FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2024554350> ?p ?o ?g. }

• W2024554350 endingPage "12436" @default.
• W2024554350 startingPage "12426" @default.
• W2024554350 abstract "Recent evidence suggests a role for base excision repair (BER) proteins in the response to DNA interstrand crosslinks, which block replication and transcription, and lead to cell death and genetic instability. Employing fluorescently tagged fusion proteins and laser microirradiation coupled with confocal microscopy, we observed that the endonuclease VIII-like DNA glycosylase, NEIL1, accumulates at sites of oxidative DNA damage, as well as trioxsalen (psoralen)-induced DNA interstrand crosslinks, but not to angelicin monoadducts. While recruitment to the oxidative DNA lesions was abrogated by the anti-oxidant N-acetylcysteine, this treatment did not alter the accumulation of NEIL1 at sites of interstrand crosslinks, suggesting distinct recognition mechanisms. Consistent with this conclusion, recruitment of the NEIL1 population variants, G83D, C136R, and E181K, to oxidative DNA damage and psoralen-induced interstrand crosslinks was differentially affected by the mutation. NEIL1 recruitment to psoralen crosslinks was independent of the nucleotide excision repair recognition factor, XPC. Knockdown of NEIL1 in LN428 glioblastoma cells resulted in enhanced recruitment of XPC, a more rapid removal of digoxigenin-tagged psoralen adducts, and decreased cellular sensitivity to trioxsalen plus UVA, implying that NEIL1 and BER may interfere with normal cellular processing of interstrand crosslinks. While exhibiting no enzymatic activity, purified NEIL1 protein bound stably to psoralen interstrand crosslink-containing synthetic oligonucleotide substrates in vitro. Our results indicate that NEIL1 recognizes specifically and distinctly interstrand crosslinks in DNA, and can obstruct the efficient removal of lethal crosslink adducts. Recent evidence suggests a role for base excision repair (BER) proteins in the response to DNA interstrand crosslinks, which block replication and transcription, and lead to cell death and genetic instability. Employing fluorescently tagged fusion proteins and laser microirradiation coupled with confocal microscopy, we observed that the endonuclease VIII-like DNA glycosylase, NEIL1, accumulates at sites of oxidative DNA damage, as well as trioxsalen (psoralen)-induced DNA interstrand crosslinks, but not to angelicin monoadducts. While recruitment to the oxidative DNA lesions was abrogated by the anti-oxidant N-acetylcysteine, this treatment did not alter the accumulation of NEIL1 at sites of interstrand crosslinks, suggesting distinct recognition mechanisms. Consistent with this conclusion, recruitment of the NEIL1 population variants, G83D, C136R, and E181K, to oxidative DNA damage and psoralen-induced interstrand crosslinks was differentially affected by the mutation. NEIL1 recruitment to psoralen crosslinks was independent of the nucleotide excision repair recognition factor, XPC. Knockdown of NEIL1 in LN428 glioblastoma cells resulted in enhanced recruitment of XPC, a more rapid removal of digoxigenin-tagged psoralen adducts, and decreased cellular sensitivity to trioxsalen plus UVA, implying that NEIL1 and BER may interfere with normal cellular processing of interstrand crosslinks. While exhibiting no enzymatic activity, purified NEIL1 protein bound stably to psoralen interstrand crosslink-containing synthetic oligonucleotide substrates in vitro. Our results indicate that NEIL1 recognizes specifically and distinctly interstrand crosslinks in DNA, and can obstruct the efficient removal of lethal crosslink adducts. A wide spectrum of DNA damage is generated through spontaneous decomposition, reactions with endogenously produced chemical species, and direct or indirect interactions with various exogenous agents. Some of the most common forms of DNA damage include simple base alterations, abasic sites, and single-strand breaks (1Lindahl T. Instability and decay of the primary structure of DNA.Nature. 1993; 362: 709-715Crossref PubMed Scopus (4325) Google Scholar). More complex lesions, which are more typically associated with environmental or clinical DNA-damaging agents, include helix-distorting (bulky) base adducts, double-strand breaks, and intra or interstrand crosslinks (2Stone M.P. Huang H. Brown K.L. Shanmugam G. Chemistry and structural biology of DNA damage and biological consequences.Chem. Biodivers. 2011; 8: 1571-1615Crossref PubMed Scopus (37) Google Scholar). To prevent the genotoxic and lethal consequences of DNA damage, organisms have evolved a series of distinct, albeit interconnected, DNA repair mechanisms (3Jackson S.P. Bartek J. The DNA-damage response in human biology and disease.Nature. 2009; 461: 1071-1078Crossref PubMed Scopus (3828) Google Scholar). The base excision repair (BER) 2The abbreviations used are: BERbase excision repairNACN-acetylcysteineAPapurinic/apyrimidinicMPG3-methyladenine DNA glycosylaseUNGuracil DNA glycosylaseDAPIdiamidino-2-phenylindoledig-psodigoxigenin-labeled psoralen. pathway is the predominant system for coping with spontaneous hydrolytic, oxidative, and alkylative DNA modifications (4Wilson 3rd, D.M. Bohr V.A. The mechanics of base excision repair, and its relationship to aging and disease.DNA Repair. 2007; 6: 544-559Crossref PubMed Scopus (267) Google Scholar). Such lesions include uracil, 8-oxoguanine, 3-methyladenine, apurinic/apyrimidinic (AP) sites, and a variety of DNA single-strand break ends. Classic BER involves substrate base removal by a DNA glycosylase, incision at the resulting abasic site by an AP endonuclease, gap-filling by a DNA polymerase and sealing of the remaining nick by a DNA ligase. Although BER has traditionally been thought to recognize lesions that have little impact on overall DNA structure, recent evidence has implicated a direct involvement of BER in the processing of interstrand crosslinks (5Wilson 3rd, D.M. Seidman M.M. A novel link to base excision repair?.Trends Biochem. Sci. 2010; 35: 247-252Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar). This damage involves the covalent linkage of the two complementary strands of DNA, thereby preventing strand separation that is required for events such as transcription and replication. Thus, interstrand crosslinks are highly toxic DNA modifications, which can promote genomic instability (6Muniandy P.A. Liu J. Majumdar A. Liu S.T. Seidman M.M. DNA interstrand crosslink repair in mammalian cells: step by step.Crit. Rev. Biochem. Mol. Biol. 2010; 45: 23-49Crossref PubMed Scopus (139) Google Scholar). base excision repair N-acetylcysteine apurinic/apyrimidinic 3-methyladenine DNA glycosylase uracil DNA glycosylase diamidino-2-phenylindole digoxigenin-labeled psoralen. Some of the early data that suggested a role for BER factors in the removal of DNA lesions formed by crosslinking agents includes the mild hypersensitivities reported for homozygous 3-methyladenine DNA glycosylase (MPG)-deficient mouse cells to bis-chloroethylnitrosourea and mitomycin C (7Engelward B.P. Dreslin A. Christensen J. Huszar D. Kurahara C. Samson L. Repair-deficient 3-methyladenine DNA glycosylase homozygous mutant mouse cells have increased sensitivity to alkylation-induced chromosome damage and cell killing.EMBO J. 1996; 15: 945-952Crossref PubMed Scopus (183) Google Scholar, 8Allan J.M. Engelward B.P. Dreslin A.J. Wyatt M.D. Tomasz M. Samson L.D. Mammalian 3-methyladenine DNA glycosylase protects against the toxicity and clastogenicity of certain chemotherapeutic DNA cross-linking agents.Cancer Res. 1998; 58: 3965-3973PubMed Google Scholar). Whether or not this increased sensitivity was the result of impaired removal of interstrand crosslinks or one of the many monoadducts formed by these compounds, however, was not determined. More recent data from the Samson laboratory indicate that MPG (also known as AAG) is important for resistance of mouse embryonic stem cells to psoralen-induced interstrand crosslinks, but not angelicin-induced monoadducts, although the exact molecular process that engages MPG has not been elucidated (9Maor-Shoshani A. Meira L.B. Yang X. Samson L.D. 3-Methyladenine DNA glycosylase is important for cellular resistance to psoralen interstrand cross-links.DNA Repair. 2008; 7: 1399-1406Crossref PubMed Scopus (15) Google Scholar). In a separate study, Saparbaev and co-workers found that the human DNA glycosylase, endonuclease VIII-like 1 (NEIL1), excises psoralen-induced monoadducts in duplex DNA, initiating a classic BER response involving the AP endonuclease APE1 (10Couvé-Privat S. Macé G. Rosselli F. Saparbaev M.K. Psoralen-induced DNA adducts are substrates for the base excision repair pathway in human cells.Nucleic Acids Res. 2007; 35: 5672-5682Crossref PubMed Scopus (51) Google Scholar). Consistently, HeLa cells depleted for NEIL1 or APE1 were shown to be hypersensitive to 8-methoxypsoralen (+UVA) exposure, a treatment scheme that creates a significant percentage of monoadduct products (10Couvé-Privat S. Macé G. Rosselli F. Saparbaev M.K. Psoralen-induced DNA adducts are substrates for the base excision repair pathway in human cells.Nucleic Acids Res. 2007; 35: 5672-5682Crossref PubMed Scopus (51) Google Scholar, 11Lai C. Cao H. Hearst J.E. Corash L. Luo H. Wang Y. Quantitative analysis of DNA interstrand cross-links and monoadducts formed in human cells induced by psoralens and UVA irradiation.Anal. Chem. 2008; 80: 8790-8798Crossref PubMed Scopus (60) Google Scholar). More recently, Saparbaev and co-workers found that NEIL1 can also excise an unhooked interstrand crosslink remnant within a synthetic three-stranded DNA structure, catalyzing a classic BER reaction in vitro (12Couvé S. Macé-Aimé G. Rosselli F. Saparbaev M.K. The human oxidative DNA glycosylase NEIL1 excises psoralen-induced interstrand DNA cross-links in a three-stranded DNA structure.J. Biol. Chem. 2009; 284: 11963-11970Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). These data imply multiple routes of entry for NEIL1 in the psoralen crosslink response. Unlike the above work, which suggested a role for BER components in the repair of crosslink adducts, Patrick and co-workers found that cells deficient in BER display a cisplatin-resistant phenotype, which is accompanied by enhanced excision of cisplatin-induced interstrand crosslinks (13Kothandapani A. Dangeti V.S. Brown A.R. Banze L.A. Wang X.H. Sobol R.W. Patrick S.M. Novel role of base excision repair in mediating cisplatin cytotoxicity.J. Biol. Chem. 2011; 286: 14564-14574Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). In particular, they demonstrated that the region around a cisplatin interstrand crosslink is susceptible to increased spontaneous decay, namely cytosine deamination, due to a local structural distortion in the duplex. This physical and chemical feature of the crosslinked DNA results in a uracil-specific BER response, which would occur near the interstrand crosslink and thus interfere with the normal repair processes in vivo. Consistently, the authors found that cells defective in uracil DNA glycosylase (UNG), APE1, or POLβ function, key elements of an effective BER reaction, exhibit a cisplatin-specific resistant phenotype. Given the complex picture that is emerging regarding the role of BER in interstrand crosslink processing, we sought herein to better define the involvement of NEIL1 in the cellular response to trioxsalen (psoralen)-induced interstrand crosslinks. U2OS and HeLa cells were obtained from ATCC (Manassas, VA); mutant XPC15 and corrected XPC16 cell lines from Coriell Medical Institute (Camden, NJ); and NEIL1 knockdown and control LN428 cell lines from Trevigen (Gaithersburg, MD). Dulbecco's modified Eagle's media (DMEM) was acquired from Invitrogen Corporation (Carlsbad, CA). Vectorshield Hard Set mounting medium was obtained from Vector Laboratories (Burlingame, CA), and trioxsalen, angelicin, and N-acetylcysteine were from Sigma, Aldrich. The chemical design and characterization of digoxigenin-tagged trimethylpsoralen (dig-pso) has been described previously (14Thazhathveetil A.K. Liu S.T. Indig F.E. Seidman M.M. Psoralen conjugates for visualization of genomic interstrand cross-links localized by laser photoactivation.Bioconjug. Chem. 2007; 18: 431-437Crossref PubMed Scopus (42) Google Scholar). To generate the C-terminal fluorescently-tagged NEIL1 expression construct, the NEIL1 coding region was PCR amplified in 4% DMSO using the Hercules II Fusion Enzyme according to the manufacturer's guidelines (Stratagene, Agilent Technologies, Santa Clara, CA) with primers 5HNEIL1 (5′-CCCCAAGCTTGCCACCATGCCTGAGGGCCCCGAGCT-3′) and 3ENEIL1 (5′-CGGAATTCCAGAGGCTGAGGTCCCCTCTGGT-3′), and a cDNA template obtained from Origene (Rockville, MD; catalogue no. SC123674). The PCR product was digested accordingly and subcloned into the HindIII and EcoR1 restriction sites of either pmCherry-N1 or pAcGFP1-N1 (Clontech). Nucleotide substitutions were introduced into the WT pAcGFP-NEIL1 plasmid using the QuikChange II XL Site-directed Mutagenesis kit (Stratagene) to create the G83D, C136R, and E181K variant GFP-fusion constructs. HeLa, U2OS, XPC15 mutant, or XPC16 complemented cells were grown in DMEM with 10% FBS, 1% penicillin/streptomycin, and 1% glutamate at 5% CO2 and 37 °C. The designated plasmid was transfected into 200,000 cells, which had been adhered for 24 h to a 35-mm glass bottom culture dish with a 10-mm microwell (MatTek Corporation, Ashland, MA), using the Dreamfect reagent according to the manufacturer's standard protocol (OZ Biosciences, Marseille, France). In brief, 1 μg of plasmid was combined with the Dreamfect reagent and incubated at room temperature for 20 min. After this time, the mixture was added to the adhered cells for 4 h and then removed. Cells were incubated for 48 h under standard culture conditions and used to determine the intracellular localization or recruitment dynamics of the specified fluorescently tagged fusion protein. With the LN428 cell lines, an identical procedure (see above) was employed using a pEGFP-N3 vector that harbors full-length XPC (15Hoogstraten D. Bergink S. Ng J.M. Verbiest V.H. Luijsterburg M.S. Geverts B. Raams A. Dinant C. Hoeijmakers J.H. Vermeulen W. Houtsmuller A.B. Versatile DNA damage detection by the global genome nucleotide excision repair protein XPC.J. Cell Sci. 2008; 121: 2850-2859Crossref PubMed Scopus (94) Google Scholar). HeLa or U2OS cells were transfected with the indicated plasmid using the approach outlined above in slide chambers. 48 h post-transfection, the medium was removed, and cells were sealed under a glass coverslip with 50 μl of Vectorshield Hard Set mounting medium with diamidino-2-phenylindole dye (DAPI). The slides were allowed to harden overnight at 4 °C, and were viewed using a Nikon Eclipse TE2000-E microscope equipped with a CCD camera (Hamamatsu, Tokyo, Japan) and various fluorescence modules. Velocity software (Improvision, PerkinElmer, Coventry, England) was used to capture and process images. All images were acquired using identical gain, exposure, sensitivity, and contrast settings. Localized microirradiation was performed using the Nikon Eclipse TE2000-E microscope set-up described above, a SRS NL100 nitrogen pumped dye laser with Micropoint ablation system (Photonics Instruments, St. Charles, IL) adjusted via passage through a dye to generate a wavelength of 365 nm, and a CSU10 spinning disk system (Yokogawa, Japan). Laser power was attenuated in terms of percent intensity using Velocity software (see above). In particular, a defined laser intensity was directed to deliver pulses to a delineated rectangular region of interest (94 × 20 pixels, 0.16 μm/pixel) using a Plan Fluor ×60/1.25 numerical aperture oil objective. Galvanometer-driven beam displacers oriented the laser beam, which fired randomly throughout the region until complete exposure was obtained; 300 nm was used for the diffraction limited spot size. The laser fires 3-ns pulses with a 10 Hz repetition rate with a power of 0.7 nanowatts, measured at the back aperture of the ×60 objective at 365 nm. A setting of 1.7% (for psoralen) and 2.2% (for angelicin) was used to create interstrand crosslinks or monoadducts in the targeted region. A setting of 2.7% was used to create free radical induced single strand breaks (16Muniandy P.A. Thapa D. Thazhathveetil A.K. Liu S.T. Seidman M.M. Repair of laser-localized DNA interstrand cross-links in G1 phase mammalian cells.J. Biol. Chem. 2009; 284: 27908-27917Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). 30 min prior to the experiment, cells (as indicated) were treated either with 5 μm psoralen (30 min at 37 °C), 40 μm angelicin (30 min at 37 °C), or not at all. Throughout the experiment, adhered cells were maintained at 80% humidity, 5% CO2, and 37 °C using a live cell environmental chamber or CO2 enhancement workhead (Slonet Scientific, Segensworth, UK). Live cells were subjected to site directed laser damage at various intensities (see above). The data were analyzed using the Velocity software listed above and “region of interest fluorescent intensity” was photographically recorded as specified. All images were acquired using identical gain, exposure, sensitivity, and contrast settings. To examine the effects of the antioxidant N-acetylcysteine (NAC), repair proficient HeLa cells were transfected with the pAcGFP-NEIL1 plasmid (see above) and cultured for an additional 48 h. NAC was then added to the media at a final concentration of 6 mm, and where indicated, psoralen was added 30 min prior to laser microirradiation. The cells were subsequently microirradiated at either 2.7% alone or 1.7% in the presence of psoralen. As described above, live cells were subjected to site directed laser damage and subsequent recruitment (or lack thereof) was photographically recorded. The data were analyzed, and the images were acquired as detailed above. Control and NEIL1 knockdown LN428 cell lines (Trevigen) were cultured in DMEM. Once cells reached 80% confluence, they were trypsinized, washed with PBS, and harvested by centrifugation. Cell pellets were frozen at −80 °C for 1 h prior to extract preparation. Cells were re-suspended in 1 ml lysis buffer (50 mm Tris, pH 7.4, 1 mm EDTA, 1 mm DTT, 10% glycerol, 0.5 mm PMSF) and sonicated. Following centrifugation, a Bradford assay (Bio-Rad) was run to determine the protein concentration of the supernatant (whole cell extract). 30 μg of each extract was separated on a Nupage MOPS gel (Invitrogen), and the protein was transferred to a 0.2 μm PVDF membrane (Invitrogen) using standard blotting procedures. Anti-NEIL1 rabbit polyclonal antibody (Calbiochem, EMD Biosciences, San Diego, CA) was used as the primary antibody, followed by goat anti-rabbit HRP-conjugated secondary antibody (Pierce Biotechnology). Detection was carried out using a Pierce Super signal kit. β-Actin levels were determined on the same blot to ensure equal loading of whole cell extracts using a rabbit polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA) and the same goat anti-rabbit secondary as above. Blots were exposed to film, and all data were analyzed using ImageQuant TL software (GE Healthcare). Control and NEIL1 knockdown LN428 cell lines (Trevigen) were grown to confluence, trypsinized and counted, and 100 cells were then transferred to each well of a 6-well plate. Treatments were carried out at the designated concentrations of trioxsalen (plus UVA light using a UVA Rayonet box from Southern New England Ultraviolet Company (Branford, CT)) as outlined previously (16Muniandy P.A. Thapa D. Thazhathveetil A.K. Liu S.T. Seidman M.M. Repair of laser-localized DNA interstrand cross-links in G1 phase mammalian cells.J. Biol. Chem. 2009; 284: 27908-27917Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Cells were then gently washed twice with 1× PBS, and incubated for 10 days with fresh DMEM to allow individual colonies to form. Colonies were stained with methylene blue and counted, and the percent survival determined relative to the untreated control. Control and NEIL1 knockdown cells (Trevigen) were seeded (2 × 105) in a 35-mm glass bottom culture dish for 24 h. These cells were treated with 20 μm dig-pso and incubated at 37 °C for 30 min prior to laser treatment at 1.7% intensity (14Thazhathveetil A.K. Liu S.T. Indig F.E. Seidman M.M. Psoralen conjugates for visualization of genomic interstrand cross-links localized by laser photoactivation.Bioconjug. Chem. 2007; 18: 431-437Crossref PubMed Scopus (42) Google Scholar, 16Muniandy P.A. Thapa D. Thazhathveetil A.K. Liu S.T. Seidman M.M. Repair of laser-localized DNA interstrand cross-links in G1 phase mammalian cells.J. Biol. Chem. 2009; 284: 27908-27917Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). After the laser treatment, cells were fixed either immediately or at the indicated time point in 4% formaldehyde for 10 min at room temperature. Fixed cells were permeabilized with 0.5% Triton X-100, 1% BSA, 100 mm glycine, and 0.2 mg/ml EDTA in PBS on ice for 10 min, and subsequently digested with RNase A. Cells were blocked with 10% goat serum in PBS with 0.01% sodium azide for 1 h at 37 °C. Immunofluorescence staining using a primary digoxigenin antibody (Abcam, Cambridge, MA) and γH2AX antibody (Santa Cruz Biotechnology) was carried out. Secondary antibodies (Alexa Fluor goat anti-mouse and Alexa Fluor goat anti-rabbit (Molecular Probes)) were used for visualization. Approximately 20–25 cells were visualized for each time point. Mean Intensity of dig-pso from each cell at the damage site was measured (Velocity 6.01 version, Perkin Elmer) and corrected for background with background intensity from undamaged site of that respective cell. The oligonucleotides used to create the different DNA substrates were synthesized and gel purified by Integrated DNA Technologies, Inc. (San Jose, CA): 34–5OHC, CTGCAGCTGATGCGC[5OHC]GTACGGATCCCCGGGTAC; 34G, GTACCCGGGGATCCGTACGGCGCATCAGCTGCAG; D21, CCGCGGCGTACCGGCCGCGGC; and C21, TTGCCGCGGCCGGTACGCCGCGG. To generate the interstrand crosslink-containing duplex (D21/C21 ICL), 5 nmol of each D21 and C21 were annealed in TE buffer, and this 5 μm DNA solution was then incubated with 50 μm 4,5′,8-trimethylpsoralen for 1 h in the dark in 5 mm Tris (pH 7.6), 50 mm NaCl, and 0.2 mm EDTA. This mixture was subsequently irradiated for 20 min with UVA light (365 nm) on ice. The irradiated samples were purified over a DIONEX DNAPac ion exchange column on a Shimadzu HPLC system (LC-10ADvp) with a dual wavelength detector (SPD-10ADvp) and an auto injector (SIL-10AVvp). A solution of 25 mm NaOH (mobile phase A) and 1 m NaCl in 25 mm NaOH (mobile phase B) was used for separation of uncrosslinked and crosslinked DNA. A gradient of 2 min 10–50% B, 20 min 50–90% B, and 21 min 90–100% B was employed with a flow rate of 1.0 ml/min. The fractions were immediately neutralized after collection by the addition of Tris buffer, pH 7.4. The fractions containing the interstrand crosslinked DNA were pooled and desalted by dialysis in water in a 2,000 molecular weight cutoff cassette (Thermo Scientific, Rockford, IL) at 4 °C overnight and concentrated in a Speed-vac concentrator. The D21/C21 ICL substrate was 5′ end-labeled by T4 polynucleotide kinase (New England Biolabs, Beverly, MA) and [γ-32P]ATP (3000 Ci/mmol, Perkin Elmer, Waltham, MA) using a standard protocol. For the 5-hydroxycytosine (5OHC) positive control substrate, the damage-containing strand was 5′ end-labeled prior to annealing to the cold complementary 34G strand. For the D21/C21 duplex that did not contain the site-specific interstrand crosslink, the C21 strand was radiolabeled prior to annealing to the complementary D21 oligonucleotide. To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs). After incubation at 37 °C for 10 min, the reaction was stopped by the addition of formamide loading buffer (95% formamide, 10 mm EDTA, bromphenol blue, and xylene cyanol) and heated to 90 °C for 10 min followed by incubation on ice for 3 min. The reactions were then resolved on a 20% polyacrylamide denaturing urea gel (National Diagnostics, Atlanta, GA) at 250 mV for 2.5 h. The gel was exposed to a phosphor screen (GE Healthcare, Pittsburgh, PA), which was subsequently imaged on a GE Healthcare Typhoon Trio+ Variable Mode Imager. To assess stable DNA binding, electrophoretic mobility shift assays (EMSAs) were performed by incubating NEIL1 protein (New England Biolabs) at 7.5, 22.5, or 75 ng with 100 fmol of the appropriate labeled substrate in a 10 μl volume of 70 mm MOPS, pH 7.5, 1 mm EDTA, 1 mm DTT, and 5% glycerol. Following incubation for 15 min on ice, binding reactions were resolved on an 8% polyacrylamide non-denaturing gel in TBE at 100 V for 120 min. The gel was exposed and imaged as above, and all data were analyzed using ImageQuant software (GE Healthcare). As a means of evaluating the role of DNA repair proteins in an interstrand crosslink response, we have employed a strategy whereby we transiently express fluorescent-tagged fusion proteins in human cells and monitor their recruitment dynamics to and retention time at specified sites of laser-induced DNA damage. In these experiments, photoactivated trioxsalen (psoralen) is used as the interstrand crosslinking agent, and angelicin is used as a control to generate monoadducts exclusively (Ref. 16Muniandy P.A. Thapa D. Thazhathveetil A.K. Liu S.T. Seidman M.M. Repair of laser-localized DNA interstrand cross-links in G1 phase mammalian cells.J. Biol. Chem. 2009; 284: 27908-27917Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar; further details below). Our studies herein focus on the NEIL1 DNA glycosylase, since this protein has been previously shown to play multiple roles in interstrand crosslink repair (10Couvé-Privat S. Macé G. Rosselli F. Saparbaev M.K. Psoralen-induced DNA adducts are substrates for the base excision repair pathway in human cells.Nucleic Acids Res. 2007; 35: 5672-5682Crossref PubMed Scopus (51) Google Scholar, 12Couvé S. Macé-Aimé G. Rosselli F. Saparbaev M.K. The human oxidative DNA glycosylase NEIL1 excises psoralen-induced interstrand DNA cross-links in a three-stranded DNA structure.J. Biol. Chem. 2009; 284: 11963-11970Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). When transiently expressed in human cervical carcinoma (HeLa) cells, NEIL1 tagged with GFP at the C terminus exhibits diffuse nuclear localization, with a significant concentration in the nucleolus (Fig. 1A). NEIL1 tagged with an alternative fluorescent protein (mCherry) displays a similar pattern of intracellular localization whether expressed in HeLa cells (data not shown) or human osteosarcoma U2OS cells (Fig. 1B). After confirming predominantly nuclear targeting of the tagged NEIL1 protein, we determined the recruitment dynamics of GFP-NEIL1 to defined sites of DNA damage using laser microirradiation coupled with confocal microscopy. Initially, we employed a high laser dose (2.7%) known to generate DNA damage (likely oxidative lesions; see below) processed by the BER pathway to test the functionality of the GFP-NEIL1 fusion protein. As shown in Fig. 2 (top row), nucleoplasmic, and not apparently nucleolar, GFP-NEIL1 rapidly accumulates at the site of high dose irradiation. To determine whether NEIL1 responds to psoralen-induced adducts, pGFP-NEIL1 transfected HeLa cells were incubated with trioxsalen in culture, and then specified regions within the nucleus were targeted with laser intensities sufficient to activate the compound, but too low to produce significant oxidative lesions (1.7%). As seen in Fig. 2 (second row), GFP-NEIL1 was immediately recruited to sites of DNA interstrand crosslink damage (i.e. at the 5 s time point), dispersed completely by 8 min, and didn't re-localize to the irradiated region out to 60 min post-laser treatment (not shown). Importantly, the fusion protein did not recruit to sites treated with the low (1.7%) laser dose alone (i.e. no psoralen; Fig. 2, middle row). To determine whether the GFP-NEIL1 response observed above is specific to psoralen-induced interstrand crosslinks and not monoadducts, we employed angelicin, a photoreactive analog of psoralen that can form only monoadducts repaired by nucleotide excision repair (NER). As depicted in Fig. 2, GFP-NEIL1 responds neither to angelicin + laser (fourth row) nor to the corresponding laser alone control (2.2%, bottom row), suggesting that the glycosylase is recognizing some feature specific to a trioxsalen-induced interstrand crosslink. Immunofluorescence staining with antibody against XPB confirmed that under our treatment/exposure conditions involving angelicin + laser, we were indeed generating site-specific DNA monoadducts that prompt a classic NER response (data not shown). To determine the contribution of oxidative damage to the NEIL1 response reported above, we employed the anti-oxidant NAC. NAC is the N-acetyl derivative of the amino acid l-cysteine, and its thiol (sulfhydryl) group confers anti-oxidant effects through reduction of free radicals. We postulated that NAC treatment would abrogate any response that is reliant on the formation of oxidative DNA damage. As seen in Fig. 3A, NAC completely suppressed NEIL1 recruitment to sites of the high laser dose treatment (top row), but had no effect on the response to psoralen + low laser (bottom row). These results are consistent with our conclusions that the high laser dose elicits a general BER response and that the NEIL1 protein is reacting to something specific to the crosslinking agent. Prior studies have shown that the NER damage recognition factor, XPC, which exists as part of" @default.
• W2024554350 created "2016-06-24" @default.
• W2024554350 creator A5002346747 @default.
• W2024554350 creator A5063296805 @default.
• W2024554350 creator A5068693127 @default.
• W2024554350 creator A5070162194 @default.
• W2024554350 creator A5075915042 @default.
• W2024554350 creator A5090254925 @default.
• W2024554350 creator A5091274044 @default.
• W2024554350 date "2013-05-01" @default.
• W2024554350 modified "2023-09-26" @default.
• W2024554350 title "NEIL1 Responds and Binds to Psoralen-induced DNA Interstrand Crosslinks" @default.
• W2024554350 cites W1968039715 @default.
• W2024554350 cites W1971777367 @default.
• W2024554350 cites W1982266992 @default.
• W2024554350 cites W2004125597 @default.
• W2024554350 cites W2012442261 @default.
• W2024554350 cites W2027631153 @default.
• W2024554350 cites W2028176167 @default.
• W2024554350 cites W2030519118 @default.
• W2024554350 cites W2048143514 @default.
• W2024554350 cites W2051662963 @default.
• W2024554350 cites W2052260838 @default.
• W2024554350 cites W2062847513 @default.
• W2024554350 cites W2077436902 @default.
• W2024554350 cites W2089207295 @default.
• W2024554350 cites W2089555846 @default.
• W2024554350 cites W2090219305 @default.
• W2024554350 cites W2134259738 @default.
• W2024554350 cites W2141116983 @default.
• W2024554350 cites W2145200068 @default.
• W2024554350 cites W2148827433 @default.
• W2024554350 cites W2152645308 @default.
• W2024554350 cites W2152681057 @default.
• W2024554350 cites W236769407 @default.
• W2024554350 doi "https://doi.org/10.1074/jbc.m113.456087" @default.
• W2024554350 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3642291" @default.
• W2024554350 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/23508956" @default.
• W2024554350 hasPublicationYear "2013" @default.
• W2024554350 type Work @default.
• W2024554350 sameAs 2024554350 @default.
• W2024554350 citedByCount "23" @default.
• W2024554350 countsByYear W20245543502014 @default.
• W2024554350 countsByYear W20245543502015 @default.
• W2024554350 countsByYear W20245543502016 @default.
• W2024554350 countsByYear W20245543502017 @default.
• W2024554350 countsByYear W20245543502018 @default.
• W2024554350 countsByYear W20245543502019 @default.
• W2024554350 countsByYear W20245543502020 @default.
• W2024554350 countsByYear W20245543502021 @default.
• W2024554350 countsByYear W20245543502023 @default.
• W2024554350 crossrefType "journal-article" @default.
• W2024554350 hasAuthorship W2024554350A5002346747 @default.
• W2024554350 hasAuthorship W2024554350A5063296805 @default.
• W2024554350 hasAuthorship W2024554350A5068693127 @default.
• W2024554350 hasAuthorship W2024554350A5070162194 @default.
• W2024554350 hasAuthorship W2024554350A5075915042 @default.
• W2024554350 hasAuthorship W2024554350A5090254925 @default.
• W2024554350 hasAuthorship W2024554350A5091274044 @default.
• W2024554350 hasBestOaLocation W20245543501 @default.
• W2024554350 hasConcept C12554922 @default.
• W2024554350 hasConcept C153911025 @default.
• W2024554350 hasConcept C185592680 @default.
• W2024554350 hasConcept C2781110370 @default.
• W2024554350 hasConcept C54355233 @default.
• W2024554350 hasConcept C552990157 @default.
• W2024554350 hasConcept C55493867 @default.
• W2024554350 hasConcept C86803240 @default.
• W2024554350 hasConceptScore W2024554350C12554922 @default.
• W2024554350 hasConceptScore W2024554350C153911025 @default.
• W2024554350 hasConceptScore W2024554350C185592680 @default.
• W2024554350 hasConceptScore W2024554350C2781110370 @default.
• W2024554350 hasConceptScore W2024554350C54355233 @default.
• W2024554350 hasConceptScore W2024554350C552990157 @default.
• W2024554350 hasConceptScore W2024554350C55493867 @default.
• W2024554350 hasConceptScore W2024554350C86803240 @default.
• W2024554350 hasIssue "18" @default.
• W2024554350 hasLocation W20245543501 @default.
• W2024554350 hasLocation W20245543502 @default.
• W2024554350 hasLocation W20245543503 @default.
• W2024554350 hasLocation W20245543504 @default.
• W2024554350 hasOpenAccess W2024554350 @default.
• W2024554350 hasPrimaryLocation W20245543501 @default.
• W2024554350 hasRelatedWork W1995683710 @default.
• W2024554350 hasRelatedWork W2023725452 @default.
• W2024554350 hasRelatedWork W2053208979 @default.
• W2024554350 hasRelatedWork W2054728413 @default.
• W2024554350 hasRelatedWork W2056185748 @default.
• W2024554350 hasRelatedWork W2088855920 @default.
• W2024554350 hasRelatedWork W2237201333 @default.
• W2024554350 hasRelatedWork W2408983254 @default.
• W2024554350 hasRelatedWork W255419425 @default.
• W2024554350 hasRelatedWork W2953319487 @default.
• W2024554350 hasVolume "288" @default.
• W2024554350 isParatext "false" @default.
• W2024554350 isRetracted "false" @default.
• W2024554350 magId "2024554350" @default.
• W2024554350 workType "article" @default.