FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2024558892> ?p ?o ?g. }

• W2024558892 endingPage "26707" @default.
• W2024558892 startingPage "26702" @default.
• W2024558892 abstract "Our laboratory has cloned the cDNA (Sutter, T. R., Tang, Y. M., Hayes, C. L., Wo, Y.-Y. P., Jabs, E. W., Li, X., Yin, H., Cody, C. W., and Greenlee, W. F. (1994) J. Biol. Chem. 269, 13092–13099) and gene (Tang, Y. M., Wo, Y.-Y. P., Jabs, E. W., Stewart, J. C., Sutter, T. R., and Greenlee, W. F. (1996) J. Biol. Chem. 271, 28324–28330) for humanCYP1B1, a new member of the cytochrome P450 superfamily. Here, we report on the mapping and function of the CYP1B1promoter. The CYP1B1 promoter is fully functional, when it is uncoupled from upstream enhancer elements. Deletion analysis and site-directed mutagenesis identified four regulatory elements required for maximum promoter activity: two antisense Sp1 sites (−84 to −89 and −68 to −73), a TATA-like box (−34 to −29), and an initiator motif (−5 to +3). The initiator and the TATA-like elements are both required for basal promoter activity, with enhanced activity mediated by the two antisense Sp1 elements. The CYP1B1 initiator was demonstrated by in vitro transcription analysis to be a positioning element that maintained fidelity of transcription from a single site. Specific binding to a CYP1B1 initiator probe by human nuclear extract proteins was competed either by the highly homologous murine terminal deoxynucleotidyl transferase initiator or, to a lesser extent, by the adenovirus major late initiator. Taken together, these results indicate that the structure and function of theCYP1B1 promoter confers constitutive expression of the gene and assures fidelity of transcription initiation from a single site. The CYP1B1 promoter is distinct from the promoters of the closely related cytochrome P450s CYP1A1 andCYP1A2 and is structurally and functionally similar to the promoters of constitutively expressed genes and at least two viruses. Our laboratory has cloned the cDNA (Sutter, T. R., Tang, Y. M., Hayes, C. L., Wo, Y.-Y. P., Jabs, E. W., Li, X., Yin, H., Cody, C. W., and Greenlee, W. F. (1994) J. Biol. Chem. 269, 13092–13099) and gene (Tang, Y. M., Wo, Y.-Y. P., Jabs, E. W., Stewart, J. C., Sutter, T. R., and Greenlee, W. F. (1996) J. Biol. Chem. 271, 28324–28330) for humanCYP1B1, a new member of the cytochrome P450 superfamily. Here, we report on the mapping and function of the CYP1B1promoter. The CYP1B1 promoter is fully functional, when it is uncoupled from upstream enhancer elements. Deletion analysis and site-directed mutagenesis identified four regulatory elements required for maximum promoter activity: two antisense Sp1 sites (−84 to −89 and −68 to −73), a TATA-like box (−34 to −29), and an initiator motif (−5 to +3). The initiator and the TATA-like elements are both required for basal promoter activity, with enhanced activity mediated by the two antisense Sp1 elements. The CYP1B1 initiator was demonstrated by in vitro transcription analysis to be a positioning element that maintained fidelity of transcription from a single site. Specific binding to a CYP1B1 initiator probe by human nuclear extract proteins was competed either by the highly homologous murine terminal deoxynucleotidyl transferase initiator or, to a lesser extent, by the adenovirus major late initiator. Taken together, these results indicate that the structure and function of theCYP1B1 promoter confers constitutive expression of the gene and assures fidelity of transcription initiation from a single site. The CYP1B1 promoter is distinct from the promoters of the closely related cytochrome P450s CYP1A1 andCYP1A2 and is structurally and functionally similar to the promoters of constitutively expressed genes and at least two viruses. The cDNA for humanCYP1B1 1The abbreviations and format used for the cytochrome P450s in this report are in accordance with the rules recommended by the P450 Nomenclature Committee, as described by Nelsonet al. (51Nelson D.R. Kamataki T. Waxman D.J. Guengerich F.P. Estabrook R.W. Feyereisen R. Gonzalez F.J. Coon M.J. Gunsalus I.C. Gotoh O. Okuda K. Nebert D.W. DNA Cell Biol. 1993; 12: 1-51Crossref PubMed Scopus (1655) Google Scholar). has been isolated from the human keratinocyte line SCC12(c12c2) and shown to be regulated transcriptionally by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) 2The abbreviations used are: TCDD/dioxin, 2,3,7,8-tetrachlorodibenzo-p-dioxin; AdML, adenovirus major late gene; bp, base pair(s); CAT, chloramphenicol acetyltransferase; DTT, dithiothreitol; Inr, initiator element; nt, nucleotide(s); PCR, polymerase chain reaction; PMSF, phenylmethylsulfonyl fluoride; TdT, terminal deoxynucleotide transferase; TIS, transcription initiation site. (1Sutter T.R. Guzman K. Dold K.M. Greenlee W.F. Science. 1991; 254: 415-418Crossref PubMed Scopus (292) Google Scholar). The protein encoded by the CYP1B1 gene is the only known member of a new cytochrome P450 subfamily, CYP1B (2Sutter T.R. Tang Y.M. Hayes C.L. Wo Y.-Y.P. Jabs E.W. Li X. Yin H. Cody C.W. Greenlee W.F. J. Biol. Chem. 1994; 269: 13092-13099Abstract Full Text PDF PubMed Google Scholar). Orthologous cDNAs have been identified and cloned from tissues from the mouse (3Savas U. Bhattacharyya K.K. Christou M. Alexander D.L. Jefcoate C.R. J. Biol. Chem. 1994; 269: 14905-14911Abstract Full Text PDF PubMed Google Scholar, 4Shen Z. Well R.L. Liu J. Elkind M.M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11483-11487Crossref PubMed Scopus (24) Google Scholar) and rat (5Bhattacharyya K.K. Brake P.B. Eltom S.E. Otto S.A. Jefcoate C.R. J. Biol. Chem. 1995; 270: 11595-11602Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar,6Walker N.J. Gastel J.A. Costa L.T. Clark G.C. Lucier G.W. Sutter T.R. Carcinogenesis. 1995; 16: 1319-1327Crossref PubMed Scopus (109) Google Scholar). A human genomic clone for CYP1B1 recently has been isolated and characterized by our laboratory (7Tang Y.M. Wo Y.-Y.P. Stewart J. Hawkins A.L. Griffin C.A. Sutter T.R. Greenlee W.F. J. Biol. Chem. 1996; 271: 28324-28330Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). Comparison of the genes for CYP1B1 with the other two members of the CYP1 family, CYP1A1 and CYP1A2, reveal several features that distinguish the CYP1B1 gene: (i) presence of only three exons versus seven (8Gonzalez F.J. Pharmacol. Rev. 1989; 40: 243-288Google Scholar), (ii) location on human chromosome 2 versus 15 (9Hildebrand C.E. Gonzalez F.J. McBride O.W. Nebert D.W. Nucleic Acids Res. 1985; 13: 2009-2016Crossref PubMed Scopus (62) Google Scholar, 10Jaiswal A.K. Nebert D.W. McBride O.W. Gonzalez F.J. J. Exp. Pathol. 1987; 3: 1-7PubMed Google Scholar), and (iii) absence of a canonical TATA box, CCAAT motif, and basal transcription element (11Imataka H. Sogawa K. Yasumoto K. Sasano K. Kobayashi A. Hayami M. Fujii-Kuriyama Y. EMBO J. 1992; 11: 3663-3671Crossref PubMed Scopus (309) Google Scholar, 12Sagami I. Kikuchi H. Ikawa S. Watanabe M. J. Biochem. (Tokyo). 1994; 116: 801-810Crossref Scopus (11) Google Scholar, 13Yanagida A. Sogawa K. Yasumoto K.-I. Fujii-Kuriyama Y. Mol. Cell Biol. 1990; 10: 1470-1475Crossref PubMed Scopus (96) Google Scholar). CYP1B1 mRNA is expressed constitutively in several organs, including the adrenal glands, ovaries, prostate, and testes, and is inducible by planar aromatic hydrocarbons, adrenocorticotrophin, and other peptide hormones (2Sutter T.R. Tang Y.M. Hayes C.L. Wo Y.-Y.P. Jabs E.W. Li X. Yin H. Cody C.W. Greenlee W.F. J. Biol. Chem. 1994; 269: 13092-13099Abstract Full Text PDF PubMed Google Scholar, 14Otto S. Marcus C. Pidgeon C. Jefcoate C. Endocrinology. 1991; 129: 970-982Crossref PubMed Scopus (110) Google Scholar, 15Shimada T. Hayes C.L. Yamazaki H. Amin S. Hecht S.S. Guengerich F.P. Sutter T.R. Cancer Res. 1996; 56: 2979-2984PubMed Google Scholar). In contrast, CYP1A1 is not expressed constitutively; however, induced CYP1A1 mRNA and protein can be detected in human liver (16McKinnon R.A. Hall P.D. Quattrochi L.C. Tukey R.H. McManus M.E. Hepatology. 1991; 14: 848-856Crossref PubMed Scopus (92) Google Scholar). The differential expression of constitutive CYP1A1 and CYP1B1 presumably is modulated by cis-acting regulatory elements located within or near to their respective promoters. In this regard, the CYP1A1 andCYP1A2 promoters have been shown to be silent when uncoupled from upstream enhancer elements (17Jones K.W. Whitlock Jr., J.P. Mol. Cell Biol. 1990; 10: 5098-5105Crossref PubMed Scopus (52) Google Scholar, 18Quattrochi L.C. Tukey R.H. Mol. Pharmacol. 1989; 36: 66-71PubMed Google Scholar). Here, we present the mapping and characterization of functional modalities within the CYP1B1 promoter region. TheCYP1B1 promoter consists of at least four distinct regulatory elements. All are required for maximum promoter activity and are functional, when uncoupled from upstream enhancers. An 8-bp sequence surrounding the transcription start site was found to bind to sequence-specific DNA-binding proteins present in SCC12(c12c2) nuclear extracts and to function as a positioning element, assuring the fidelity of transcription from the single initiation site (TIS), identified previously (7Tang Y.M. Wo Y.-Y.P. Stewart J. Hawkins A.L. Griffin C.A. Sutter T.R. Greenlee W.F. J. Biol. Chem. 1996; 271: 28324-28330Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). Heterologous chloramphenicol acetyltransferase (CAT) reporter gene constructs containing progressive deletions of the CYP1B1 gene 5′-flanking region were made as described previously (7Tang Y.M. Wo Y.-Y.P. Stewart J. Hawkins A.L. Griffin C.A. Sutter T.R. Greenlee W.F. J. Biol. Chem. 1996; 271: 28324-28330Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). 5′-End deletions of the −164/+25 fragment in the pCATbasic(−164/+25) vector were made as follows: three oligonucleotides (20-mers), each containing a 5′-end HindIII site, and a vector-specific primer (spanning sequence from nt 2803 to nt 2783 in pCAT-Basic) were used for polymerase chain reaction (PCR) to amplify the fragments containing theCYP1B1 sequence −101 to +25, −83 to +25, or −47 to +25, plus 540 base pairs of CAT gene sequence. These PCR products were digested with HindIII and BalI, and cloned into the HindIII/BalI-digested pCAT-Basic vector to generate the constructs pCATbasic(−101/+25), pCATbasic(−83/+25), and pCATbasic(−47/+25). Constructs containing part of exon 1 (pCATbasic(−164/+184)) and the entire exon 1 and intron 1 (pCATbasic(−164/+761)) of the CYP1B1 gene were made using the same approach. Mutations in theCYP1B1 promoter were created by oligonucleotide-directed PCR mutagenesis as described previously (19Saiki R.K. Gelfand D.H. Stoffel S. Scharf S.J. Higuchi R. Horn G.T. Mullis K.B. Erlich H.A. Science. 1988; 239: 487-491Crossref PubMed Scopus (13496) Google Scholar). By using four primers (two vector-specific primers and two complementary mutagenic primers) and two-step PCR, three CYP1B1 promoter regulatory elements in the construct pCATbasic(−164/+25) were individually mutated to specific restriction sites. Two antisense GC boxes (i.e.GGGCGG, start from nt −84 and nt −68), which presumably could bind to the transcription factor Sp1, were altered to SalI sites. In contrast, the TATA-like sequence (i.e. TTAAAA, from nt −33 to nt −28) and the sequence surrounding the transcription start site (i.e. −3 TTGACTCT +5) were mutated to PstI andXbaI sites, respectively. Double mutations on both Sp1 recognition motifs were constructed exactly as described above, except that the template used in the PCR was derived from a mutant promoter that already contained a single Sp1 site mutation. All of the CAT reporter constructs were sequenced (20Sanger F. Nicklen S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Crossref PubMed Scopus (52674) Google Scholar) and subjected to restriction analysis to confirm that the desired mutation was present and that no other alterations had occurred. The procedures for transient transfection of SCC12(c12c2) cells and assay of CAT gene activity were as described previously (8Gonzalez F.J. Pharmacol. Rev. 1989; 40: 243-288Google Scholar). The analysis of each construct was done on at least three sample dishes and was repeated at least twice. Nuclear extracts for gel shift assay were prepared from SCC12(c12c2) cells according to the method described (21Dignam J.D. Martin P.L. Shastry B.S. Roeder R.G. Nucleic Acids Res. 1983; 11: 582-589Crossref Scopus (9160) Google Scholar), dialyzed against buffer D (20 mm Hepes (pH 7.8), 100 mm KCl, 0.2 mm EDTA, 0.5 mm DTT, 0.5 mmphenylmethylsulfonyl fluoride (PMSF), and 20% glycerol), and stored in small aliquots at −80 °C. Protein concentration was determined as described (22Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (216440) Google Scholar), using bovine serum albumin as a standard. Two DNA probes were used for gel shift analysis. One was a PCR-amplified DNA fragment (spanning the sequence from −101 to −43) in which two consensus Sp1 binding motifs were encompassed. The PCR product, which was incorporated with HindIII andXbaI sites at its 5′-ends, was digested withHindIII and XbaI, filled in with [α-32P]dATP, and purified by polyacrylamide gel electrophoresis. For mobility shift assay, 5 μg of nuclear protein (or 20 ng of purified Sp1 protein (Promega)) was preincubated at room temperature in a reaction solution (15 μl) containing 10 mm Hepes-NaOH (pH 7.9), 0.1 mm EDTA, 50 mm KCl, 0.25 mm DTT, 0.25 mm PMSF, 1 mm MgCl2, 10% glycerol, and 1 μg of poly(dI·dC)·poly(dI·dC) (Pharmacia Biotech Inc.). The probe (10,000 cpm) was then added, and the incubation was continued for another 15 min. The samples were analyzed at 4 °C on a 5% nondenaturing polyacrylamide gel (30:1 acrylamide:bisacrylamide), containing 6.7 mm Tris-HCl (pH 7.9), 3.3 mmsodium acetate, and 1 mm EDTA. The other probe was made to examine the sequence surrounding the TIS of the CYP1B1. A pair of synthetic complementary oligonucleotides (5′-GCGCGCTTTGACTCTGGAGT-3′ and 5′-GACTCCAGAGTCAAAGCGCG-3′), which correspond to the sequence from −10 to +11 relative to the transcription start site, were prepared and annealed as described (23Briggs M.R. Kadonaga J.T. Bell S.P. Tjian R. Science. 1986; 234: 47-52Crossref PubMed Scopus (1058) Google Scholar). The annealed double-stranded oligonucleotide was labeled with [α-32P]dCTP and Klenow fragment (Life Technologies, Inc.) and subsequently purified by PAGE. The experimental procedure for the gel shift assay was similar to that described above, except using 10 μg of nuclear protein, 2 μg of poly(dI·dC)·poly(dI·dC), 20,000 cpm of probe, and a modified buffer containing 10 mm Hepes-NaOH (pH 7.9), 60 mm KCl, 1 mm EDTA, 1 mm DTT, 10% glycerol, and 1 mm PMSF. Competition studies were performed, to analyze the binding specificity, by using 100–400-fold molar excess of the unlabeled initiator sequences from TdT, the adenovirus major late promoter (AdML), or the mutated CYP1B1 Inr shown below (Sequences 1–3). The competitor was added immediately before the addition of radiolabeled probe. mCYP1B1Inr:5′­GCGCGCTTTTCTAGAGGAGTGGGA­3′ CGCGCGAAAAGATCTCCTCACCCT TdT Inr:5′­GCCCTCATTCTGGAGA­3′ GGGAGTAAGACCTCTG AdML Inr:5′­GTCCTCACTCTCTTCCG­3′ AGGAGTGAGAGAAGGCG SEQUENCES1–3 In vitrotranscription reactions were conducted on 550-bpPvuII/PvuII fragments obtained from the heterologous CAT reporter construct pCATbasic(−164/+25) and constructs containing mutations at either or both Sp1 sites, the TATA-like sequence, and the Inr (see above), using a HeLa cell nuclear extractin vitro transcription system (Promega). Briefly, a reaction mixture (23.5 μl total) containing 100 ng of DNA fragment, 8 units of HeLa nuclear extract, 40 units of RNasin (Promega), 6 mmMgCl2, 3 mm Hepes (pH 7.9), 44 mmKCl, 0.1 mm EDTA, and 0.2 mm DTT was preincubated for 15 min at room temperature. After this period, an aliquot of 1.5 μl of ribonucleotide mix (10 mm each of rNTP) was added, and the reaction mixture was further incubated at room temperature for another 15 min. The reaction was terminated by adding 175 μl of the stop mix (containing 0.3 m Tris-HCl (pH 7.4), 0.3 m sodium acetate, 0.5% SDS, 2 mmEDTA, and 3 μg/ml tRNA). After the extraction with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), the synthesized RNA was precipitated with 95% ethanol, centrifuged, and dried. The RNA transcribed in vitro was subsequently analyzed by primer extension reaction. The primer used for the reaction was a 34-mer oligonucleotide (5′-CTCCTGAAAATCTCGCCAAGCTCAGATCCTCTAG-3′), which is complementary to the 5′-end of the CAT reporter gene. Primer extension was started by dissolving the RNA in a 10-μl buffer solution containing 10 mm Tris-HCl (pH 7.5), 0.5 m NaCl, 5 mm EDTA, and 1 × 105 cpm of32P-end-labeled primer. After heating at 85 °C for 5 min, the solution was incubated at 60 °C for 1 h. The extension reaction was then initiated by adding a 40-μl solution containing 12.5 mm Tris-HCl (pH 8.3), 20 mmMgCl2, 12.5 mm DTT, 20 units of RNasin, 1.25 mm each of dNTP, and 10 units of avian myeloblastosis virus reverse transcriptase (Promega). After incubation for 1 h at 42 °C, the reaction was stopped by adding 50 μl of a solution containing 1% SDS and 20 mm NaCl. The reaction product was precipitated with 250 μl of ethanol and loaded onto an 8% polyacrylamide-urea gel, and the results were analyzed by a phosphorimage analyzer (Fuji BAS 1000). A series of reporter plasmids containing the various CYP1B1 5′-flanking fragments (from nt −2300 to nt −164) in the sense orientation upstream to the CAT gene were transfected into SCC12(c12c2) cells (see “Experimental Procedures”). The level of CAT activity for each construct was normalized with respect to a co-transfected β-galactosidase plasmid and then compared with the negative control (promoterless plasmid). The construct containing the longest 5′-flanking sequence (−2300/+25) exhibited 43-fold greater CAT activity than the promoterless control (Fig. 1). Removal of the region between −2300 and −1356 resulted in a 45% reduction of CAT activity. When the deletion was extended to nt −1022, a 2.5-fold increase in the activity was observed as compared with the construct with its 5′-end at nt −1356 (Fig. 1). This construct (−1022/+25) showed the highest transcriptional activity (greater than 60-fold relative to the promoterless plasmid) of all the constructs tested. A further removal in sequence to nt −835 dramatically decreased the CAT activity by 90%. The promoter activity gradually increased with progressive 5′-deletions from nt −835, with the shortest promoter sequence (−164/+25) possessing 33-fold greater activity than the promoterless control (Fig. 1). The results of this initial 5′-deletion analysis indicate that the fully active CYP1B1 promoter is contained within the −164/+25 fragment. The pattern of CAT activity for the various deletion constructs suggest that potential enhancer elements are located between nt −2300 and nt −1356 and between nt −1022 and −835. Potential negative regulatory elements are located between nt −1356 and −1022 and between nt −835 and −164 (Fig. 1). Based on sequence analysis, the −164/+25 fragment contains a TATA-like box (TTAAAA) from nt −33 to −28, two Sp1 sites (GGGCGG) starting at nt −84 and −68 on the antisense strand, and a potential initiator element (TTGACTCT) from nt −3 to +5. No known enhancer elements are located in the −164/+25 fragment. To determine if these putative regulatory elements in the CYP1B1 promoter are functional, a series of 5′-deletion constructs within the −164/+25 fragment were made (Fig. 2). A deletion of 53 base pairs, from the 5′-end to nt −101, only slightly altered the promoter activity, indicating that the region from −164 to −101 does not contain any critical cis-acting element(s) that contribute(s) to promoter activity. Deletions that removed one or both Sp1 binding motifs reduced CAT activity by 80–95%, respectively, from that observed with the −101/+25 construct (Fig. 2). The smallest 5′-flanking construct examined (−47/+25), which contained both the TATA-like box (TTAAAA) and putative Inr (TTGACTCT), exhibited 2–4-fold greater CAT activity than the promoterless control (Fig. 2) and is defined operationally as the basal promoter for CYP1B1. Full promoter activity requires both Sp1 motifs located within the −101/+25 fragment. The CAT activity measured for constructs containing sequences 3′-ward from the TIS of the CYP1B1 gene was reduced relative to the −164/+25 and −101/+25 constructs (Fig. 2). However, the longest 3-ward construct examined (−164/+761) containing the first exon and intron of the CYP1B1 gene displayed 8-fold greater CAT activity than the basal promoter (−47/+25). Mutations at the distal (nt −89 to −84) or proximal (nt −73 to nt −68) Sp1 binding motifs resulted in a 65% or 71% decrease, respectively, in CAT activity, as compared with the nonmutated (−164/+25) construct (Fig.3). Mutations at both Sp1 sites reduced CAT activity to 20% of the fully active promoter. Mutating the TATA-like motif (TTAAAA) to TGCAGA or the putative initiator element from TTGACTCT to TTTCTAGA suppressed promoter activity by 85% or 55%, respectively (Fig. 3). Taken together, these results indicate that all of the four regulatory elements identified by sequence analysis and deletion mapping (Fig. 2) are required for full CYP1B1promoter activity. Based on the mutational analysis supporting the involvement of both Sp1 sites for full promoter activity (Fig. 3), a radiolabeled −101/−47 probe containing both Sp1 sites was prepared (see “Experimental Procedures”) and incubated with nuclear extracts from SCC12(c12c2) cells. Two major complexes (shown by arrows) are observed, which co-migrate with complexes formed when the same probe is incubated with purified recombinant Sp1 protein (Fig. 4). The addition of a 100-fold molar excess of unlabeled −101/−41 fragment competed with the labeled probe (Fig. 4, lane 6), whereas little or no competition was observed with a nonspecific probe (Fig. 4,lane 7) or a probe containing double mutations in both Sp1 sites (Fig. 4, lane 8). The same pattern of competition was observed with the purified Sp1 protein (data not shown). These results support the findings from site-directed mutagenesis (Fig. 3) and indicate the involvement of Sp1 in regulating the activity of theCYP1B1 promoter. We have demonstrated previously that the transcription of the human CYP1B1 gene begins at a single site (7Tang Y.M. Wo Y.-Y.P. Stewart J. Hawkins A.L. Griffin C.A. Sutter T.R. Greenlee W.F. J. Biol. Chem. 1996; 271: 28324-28330Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). Based on sequence analysis, theCYP1B1 promoter does not contain a consensus TATA box, but does possess a potential Inr element from nt −3 to +5. When the Inr sequence in the CYP1B1 promoter is aligned with other reported Inr elements, considerable sequence homology is observed (Fig.5): identical matches with 9 of 12 nucleotides in the Inr found in the TATA-less promoter of TdT between nt −3 to +9 and with 5 of 8 nucleotides in the −3 to +5 sequence of the AdML. To determine if the Inr in the CYP1B1 promoter is responsible for maintaining accuracy of transcription from a single site, we transcribed in vitro a −164/+25 fragment containing the four CYP1B1 promoter regulatory elements (Fig. 3), as well as promoter fragments with mutations in each element. The transcribed RNA was then analyzed by primer extension with a labeled downstream primer (Fig. 6). A closely spaced doublet signal was observed with the nonmutated −164/+25 fragment. This most likely represents a single band, with the doublet signal resulting from capping of the transcribed RNA. This same doublet signal was observed with the fragments containing mutations in one or both Sp1 sites, or in the TATA-like box. In contrast, multiple bands were observed when the Inr sequence was mutated (Fig. 6). These results strongly support the position that the start site of transcription in the CYP1B1 promoter is determined by the −3 to +5 Inr sequence (TTGACTCT). Gel shift analysis was carried out to determine if proteins present in nuclear extracts from SCC12(c12c2) cells could bind specifically to the Inr in the CYP1B1 promoter. One major complex is observed when a radiolabeled probe containing the CYP1B1 Inr is incubated with nuclear extract proteins (Fig.7). Competition by a probe for the highly homologous murine TdT Inr competes with the CYP1B1 Inr for binding with nuclear extracts. Competition by a AdML Inr probe also is observed, but requires a higher concentration (400-fold) of unlabeled probe. Using a radiolabeled TdT Inr probe, a major DNA-protein complex was observed with SCC12(c12c2) nuclear extracts (Fig. 7). Specific competition occurred with either unlabeled TdT Inr or CYP1B1Inr probes, but not with the AdML Inr or a mutated CYP1B1probe. These results suggest that the Inr regions for both TdT andCYP1B1 can recognize DNA-binding proteins in SCC12(c12c2) cells. The CYP1B1 Inr appears to be less specific than the TdT Inr, as indicated by the differential competition with unlabeled AdML Inr. Stepwise deletion of the 5′-flanking region of theCYP1B1 gene indicated that the regions between nt −2300 and nt −1356 and between nt −1022 and nt −835 may contain transcriptional enhancer elements (Fig. 1). The −1022/−835 region has been shown previously to contain three dioxin-responsive core binding motifs that contribute to the TCDD-inducible expression of CYP1B1 (7Tang Y.M. Wo Y.-Y.P. Stewart J. Hawkins A.L. Griffin C.A. Sutter T.R. Greenlee W.F. J. Biol. Chem. 1996; 271: 28324-28330Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). Although cells were not treated with TCDD in this study, it is possible that the dioxin-responsive enhancers or other cis elements were responsive to components in the serum or medium, or to constitutively expressed cell proteins. In this regard, two repeats of the motif GGGTGG are located within the −1022/−835 region, with a third at −1061. Although this motif contains a T in place of the C in the consensus Sp1 binding site (GGGCGG; Ref. 23Briggs M.R. Kadonaga J.T. Bell S.P. Tjian R. Science. 1986; 234: 47-52Crossref PubMed Scopus (1058) Google Scholar), it has been demonstrated to bind the transcription factor Sp1 and activate a high level of transcription (24Kudo S. Fukuda M. Eur. J. Biochem. 1994; 223: 319-327Crossref PubMed Scopus (27) Google Scholar). Sp1-dependent enhancer activity has been demonstrated for the human adenosine deaminase gene (25Dusing M.R. Wiginton D.A. Nucleic Acids Res. 1994; 22: 669-677Crossref PubMed Scopus (56) Google Scholar), the ratα2MR/LRP gene (26Gaâta B.A. Borthwick I. Stanley K.K. Biochim. Biophys. Acta. 1994; 1219: 307-313Crossref Scopus (22) Google Scholar) and ornithine decarboxylase (27Kumar A.P. Mar P.K. Zhao B. Montgomery R.L. Kang D.-C. Butler A.P. J. Biol. Chem. 1995; 270: 4341-4348Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar) genes, and the SV40 enhancer (28Dynan W.S. Tjian R. Cell. 1983; 35: 79-87Abstract Full Text PDF PubMed Scopus (911) Google Scholar). Sp1 also can act synergistically with either the androgen (29Faber P.W. van Rooij H.C.J. Schipper H.J. Brinkmann A.O. Trapman J. J. Biol. Chem. 1993; 268: 9296-9301Abstract Full Text PDF PubMed Google Scholar), glucocorticoid (30Schåle R. Muller M. Kaltschmidt C. Renkawitz R. Science. 1988; 242: 1418-1420Crossref Scopus (387) Google Scholar), or epidermal growth factor (31Merchant J.L. Shiotani A. Mortensen E.R. Shumaker D.K. Abraczinskas D.R. J. Biol. Chem. 1995; 270: 6314-6319Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar) receptor to enhance gene expression. Deletion mapping (Fig. 2) and site-directed mutagenesis (Fig. 3) have identified four regulatory elements that are required for maximum activity of the CYP1B1 promoter: two Sp1 binding motifs, a TATA-like sequence, and an Inr overlapping the TIS. Sp1 sites as far removed as 87 bp upstream from the TIS have been shown to be functional and to act in a bidirectional manner (32Smale S.T. Baltimore D. Cell. 1989; 57: 103-113Abstract Full Text PDF PubMed Scopus (1149) Google Scholar). In this regard, both of the active Sp1 sites in the CYP1B1 promoter were located on the antisense strand at nt −68 and −84, respectively. These sites functioned in an additive manner to activate transcription. The human CYP1B1 promoter does not contain a consensus TATA box (TATAAA) but, instead, a closely related TATA-like sequence (TTAAAA) at nt −34 (Fig. 3). The transcription factor TFIID binds to sites in the nt −30 region of several promoters lacking consensus TATA boxes (33Atchison M.L. Meyuhas O. Perry R.P. Mol. Cell Biol. 1989; 9: 2067-2074Crossref PubMed Scopus (63) Google Scholar, 34Ayer D.A. Dynan W.S. Mol. Cell Biol. 1988; 8: 2021-2033Crossref PubMed Scopus (47) Google Scholar, 35Chen M.-J. Shimada T. Moulton A.D. Cline A. Humphries R.K. Maizel J. Nienhuis A.W. J. Biol. Chem. 1984; 259: 3933-3943Abstract Full Text PDF PubMed Google Scholar, 36Miyamoto M. Fujita T. Kimura Y. Maruyama M. Harada H. Sudo Y. Miyata T. Taniguchi T. Cell. 1988; 54: 903-913Abstract Full Text PDF PubMed Scopus (795) Google Scholar) including the AT-rich elements (37Hahn S. Buratowski S. Sharp P.A. Guarente L. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 5718-5722Crossref PubMed Scopus (218) Google Scholar) such as the ATAAAA sequence found in the bovine elastin gene (38Manohar A. Anwar R.A. Biochim. Biophys. Acta. 1994; 1219: 233-236Crossref Scopus (4) Google Scholar). For this group of TATA-less promoters, the level of transcriptional activity correlates with differences in the affinity of TFIID for binding to the nt −30 region (39Wiley S.R. Kraus R.J. Mertz J.E. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5814-5818Crossref PubMed Scopus (121) Google Scholar). By extension, it would be predicted that the TATA-like element of the CYP1B1 promoter, which is highly similar to the consensus TATA box sequence, would have a high affinity for TFIID and thus high promoter activity. This position is supported by the results shown in Fig. 3. Mutation of the TATA-like element to TGCAGA decreased promoter activity by 75%. The contribution of the Inr that overlaps the TIS to CYP1B1promoter activity is less than either Sp1 sites or the TATA-like box (Fig. 3). However, the in vitro transcription analysis carried out here (Fig. 6) strongly supports the position that the Inr is essential for maintaining fidelity of CYP1B1 transcription from a single site, as demonstrated previously (7Tang Y.M. Wo Y.-Y.P. Stewart J. Hawkins A.L. Griffin C.A. Sutter T.R. Greenlee W.F. J. Biol. Chem. 1996; 271: 28324-28330Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). Either a consensus TATA box or an initiator sequence is sufficient to direct the Sp1-dependent activated transcription from a single site (40O'Shea-Greenfield A. Smale S.T. J. Biol. Chem. 1992; 267: 1391-1402Abstract Full Text PDF PubMed Google Scholar, 41Smale S.T. Schmidt M.C. Berk A.J. Baltimore D. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 4509-4513Crossref PubMed Scopus (353) Google Scholar). When a promoter contains both core elements, the TATA and Inr can act cooperatively to enhance the transcription levels and to assure the specificity of the start site. In the absence of a functional Inr, mutations in the TATA sequence can result in the initiation from multiple sites (42Grosveld G.C. Shewmaker C.K. Jat P. Flavell R.A. Cell. 1981; 25: 215-226Abstract Full Text PDF PubMed Scopus (83) Google Scholar, 43Grosschedl R. Birnstiel M.L. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 1432-1436Crossref PubMed Scopus (248) Google Scholar). Other studies on TATA-less promoters have suggested the involvement of Sp1 motifs in transcription start site selection (27Kumar A.P. Mar P.K. Zhao B. Montgomery R.L. Kang D.-C. Butler A.P. J. Biol. Chem. 1995; 270: 4341-4348Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar, 44Kollmar R. Sukow K.A. Sponagle S.K. Farnham P.J. J. Biol. Chem. 1994; 269: 2252-2257Abstract Full Text PDF PubMed Google Scholar, 45Lu J. Lee W. Jiang C. Keller E.B. J. Biol. Chem. 1994; 269: 5391-5402Abstract Full Text PDF PubMed Google Scholar). Our data indicate that for theCYP1B1 promoter the Inr alone determines that transcription initiates from a single site, even in the absence of the upstream TATA counterpart (Fig. 6). Similar results have been reported for three mouse ribosomal protein promoters (46Hariharan N. Perry R.P. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 1526-1530Crossref PubMed Scopus (121) Google Scholar) and for the Inr-containing adenovirus IVa2 and major late promoters (47Hu S.L. Manley J.L. Proc. Natl. Acad. Sci., U. S. A. 1981; 78: 820-824Crossref PubMed Scopus (94) Google Scholar, 48Carcamo J. Maldonado E. Cortes P. Ahn M. Ha I. Kasai Y. Flint J. Reinberg D. Genes Dev. 1990; 4: 1611-1622Crossref PubMed Scopus (43) Google Scholar). Mutation of the consensus TATA box in AdML and the TATA analog in Iva2 significantly decreased the transcriptional activity, but the position of the transcriptional start site was maintained. A strict sequence conservation is missing in many of the known Inr elements. However, we found the CYP1B1 Inr is highly homologous to the TdT Inr (match of 9 of 12 nucleotides) and closely related to the AdML Inr beginning at nt −3 (Fig. 5). Consistent with this observation based on nucleotide sequence, we found that DNA-binding proteins present in SCC12(c12c2) nuclear extracts can bind specifically to oligonucleotide probes for either the CYP1B1or TdT Inr element (Fig. 7). Further, nuclear extract protein binding to the CYP1B1 Inr probe was competed by either the TdT or AdML Inr probes. Thus, it is likely that the same or closely related nuclear proteins interact with the CYP1B1, TdT, and AdML Inr elements. We thank George Tang (National Center for Toxicological Research) and Stefan Kress (University of Tübingen) for many helpful discussions and John Williams (University of Massachusetts Medical Center) for assistance in the preparation of this manuscript." @default.
• W2024558892 created "2016-06-24" @default.
• W2024558892 creator A5018679833 @default.
• W2024558892 creator A5044653473 @default.
• W2024558892 creator A5081157819 @default.
• W2024558892 date "1997-10-01" @default.
• W2024558892 modified "2023-10-16" @default.
• W2024558892 title "Functional Analysis of the Promoter for the HumanCYP1B1 Gene" @default.
• W2024558892 cites W1503135238 @default.
• W2024558892 cites W1503386326 @default.
• W2024558892 cites W1503457692 @default.
• W2024558892 cites W1577890972 @default.
• W2024558892 cites W1581478432 @default.
• W2024558892 cites W1667331074 @default.
• W2024558892 cites W1871602158 @default.
• W2024558892 cites W1918014554 @default.
• W2024558892 cites W1966892995 @default.
• W2024558892 cites W1973381207 @default.
• W2024558892 cites W1977660995 @default.
• W2024558892 cites W1982666619 @default.
• W2024558892 cites W1993243592 @default.
• W2024558892 cites W1993713336 @default.
• W2024558892 cites W1994291007 @default.
• W2024558892 cites W1997571502 @default.
• W2024558892 cites W1998108444 @default.
• W2024558892 cites W1998912417 @default.
• W2024558892 cites W1999156595 @default.
• W2024558892 cites W1999882436 @default.
• W2024558892 cites W2000878085 @default.
• W2024558892 cites W2003027222 @default.
• W2024558892 cites W2018384828 @default.
• W2024558892 cites W2025723633 @default.
• W2024558892 cites W2030486516 @default.
• W2024558892 cites W2032118018 @default.
• W2024558892 cites W2041639550 @default.
• W2024558892 cites W2042770481 @default.
• W2024558892 cites W2046408733 @default.
• W2024558892 cites W2074351361 @default.
• W2024558892 cites W2082684341 @default.
• W2024558892 cites W2086941764 @default.
• W2024558892 cites W2091291725 @default.
• W2024558892 cites W2092789969 @default.
• W2024558892 cites W2114758061 @default.
• W2024558892 cites W2132693026 @default.
• W2024558892 cites W2138270253 @default.
• W2024558892 cites W2149935989 @default.
• W2024558892 cites W2150946709 @default.
• W2024558892 cites W2158472800 @default.
• W2024558892 cites W2159980909 @default.
• W2024558892 cites W2163853656 @default.
• W2024558892 cites W4293247451 @default.
• W2024558892 doi "https://doi.org/10.1074/jbc.272.42.26702" @default.
• W2024558892 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9334254" @default.
• W2024558892 hasPublicationYear "1997" @default.
• W2024558892 type Work @default.
• W2024558892 sameAs 2024558892 @default.
• W2024558892 citedByCount "55" @default.
• W2024558892 countsByYear W20245588922012 @default.
• W2024558892 countsByYear W20245588922017 @default.
• W2024558892 countsByYear W20245588922019 @default.
• W2024558892 countsByYear W20245588922020 @default.
• W2024558892 countsByYear W20245588922022 @default.
• W2024558892 crossrefType "journal-article" @default.
• W2024558892 hasAuthorship W2024558892A5018679833 @default.
• W2024558892 hasAuthorship W2024558892A5044653473 @default.
• W2024558892 hasAuthorship W2024558892A5081157819 @default.
• W2024558892 hasBestOaLocation W20245588921 @default.
• W2024558892 hasConcept C104317684 @default.
• W2024558892 hasConcept C54355233 @default.
• W2024558892 hasConcept C55112680 @default.
• W2024558892 hasConcept C70721500 @default.
• W2024558892 hasConcept C86803240 @default.
• W2024558892 hasConceptScore W2024558892C104317684 @default.
• W2024558892 hasConceptScore W2024558892C54355233 @default.
• W2024558892 hasConceptScore W2024558892C55112680 @default.
• W2024558892 hasConceptScore W2024558892C70721500 @default.
• W2024558892 hasConceptScore W2024558892C86803240 @default.
• W2024558892 hasIssue "42" @default.
• W2024558892 hasLocation W20245588921 @default.
• W2024558892 hasOpenAccess W2024558892 @default.
• W2024558892 hasPrimaryLocation W20245588921 @default.
• W2024558892 hasRelatedWork W1641042124 @default.
• W2024558892 hasRelatedWork W1990804418 @default.
• W2024558892 hasRelatedWork W1993764875 @default.
• W2024558892 hasRelatedWork W2013243191 @default.
• W2024558892 hasRelatedWork W2034625591 @default.
• W2024558892 hasRelatedWork W2051339581 @default.
• W2024558892 hasRelatedWork W2082860237 @default.
• W2024558892 hasRelatedWork W2117258802 @default.
• W2024558892 hasRelatedWork W2130076355 @default.
• W2024558892 hasRelatedWork W2151865869 @default.
• W2024558892 hasVolume "272" @default.
• W2024558892 isParatext "false" @default.
• W2024558892 isRetracted "false" @default.
• W2024558892 magId "2024558892" @default.
• W2024558892 workType "article" @default.