FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2024554245> ?p ?o ?g. }

• W2024554245 endingPage "102" @default.
• W2024554245 startingPage "87" @default.
• W2024554245 abstract "The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-α (IFN-α) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-α/β producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-α production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5′ TTTTCAATTCGAAGATGAAT 3′ (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-α. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-α induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-α without pre-incubation with lipofectin, for instance the ODN 2216 (5′ GGGGGACGATCGTCGGGGGG 3′). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-α levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-α. The identity of the IFN-α producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-α and surface markers. Approximately 1–3 IPC/103 PBMC were detected, compared to only 3 IPC/104 PBMC stimulated by Aujeszky’s disease virus. The IPC frequencies were confirmed by detection of IFN-α mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC." @default.
• W2024554245 created "2016-06-24" @default.
• W2024554245 creator A5025233154 @default.
• W2024554245 creator A5025974509 @default.
• W2024554245 creator A5051475864 @default.
• W2024554245 creator A5067191958 @default.
• W2024554245 creator A5078557164 @default.
• W2024554245 creator A5080303392 @default.
• W2024554245 date "2004-09-01" @default.
• W2024554245 modified "2023-09-28" @default.
• W2024554245 title "Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-α in the pig and the phenotype of the IFN-α producing cells" @default.
• W2024554245 cites W1468684175 @default.
• W2024554245 cites W1485179699 @default.
• W2024554245 cites W1510227107 @default.
• W2024554245 cites W1514540900 @default.
• W2024554245 cites W1538844879 @default.
• W2024554245 cites W1555706276 @default.
• W2024554245 cites W1591562094 @default.
• W2024554245 cites W1606181274 @default.
• W2024554245 cites W1668839376 @default.
• W2024554245 cites W1819432277 @default.
• W2024554245 cites W1966052560 @default.
• W2024554245 cites W1967879964 @default.
• W2024554245 cites W1969702096 @default.
• W2024554245 cites W1978962348 @default.
• W2024554245 cites W1981164863 @default.
• W2024554245 cites W1981289301 @default.
• W2024554245 cites W1983565987 @default.
• W2024554245 cites W1985870186 @default.
• W2024554245 cites W1986315531 @default.
• W2024554245 cites W1987867113 @default.
• W2024554245 cites W1998192249 @default.
• W2024554245 cites W1999070120 @default.
• W2024554245 cites W2001080072 @default.
• W2024554245 cites W2004726009 @default.
• W2024554245 cites W2006772331 @default.
• W2024554245 cites W2009323949 @default.
• W2024554245 cites W2009753070 @default.
• W2024554245 cites W2018251038 @default.
• W2024554245 cites W2026054459 @default.
• W2024554245 cites W2028007958 @default.
• W2024554245 cites W2033441782 @default.
• W2024554245 cites W2035892143 @default.
• W2024554245 cites W2036287577 @default.
• W2024554245 cites W2036799823 @default.
• W2024554245 cites W2037653553 @default.
• W2024554245 cites W2040024010 @default.
• W2024554245 cites W2057237586 @default.
• W2024554245 cites W2062350041 @default.
• W2024554245 cites W2065357088 @default.
• W2024554245 cites W2067351187 @default.
• W2024554245 cites W2069240580 @default.
• W2024554245 cites W2069981713 @default.
• W2024554245 cites W2072075206 @default.
• W2024554245 cites W2072477927 @default.
• W2024554245 cites W2077226482 @default.
• W2024554245 cites W2081565453 @default.
• W2024554245 cites W2082537000 @default.
• W2024554245 cites W2090819044 @default.
• W2024554245 cites W2091303798 @default.
• W2024554245 cites W2093508027 @default.
• W2024554245 cites W2093872322 @default.
• W2024554245 cites W2095410517 @default.
• W2024554245 cites W2101760818 @default.
• W2024554245 cites W2104904748 @default.
• W2024554245 cites W2113779347 @default.
• W2024554245 cites W2118011548 @default.
• W2024554245 cites W2119110692 @default.
• W2024554245 cites W2129651283 @default.
• W2024554245 cites W2130645896 @default.
• W2024554245 cites W2148704093 @default.
• W2024554245 cites W2155850103 @default.
• W2024554245 cites W2160063406 @default.
• W2024554245 cites W2238796300 @default.
• W2024554245 cites W2298453299 @default.
• W2024554245 cites W2316206988 @default.
• W2024554245 cites W4313333649 @default.
• W2024554245 doi "https://doi.org/10.1016/j.vetimm.2004.04.017" @default.
• W2024554245 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/7125693" @default.
• W2024554245 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15261695" @default.
• W2024554245 hasPublicationYear "2004" @default.
• W2024554245 type Work @default.
• W2024554245 sameAs 2024554245 @default.
• W2024554245 citedByCount "24" @default.
• W2024554245 countsByYear W20245542452012 @default.
• W2024554245 countsByYear W20245542452020 @default.
• W2024554245 crossrefType "journal-article" @default.
• W2024554245 hasAuthorship W2024554245A5025233154 @default.
• W2024554245 hasAuthorship W2024554245A5025974509 @default.
• W2024554245 hasAuthorship W2024554245A5051475864 @default.
• W2024554245 hasAuthorship W2024554245A5067191958 @default.
• W2024554245 hasAuthorship W2024554245A5078557164 @default.
• W2024554245 hasAuthorship W2024554245A5080303392 @default.
• W2024554245 hasBestOaLocation W20245542451 @default.
• W2024554245 hasConcept C104317684 @default.
• W2024554245 hasConcept C140173407 @default.
• W2024554245 hasConcept C150194340 @default.
• W2024554245 hasConcept C153911025 @default.

• next