended in extraction buffer NX1. After a 10-min spin, the supernatant was collected as the soluble nuclear fraction. The insoluble pellet was resuspended in extraction buffer NX2 supplemented with benzonase and incubated for 1 h with gentle agitation. After another 10-min spin, the supernatant was collected as the chromosome-binding fraction. Kinase Assay—Cdc2 was immunoprecipitated from cell lysates with a Cdc2 antibody and resuspended in TBMD buffer (50 mm Tris, pH 7.5, 10 mm MgCl2, 5 mm dithiothreitol, 2 mm EGTA, 0.5 mm sodium vanadate, 20 mm p-nitrophenyl phosphate) supplemented with 25 μm ATP and 50 μCi of [γ-32P]ATP. The reaction mixtures were incubated at 30 °C for 30 min in the presence of histone H1 as a substrate and resolved by SDS-PAGE. The gels were stained with Coomassie Brilliant Blue, dried, and subjected to autoradiography. Mitotic Chromosome Spread—Chromosome spread analysis was performed as described (12Toyoda Y. Yanagida M. Mol. Biol. Cell. 2006; 17: 2287-2302Crossref PubMed Scopus (86) Google Scholar). HeLa cells were transfected with GFP-topoIIα (WT or Plk1 unphosphorylatable mutant) and blocked at M phase with nocodazole treatment for 12 h. Mitotic cells were mechanically shaken off of plates, washed with PBS, and swollen in a hypotonic solution (75 mm KCl), followed by spreading using a 1000-rpm spin for 5 min. Spread cells were fixed by paraformaldehyde and subsequently stained with DAPI. Topoisomerase IIα Activity Assay—TopoIIα enzymatic activity was assayed by measuring the decatenation of kinetoplast DNA (kDNA) as described (15Shapiro P.S. Whalen A.M. Tolwinski N.S. Wilsbacher J. Froelich-Ammon S.J. Garcia M. Osheroff N. Ahn N.G. Mol. Cell Biol. 1999; 19: 3551-3560Crossref PubMed Google Scholar). A standard assay was carried out in a total volume of 20 μl, including 50 mm Tris-HCl, pH 7.9, 88 mm KCl, 10 mm MgCl2, 0.5 mm EDTA, 10 mm ATP, 10 mm dithiothreitol, 100 μg ml-1 bovine serum albumin, and 125 ng of kDNA. The reaction mixture containing equal amounts of topoIIα (WT, S1337A/S1524A, or S1337E/S1524E) was incubated at 37 °C for different times, and the reaction was stopped by the addition of 5 μl of stop solution (5% SDS, 25% Ficoll, and 0.05% bromphenol blue). The samples were resolved by electrophoresis at 115 V using a 1% agarose gel in a Tris acetate-EDTA buffer. Following electrophoresis, the gel was stained with ethidium bromide and photographed under UV illumination. Plk1 Functions in G1/S Phase—It has been well documented that Plk1 is involved in many mitotic processes, such as mitotic entry, bipolar spindle formation in metaphase, and cytokinesis (8Vugt van M.A. Medema R.H. Oncogene. 2005; 24: 2844-2859Crossref PubMed Scopus (240) Google Scholar, 9Barr F.A. Sillje H.H. Nigg E.A. Nat. Rev. Mol. Cell Biol. 2004; 5: 429-440Crossref PubMed Scopus (913) Google Scholar). However, several recent reports indicate that Plk1 might have additional functions outside of mitosis. For example, Plk1 is required for recovery from the DNA replication checkpoint response, which occurs in S phase (16Yoo H.Y. Kumagai A. Shevchenko A. Shevchenko A. Dunphy W.G. Cell. 2004; 117: 575-588Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). Based on immunofluorescence (IF) staining, it has long been believed that Plk1 starts to express in the cytoplasm at late S or early G2 phase (17Golsteyn R.M. Schultz S.J. Bartek J. Ziemiecki A. Ried T. Nigg E.A. J. Cell Sci. 1994; 107: 1509-1517Crossref PubMed Google Scholar). To further examine the possible non-M phase functions of Plk1, HeLa cells were synchronized with a double thymidine block protocol (16 h of thymidine treatment and 8 h of release, followed by a second 16-h incubation with thymidine). At different times after release from the block, cells were harvested and fractionated into cytoplasmic, nuclear, and chromosome-binding fractions. Different subcellular fractions were then analyzed by Western blot. Based on FACS analysis, cells were arrested at late G1 after the block, went though S phase at 4–6 h postrelease, reached G2 phase at 8 h postrelease, and entered mitosis at 10 h postrelease (data not shown). As shown in Fig. 1A, Plk1 was clearly detected at early S phase in HeLa cells (4 h after release). Significantly, Plk1 was mainly localized in the nucleus during S phase and G2 phase and was also localized to chromosomes during G2/M phase (Fig. 1A). This apparent inconsistency might be due to the fact that only cytoplasmic fractions were analyzed in the previous study. To determine whether the nuclear localization of Plk1 was a general phenomenon, U2OS, another tumor cell line, and hTERT-RPE1, a nontransformed cell line, were used to further analyze Plk1 localization and expression. Cells were treated with mimosine, hydroxyurea, or nocodazole to block at G1, S, or M phase, respectively. Cytoplasmic and nuclear fractions were prepared for anti-Plk1 Western blot analysis. Nuclear localization of Plk1 during interphase was clearly detected in HeLa cells and U2OS cells but not in hTERT-RPE1 cells (Fig. 1B), indicating that the nuclear localization of Plk1 might be tumor cell-specific. Moreover, two tumor cell lines showed much higher overall levels of Plk1 than that of RPE1 cells, in agreement with the notion that Plk1 overexpression might be correlated with transformation (18Eckerdt F. Yuan J. Strebhardt K. Oncogene. 2005; 24: 267-276Crossref PubMed Scopus (328) Google Scholar). Nuclear localization of Plk1 in HeLa cells was also observed by IF staining, using a modified permeabilization/fixation protocol (Fig. 1C). Next, RNAi was used to test whether Plk1 was required for cell cycle progression in the early stages, such as G1 and S phases. Plk1 was depleted by using a vector-based RNAi approach in randomly growing cells as previously described (14Liu X. Erikson R.L. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 5789-5794Crossref PubMed Scopus (437) Google Scholar). Upon nocodazole treatment, control cells quickly accumulated at the G2/M phase, as shown by the increase in cell population with 4 n DNA content by FACS. In contrast, Plk1-depleted cells were much more resistant to nocodazole treatment (Fig. 1, D and E). To confirm this observation, we also examined the degradation rate of cyclin E, a G1/S marker protein. In control cells, cyclin E was almost completely degraded after 6 h of treatment with nocodazole. However, a significant amount of cyclin E was still detected in Plk1-depleted cells even after 12 h of nocodazole treatment (Fig. 1F), indicating that Plk1 might be required for G1/S phase. Finally, Plk1-depleted cells were also treated with nocodazole for shorter times and stained with a phosphohistone H3 antibody, a mitotic marker. The ratio between phosphohistone H3-positive cells and the cell population with 4 n DNA content was used to follow the G2/M transition. For control cells, the percentage of phosphohistone H3-positive cells out of cells with 4 n DNA content clearly increased upon nocodazole treatment. However, such an increase was not detected in the Plk1-depleted cells, supporting the notion that Plk1 is required for mitotic entry (Fig. 1G). To further appreciate the potential involvement of Plk1 in the early stages of cell cycle, we next tried to deplete Plk1 in a synchronized culture. Accordingly, HeLa cells were depleted of Plk1 and treated with thymidine for 24 h to block at the G1/S boundary. Cells were then released into fresh medium for different times in the presence or absence of nocodazole and harvested. The double thymidine block protocol is not ideal for these experiments, since Plk1 depletion also causes dramatic G2/M block. As indicated, Plk1 depletion was very efficient using such a protocol (Fig. 2A). To be consistent with the results obtained with an asynchronous culture as described above, Plk1-depleted cells showed an obvious G1 peak during the entire releasing period, even in the presence of nocodazole, whereas control cells quickly entered mitosis (Fig. 2, B and C). It has been documented that Plk1 depletion leads to cell cycle arrest, followed by apoptosis in HeLa cells (14Liu X. Erikson R.L. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 5789-5794Crossref PubMed Scopus (437) Google Scholar). Thus, in addition to the normal 2 n, 4 n peaks, cells with sub-G1 DNA content (1 n peak) were detected at later stages of nocodazole treatment after Plk1 depletion (Fig. 1D). In a synchronized culture after Plk1 depletion, apoptotic cells with 1 n DNA content were also detected after 8 h of release from the thymidine block, even in the absence of nocodazole (Fig. 2B), indicating that the apoptotic cell death we observed in Fig. 1D is not due to nocodazole treatment. TopoIIα Interacts with Plk1 in Vivo—To search for a possible Plk1 target during interphase, we turned our attention to DNA topoIIα, which is well known to be overexpressed in tumor cells and has functions in both S and M phases (1Nitiss J.L. Biochim. Biophys. Acta. 1998; 1400: 63-81Crossref PubMed Scopus (312) Google Scholar). In addition, topoIIα was also found to be one of several potential Plk1 substrates in a yeast two-hybrid screen to search for Plk1-interacting proteins. To test whether topoIIα is a binding partner of Plk1, cells were treated with mimosine, hydroxyurea, or nocodazole to block at G1, S, or M phase, respectively. Soluble nuclear and chromosome-binding fractions were combined and subjected to anti-Plk1 immunoprecipitation (IP), followed by anti-topoIIα Western blot analysis. As shown in Fig. 3A, topoIIα was co-immunoprecipitated with Plk1 in both hydroxyurea and nocodazole-treated cells, but not in mimosine-treated cells, indicating that the binding between topoIIα and Plk1 occurs during S and G2/M phase in vivo. Both topoIIα and Plk1 were clearly detected in the nuclei of randomly growing cells by Western blot analysis (Fig. 3B). TopoIIβ and Erk2 were used as loading controls to indicate efficient subcellular fractionation. The nuclear co-localization of topoIIα and Plk1 was further confirmed by IF analysis (Fig. 3C). Based on these data, we hypothesized that topoIIα might be a substrate of Plk1 in both interphase and mitosis. TopoIIα Is Required for Cell Proliferation—To investigate the functions of topoIIα during normal cell cycle progression, we first used vector-based RNAi to specifically deplete topoIIα in HeLa cells. As indicated by Western blot analysis, topoIIα was efficiently depleted with this approach (Fig. 4A). We next determined whether topoIIα depletion influences the proliferation of HeLa cells. Although transfection with the control vector did not affect the growth rate of cells, transfection with the plasmid pBS/U6-topoIIα strongly inhibited cell proliferation (Fig. 4B). We also examined the viability of topoIIα-depleted cells. Transfection with the control vector showed little effect on cell viability, whereas <10% of topoIIα-depleted cells were still attached to the culture dishes at 6 days post-transfection (Fig. 4C). To characterize the inhibition of cell growth by topoIIα depletion, cell cycle progression was analyzed by FACS. As shown in Fig. 4D, transfection with the control vector did not affect the cell cycle profile, whereas topoIIα depletion induced a slight increase of cell population in G2/M phase and obvious cell cycle arrest at S phase. Alternatively, these results may be due to the possibility that topoIIα-depleted cells undergo an aberrant mitosis, resulting in daughter cells with highly unequal DNA content. Starting from 5 days post-transfection, topoIIα-depleted cells showed a significant sub-G1 population (Fig. 4D), suggesting that these cells were undergoing apoptosis. To further analyze this phenotype in topoIIα-depleted cells, an anti-caspase 3 Western blot was performed (Fig. 4E). Caspase 3, the executioner caspase in apoptosis, was clearly activated in topoIIα-depleted cells, as shown by the cleavage of full-length protein. Finally, a BrdUrd labeling approach was used to confirm the S phase arrest induced by topoIIα depletion. As shown in Fig. 4F, at 3 days post-transfection, topoIIα-depleted cells showed a slightly higher percentage of BrdUrd-positive cells compared with that of control cells, indicating that topoIIα is not required for DNA synthesis per se but might be involved in other interphase functions. Depletion of TopoIIα Leads to Multiple Cell Cycle Defects—Considering that topoIIα is involved in chromosome condensation and segregation (1Nitiss J.L. Biochim. Biophys. Acta. 1998; 1400: 63-81Crossref PubMed Scopus (312) Google Scholar), we next examined the possible mitotic defects induced by topoIIα depletion. For that purpose, topoIIα was depleted in synchronized cells using the protocol shown in Fig. 5A. TopoIIα-depleted cells showed obvious defects in chromosome behavior during mitosis, especially in sister chromatid separation. As shown in Fig. 5B, topoIIα-depleted cells were eventually able to go through mitosis but with obvious connected DNA bridges between separated sister chromatids through all late mitotic stages, including anaphase, telophase, and cytokinesis (Fig. 5B). To confirm the formation of DNA bridges, topoIIα-depleted cells were treated with either DNase or RNase (Fig. 5C). We found that these bridges were sensitive to DNase but not RNase treatment, indicating that they contain DNA. To further analyze topoIIα depletion-induced phenotypes, mitotic progression was followed by staining with a phosphohistone H3 antibody. Although no dramatic difference between control cells and topoIIα-depleted cells was detected, topoIIα-depleted cells showed a slight delay in mitotic exit (Fig. 5D). Interestingly, phosphohistone H3 staining was positive in the DNA bridges connecting the separating sister chromatids, even long after cell division (Fig. 5E). We also assessed the percentage of cells expressing the proliferation marker Ki67, which is normally expressed in cells in G1,S,G2, and M phases but not in G0 (19Gerdes J. Lemke H. Baisch H. Wacker H.H. Schwab U. Stein H. J. Immunol. 1984; 133: 1710-1715PubMed Google Scholar). Almost 100% of control cells were detected as Ki67-positive, whereas only about 33% of topoIIα-depleted cells were Ki67-positive, indicating that a significant portion of topoIIα-depleted cells had exited the cell cycle (Fig. 5F). Abnormal nuclear morphology was also observed in topoIIα-depleted cells. Based on DAPI staining, cells can be further categorized into three groups: cells with a normal nucleus, cells with a deformed nucleus, and multinucleated cells. For control cells, ∼95% contained normal nuclei, ∼5% of cells were multinucleated, and very few cells with deformed nuclei were detected. In striking contrast, almost 30% of topoIIα-depleted cells had deformed nuclei, and 20% of topoIIα-depleted cells were multinucleated (Fig. 5G). Taken together, these results indicate that topoIIα is required for chromosome segregation in mitosis. As a different approach, two topoII inhibitors were also utilized to study the effects on cell cycle progression. Accordingly, HeLa cells were synchronized using the double thymidine block, released for different times in the presence of VP16 or ICRF193, and harvested for FACS (Fig. 6). Since a much more stringent synchronization protocol was used here (double thymidine block in Fig. 6 versus a single thymidine block in Fig. 2), FACS profiles of control samples at 0 h points are slightly different, with a better synchronization result after the double thymidine block. Cells treated with VP16 were blocked in S phase over the entire releasing period, probably due to the activation of the DNA damage checkpoint. By inhibiting the religation activity of topoII, VP16 treatment leads to DNA double strand breaks (20Kaufmann S.H. Desnoyers S. Ottaviano Y. Davidson N.E. Poirier G.G. Cancer Res. 1993; 53: 3976-3985PubMed Google Scholar). In contrast, ICRF193 is a topoII inhibitor that does not cause DNA damage but arrests the enzyme at a point in its catalytic cycle after strand passage and religation but before release of the passed DNA (21Roca J. Ishida R. Berger J.M. Andoh T. Wang J.C. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 1781-1785Crossref PubMed Scopus (338) Google Scholar). Cells treated with ICRF193 were able to progress into mitosis and blocked there. Therefore, topoII activity is not essential for DNA replication but is absolutely required for mitosis. That BrdUrd incorporation is not affected in topoIIα-depleted cells also supports such a notion (Fig. 4F). However, we do observe an increase of S phase population in" @default.
• W2024543323 created "2016-06-24" @default.
• W2024543323 creator A5005237831 @default.
• W2024543323 creator A5037015805 @default.
• W2024543323 creator A5069121438 @default.
• W2024543323 date "2008-03-01" @default.
• W2024543323 modified "2023-10-03" @default.
• W2024543323 title "Plk1-dependent Phosphorylation Regulates Functions of DNA Topoisomerase IIα in Cell Cycle Progression" @default.
• W2024543323 cites W103636450 @default.
• W2024543323 cites W1482412291 @default.
• W2024543323 cites W1919687599 @default.
• W2024543323 cites W1978331091 @default.
• W2024543323 cites W1979591487 @default.
• W2024543323 cites W2017619447 @default.
• W2024543323 cites W2017742066 @default.
• W2024543323 cites W2017764877 @default.
• W2024543323 cites W2019391062 @default.
• W2024543323 cites W2020411912 @default.
• W2024543323 cites W2025540821 @default.
• W2024543323 cites W2040132766 @default.
• W2024543323 cites W2058111528 @default.
• W2024543323 cites W2070256138 @default.
• W2024543323 cites W2070312699 @default.
• W2024543323 cites W2075135229 @default.
• W2024543323 cites W2076183717 @default.
• W2024543323 cites W2085190855 @default.
• W2024543323 cites W2092396836 @default.
• W2024543323 cites W2094078115 @default.
• W2024543323 cites W2126486896 @default.
• W2024543323 cites W2128088579 @default.
• W2024543323 cites W2131761459 @default.
• W2024543323 cites W2131837045 @default.
• W2024543323 cites W2138884038 @default.
• W2024543323 cites W2149262930 @default.
• W2024543323 cites W2150651320 @default.
• W2024543323 cites W2157810409 @default.
• W2024543323 cites W2165160051 @default.
• W2024543323 cites W2172117494 @default.
• W2024543323 cites W2399132613 @default.
• W2024543323 doi "https://doi.org/10.1074/jbc.m709007200" @default.
• W2024543323 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18171681" @default.
• W2024543323 hasPublicationYear "2008" @default.
• W2024543323 type Work @default.
• W2024543323 sameAs 2024543323 @default.
• W2024543323 citedByCount "89" @default.
• W2024543323 countsByYear W20245433232012 @default.
• W2024543323 countsByYear W20245433232013 @default.
• W2024543323 countsByYear W20245433232014 @default.
• W2024543323 countsByYear W20245433232015 @default.
• W2024543323 countsByYear W20245433232016 @default.
• W2024543323 countsByYear W20245433232017 @default.
• W2024543323 countsByYear W20245433232018 @default.
• W2024543323 countsByYear W20245433232019 @default.
• W2024543323 countsByYear W20245433232020 @default.
• W2024543323 countsByYear W20245433232021 @default.
• W2024543323 countsByYear W20245433232022 @default.
• W2024543323 countsByYear W20245433232023 @default.
• W2024543323 crossrefType "journal-article" @default.
• W2024543323 hasAuthorship W2024543323A5005237831 @default.
• W2024543323 hasAuthorship W2024543323A5037015805 @default.
• W2024543323 hasAuthorship W2024543323A5069121438 @default.
• W2024543323 hasBestOaLocation W20245433231 @default.
• W2024543323 hasConcept C11960822 @default.
• W2024543323 hasConcept C146276462 @default.
• W2024543323 hasConcept C147897179 @default.
• W2024543323 hasConcept C1491633281 @default.
• W2024543323 hasConcept C153911025 @default.
• W2024543323 hasConcept C185592680 @default.
• W2024543323 hasConcept C29537977 @default.
• W2024543323 hasConcept C2994037739 @default.
• W2024543323 hasConcept C552990157 @default.
• W2024543323 hasConcept C55493867 @default.
• W2024543323 hasConcept C86803240 @default.
• W2024543323 hasConcept C95444343 @default.
• W2024543323 hasConceptScore W2024543323C11960822 @default.
• W2024543323 hasConceptScore W2024543323C146276462 @default.
• W2024543323 hasConceptScore W2024543323C147897179 @default.
• W2024543323 hasConceptScore W2024543323C1491633281 @default.
• W2024543323 hasConceptScore W2024543323C153911025 @default.
• W2024543323 hasConceptScore W2024543323C185592680 @default.
• W2024543323 hasConceptScore W2024543323C29537977 @default.
• W2024543323 hasConceptScore W2024543323C2994037739 @default.
• W2024543323 hasConceptScore W2024543323C552990157 @default.
• W2024543323 hasConceptScore W2024543323C55493867 @default.
• W2024543323 hasConceptScore W2024543323C86803240 @default.
• W2024543323 hasConceptScore W2024543323C95444343 @default.
• W2024543323 hasIssue "10" @default.
• W2024543323 hasLocation W20245433231 @default.
• W2024543323 hasOpenAccess W2024543323 @default.
• W2024543323 hasPrimaryLocation W20245433231 @default.
• W2024543323 hasRelatedWork W1999385302 @default.
• W2024543323 hasRelatedWork W2004681005 @default.
• W2024543323 hasRelatedWork W2011009825 @default.
• W2024543323 hasRelatedWork W2024160864 @default.
• W2024543323 hasRelatedWork W2081626500 @default.
• W2024543323 hasRelatedWork W2101008956 @default.
• W2024543323 hasRelatedWork W2793835951 @default.
• W2024543323 hasRelatedWork W3106032671 @default.

• next