FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2024583791> ?p ?o ?g. }

• W2024583791 endingPage "37167" @default.
• W2024583791 startingPage "37158" @default.
• W2024583791 abstract "Human endostatin, a potent anti-angiogenic protein, is generated by release of the C terminus of collagen XVIII. Here, we propose that cysteine cathepsins are involved in both the liberation and activation of bioactive endostatin fragments, thus regulating their anti-angiogenic properties. Cathepsins B, S, and L efficiently cleaved in vitro FRET peptides that encompass the hinge region corresponding to the N terminus of endostatin. However, in human umbilical vein endothelial cell-based assays, silencing of cathepsins S and L, but not cathepsin B, impaired the generation of the ∼22-kDa endostatin species. Moreover, cathepsins L and S released two peptides from endostatin with increased angiostatic properties and both encompassing the NGR sequence, a vasculature homing motif. The G10T peptide (residues 1455–1464: collagen XVIII numbering) displayed compelling anti-proliferative (EC50 = 0.23 nm) and proapoptotic properties. G10T inhibited aminopeptidase N (APN/CD13) and reduced tube formation of endothelial cells in a manner similar to bestatin. Combination of G10T with bestatin resulted in no further increase in anti-angiogenic activity. Taken together, these data suggest that endostatin-derived peptides may represent novel molecular links between cathepsins and APN/CD13 in the regulation of angiogenesis. Human endostatin, a potent anti-angiogenic protein, is generated by release of the C terminus of collagen XVIII. Here, we propose that cysteine cathepsins are involved in both the liberation and activation of bioactive endostatin fragments, thus regulating their anti-angiogenic properties. Cathepsins B, S, and L efficiently cleaved in vitro FRET peptides that encompass the hinge region corresponding to the N terminus of endostatin. However, in human umbilical vein endothelial cell-based assays, silencing of cathepsins S and L, but not cathepsin B, impaired the generation of the ∼22-kDa endostatin species. Moreover, cathepsins L and S released two peptides from endostatin with increased angiostatic properties and both encompassing the NGR sequence, a vasculature homing motif. The G10T peptide (residues 1455–1464: collagen XVIII numbering) displayed compelling anti-proliferative (EC50 = 0.23 nm) and proapoptotic properties. G10T inhibited aminopeptidase N (APN/CD13) and reduced tube formation of endothelial cells in a manner similar to bestatin. Combination of G10T with bestatin resulted in no further increase in anti-angiogenic activity. Taken together, these data suggest that endostatin-derived peptides may represent novel molecular links between cathepsins and APN/CD13 in the regulation of angiogenesis. IntroductionEndostatin, first discovered by Folkman and collaborators (1O'Reilly M.S. Boehm T. Shing Y. Fukai N. Vasios G. Lane W.S. Flynn E. Birkhead J.R. Olsen B.R. Folkman J. Cell. 1997; 88: 277-285Abstract Full Text Full Text PDF PubMed Scopus (4211) Google Scholar), is a potent therapeutic agent through its ability to inhibit the formation of new blood vessels and reduce tumor growth as a single drug or in combination with chemotherapy and/or radiotherapy (2Marneros A.G. Olsen B.R. Matrix Biol. 2001; 20: 337-345Crossref PubMed Scopus (174) Google Scholar, 3Ling Y. Yang Y. Lu N. You Q.D. Wang S. Gao Y. Chen Y. Guo Q.L. Biochem. Biophys. Res. Commun. 2007; 361: 79-84Crossref PubMed Scopus (228) Google Scholar). Endostatin, which corresponds to the C-terminal domain of collagen XVIII (NC-1 domain), is released by cleavage of a proteolysis-sensitive unstructured hinge region. Endostatin prevents the proliferation, migration, and adhesion of endothelial cells, blocks cell intravasation, and may also induce apoptosis (4Dhanabal M. Volk R. Ramchandran R. Simons M. Sukhatme V.P. Biochem. Biophys. Res. Commun. 1999; 258: 345-352Crossref PubMed Scopus (197) Google Scholar, 5Dixelius J. Cross M. Matsumoto T. Sasaki T. Timpl R. Claesson-Welsh L. Cancer Res. 2002; 62: 1944-1947PubMed Google Scholar, 6Folkman J. Exp. Cell Res. 2006; 312: 594-607Crossref PubMed Scopus (585) Google Scholar). Inhibition of the migration of human umbilical vein endothelial cells (HUVECs) 3The abbreviations used are: HUVEChuman umbilical vein endothelial cellAMC7-amino-4-methyl coumarinAPN/CD13aminopeptidase NCA-074N-(l-3-trans-propylcarbomoyl-oxirane-2-carbonyl)-l-isoleucyl-l-prolineE-64L-trans-epoxysuccinyl-leucylamido-(4-guanidio)butaneFMKfluoromethyl ketoneMMPmatrix metalloproteinaseRPreverse phaseZbenzyloxycarbonyl. occurs in response to VEGF (7Yamaguchi N. Anand-Apte B. Lee M. Sasaki T. Fukai N. Shapiro R. Que I. Lowik C. Timpl R. Olsen B.R. EMBO J. 1999; 18: 4414-4423Crossref PubMed Scopus (424) Google Scholar). The various effects that endostatin elicits on cells is indicative of its multiple modes of action and molecular partners (e.g. integrin αVβ3 and integrin α5β1, glypicans, heparin and heparan sulfates) that form the so-called “endostatin interaction network” (8Faye C. Inforzato A. Bignon M. Hartmann D.J. Muller L. Ballut L. Olsen B.R. Day A.J. Ricard-Blum S. Biochem. J. 2010; 427: 467-475Crossref PubMed Scopus (40) Google Scholar).Alterations in endostatin levels that are frequently observed in pathophysiological processes are of crucial importance. Nevertheless, the molecular mechanisms involved in the production and catabolism of endostatin remains poorly characterized. Although endostatin is generally described as a single protein of ∼20 kDa, several forms of varying lengths have been identified in vivo in both humans and mice (9John H. Preissner K.T. Forssmann W.G. Ständker L. Biochemistry. 1999; 38: 10217-10224Crossref PubMed Scopus (59) Google Scholar). The first protease identified as responsible for the release of murine endostatin (20-kDa form) was cathepsin L (10Felbor U. Dreier L. Bryant R.A. Ploegh H.L. Olsen B.R. Mothes W. EMBO J. 2000; 19: 1187-1194Crossref PubMed Scopus (400) Google Scholar). Matrix metalloproteinases (MMPs) have also been implicated in the release of high molecular mass endostatin forms (24–30 kDa) (11Wen W. Moses M.A. Wiederschain D. Arbiser J.L. Folkman J. Cancer Res. 1999; 59: 6052-6056PubMed Google Scholar). Despite high primary structural identity in collagen XVIII between human and mice, their hinge regions display some critical differences in their amino acid sequences (9John H. Preissner K.T. Forssmann W.G. Ständker L. Biochemistry. 1999; 38: 10217-10224Crossref PubMed Scopus (59) Google Scholar, 12Ständker L. Schrader M. Kanse S.M. Jürgens M. Forssmann W.G. Preissner K.T. FEBS Lett. 1997; 420: 129-133Crossref PubMed Scopus (113) Google Scholar). Consequently, the proteases involved in the release of human endostatin from collagen XVIII have not been clearly identified.The aim of this study was to delineate the role of cysteine cathepsins in the production and/or degradation of human collagen XVIII-derived endostatin and to analyze the consequences in its anti-angiogenic properties on endothelial cells. Our results suggest that cathepsins may finely tune release and breakdown of endostatin and give new molecular insights into its angiogenic mechanisms. These data also advocate that through endostatin-derived peptides, cysteine cathepsins and aminopeptidase N (APN/CD13) may both participate in the multidirectional network of proteolytic interactions that occur during angiogenesis (13Mason S.D. Joyce J.A. Trends Cell Biol. 2011; 21: 228-237Abstract Full Text Full Text PDF PubMed Scopus (390) Google Scholar).EXPERIMENTAL PROCEDURESEnzymes, Inhibitors, and PeptidesHuman cathepsins B, L, H, and S were from Calbiochem (VWR Intl., Libourne, France). Aminopeptidase N was from R&D Systems Europe (Lille, France). Bestatin, l-trans-epoxysuccinyl-leucylamido-(4-guanidio)butane (E-64), N-(l-3-trans-propylcarbomoyl-oxirane-2-carbonyl)-l-isoleucyl-l-proline (CA-074), methylmethanethiosulfonate, pepstatin A, and PMSF were from Sigma-Aldrich (Saint Quentin Fallavier, France). EDTA was from Merck (Darmstadt, Germany). Ac-DEVD-FMK (FMK, fluoromethyl ketone) was from Calbiochem, and bestatin was R&D Systems Europe. DTT was from Bachem (Weil am Rhein, Germany). Z-FR-AMC, Z-GPR-AMC, Z-LR-AMC, H-R-AMC, and Ac-DEVD-AMC were from Calbiochem, whereas H-A-AMC was supplied by Bachem. Cathepsins were titrated by E-64 in their activity buffer (0.1 m sodium acetate, pH 5.5, 2 mm EDTA, 2 mm DTT, and Brij 35 0.01%). FRET peptides (Endo-01 to Endo-10) were prepared as described previously (14Godat E. Lecaille F. Desmazes C. Duchêne S. Weidauer E. Saftig P. Brömme D. Vandier C. Lalmanach G. Biochem. J. 2004; 383: 501-506Crossref PubMed Scopus (33) Google Scholar). G10T (GSDPNGRRLT), Sc-G10T (i.e. scrambled G10T; GNPTDLRSRG), and K15T (KSVWHGSDPNGRRLT) peptides were synthesized by Eurogentec SA (Seraing, Belgium).Kinetics MeasurementThe hydrolysis of Endo-01 to Endo-10 substrates was followed by measuring fluorescence release (Kontron SFM 25 spectrofluorimeter; excitation wavelength, 320 nm; emission wavelength, 420 nm). The system was formerly standardized using Abz-FR-OH prepared by the total tryptic hydrolysis of an Abz-FR-pNA solution, with ϵ410 nm = 8,800 m−1 cm−1 for p-nitroanilide as reported previously (15Serveau C. Lalmanach G. Juliano M.A. Scharfstein J. Juliano L. Gauthier F. Biochem. J. 1996; 313: 951-956Crossref PubMed Scopus (73) Google Scholar). Final enzyme concentrations were 1–5 nm for cathepsins L and S, 5–10 nm for cathepsin B, and 10–100 nm for cathepsin H. Assays (triplicate) were carried out at 37 °C by adding cathepsins to intramolecularly quenched fluorescent peptides (0.5 μm) in their activity buffer. Second-order rate constants (kcat/Km) for the hydrolysis of Endo-01 to Endo-10 were determined under pseudo-first order conditions, i.e. using a substrate concentration far below the Km). Under these conditions, the Michaelis-Menten equation is reduced to: v = kobs·S, where kobs = Vm/Km. Integrating this equation over time gives ln [S] = −kobs·t + ln[S]0, where [S]0 and [S] are the substrate concentrations at time 0 and time t, respectively. Because Vm = kcat·[E]t, where [E]t is the final enzyme concentration, dividing kobs by [E]t yields the kcat/Km ratio. The kobs for the first-order substrate hydrolysis was calculated by fitting experimental data to the first-order equation using the Enzfitter software (Biosoft, Cambridge, UK). Kinetics data (i.e. specificity constants) are reported as means ± S.D. Additionally, enzymes (10 nm) were incubated with peptides (100 μm) for 60 min at 37 °C in the assay buffer before RP-HPLC analysis (Purospher star RP18 column, Merck) using a 20-min linear (0–60%) gradient of acetonitrile in 0.1% TFA (λ = 220 nm). Cleavage sites were identified by mass spectrometry (Valérie Labas, Proteomics Facilities, Institut National de la Recherche Agronomique Tours).Degradation of Human Endostatin by Cysteine CathepsinsRecombinant human endostatin (1 mm, Sigma-Aldrich) was incubated for 4 h at 37 °C in 0.1 m sodium acetate buffer, pH 5.5, 2 mm DTT in the presence of proteases (enzyme/substrate molar ratio, 1:200 to 1:5). Hydrolysis products were separated by RP-HPLC (Purospher star RP8 column, Merck) using a 35-min linear (0–60%) gradient of acetonitrile in 0.1% TFA and analyzed by mass spectrometry. In parallel samples were submitted to a 15% SDS-PAGE then electroblotted. The nitrocellulose membrane was incubated with a rabbit anti-endostatin antibody (Abcam, Cambridge, UK) (dilution of 1:1000) and then with a anti-rabbit IgG-peroxidase conjugate (Sigma-Aldrich) (dilution: 1: 5000) and revealed (ECL kit from Amersham Biosciences, Buckinghamshire, UK). In addition, endostatin was incubated with cathepsins (enzyme/substrate ratio of 1:10) for 0–120 min, and samples were analyzed by 15% SDS-PAGE and stained with Coomassie Blue, and the level of uncleaved residual endostatin was estimated by densitometry (NIH ImageJ software). Control was performed in the presence of E-64 (10 mm).Silencing of Cathepsins B, L, and S by RNA InterferenceHUVECs (PromoCell, Heidelberg, Germany) were grown in endothelial cell growth medium, containing 2% FCS at 37 °C under 5% CO2. Small interfering RNAs for cathepsin L (siCatL), cathepsin S (siCatS), cathepsin B (siCatB), and a negative control siRNA (siCTL) were obtained from Qiagen SA (Courtaboeuf, France) (Table 1). At 80% confluence, cells were transfected with 40 nm siRNA in endothelial basal medium using HiPerFect transfection agent (Qiagen SA). Total RNAs were extracted at different times (24, 48, 72, and 96 h) (RNeasy Mini Kit, Qiagen SA), and reverse transcription was performed on total RNA (1 mg) using RevertAid M-MuLV Reverse Transcriptase (GmbH, Germany). Reduction of cathepsins transcripts was determined by quantitative real-time PCR using the MyiQ system (Bio-Rad) in the presence of SyberGreen Mix (ABgene, Epsom, UK). Sense and antisense primers for cathepsins were reported in Table 1. For quantification of relative expression levels, the ΔΔCt method was used (normalization gene, human ribosomal protein S16 (RPS16)).TABLE 1siRNA sequences and primers used for quantitative PCR experimentsProteinSequences of siRNA (5′–3′)Sequences of PCR primers (5′–3′)Cat S SenseGGAUAUAUUCGGAUGGCAAGCTTCACAACCTGGAGCATTC AntisenseUUGCCAUCCGAAUAUAUCCGGCAATATCCGATTAGGGTTTGACat L SenseGAUCCGAGUGUGAUUUGAAGGAAAACTGGGAGGCTTATCTC AntisenseUUCAAUCACACUCGGAUCAGCATAATCCATTAGGCCACCACat B SenseGCAUGAUUCUUUAAUAGAAAGAGTTATGTTTACCGAGGACCT AntisenseUUCUAUUAAAGAAUCAUGCGCAGATCCGGTCAGAGATGGRPS16 SenseACGTGGCCCAGATTTATGCTAT AntisenseTGGAAGCCTCATCCACATATTTC Open table in a new tab At various post-transfection times, cells were rinsed in PBS, lysed (50 mm Tris-HCl, pH 7.4, 150 mm NaCl, Nonidet P40 1% in the presence of 100 μm E-64, 0.5 mm PMSF, 40 μm pepstatin A, and 0.5 mm EDTA) and centrifuged, and the protein concentration was measured (BCA protein assay kit, Interchim, Montluçon, France). Following running by SDS-PAGE under reducing conditions, Western blots were accomplished as described earlier using rabbit polyclonal antibodies (dilution of 1:1000) directed, respectively, against endostatin (Abcam), cathepsin L, cathepsin S, and cathepsin B (Calbiochem). Furthermore, proteolytic activities of cathepsins were measured at 37 °C in both supernatants and cell lysates. Assays were performed in 0.1 m sodium acetate buffer, pH 5.5, 2 mm DTT, 2 mm EDTA, using Z-FR-AMC (50 mm) as a substrate for both cathepsins B and L and Z-LR-AMC (50 mm) as a preferred substrate for cathepsins S and K (Spectramax Gemini, Molecular Devices; excitation wavelength = 350 nm, emission wavelength = 460 nm) (16Serveau-Avesque C. Martino M.F. Hervé-Grépinet V. Hazouard E. Gauthier F. Diot E. Lalmanach G. Biol. Cell. 2006; 98: 15-22Crossref PubMed Scopus (44) Google Scholar). Assay for specific cathepsin K activity was achieved by using Z-GPR-AMC (50 μm) in the presence of CA-074. Alternatively, because only cathepsin S retains its proteolytic activity under mildly alkaline conditions, sample was incubated in a 100 mm sodium phosphate buffer, pH 7.4, for 1 h at 37 °C before the residual specific activity of cathepsin S was measured using Z-LR-AMC (50 μm). Overall cathepsin activity was determined by E-64 titration, whereas cathepsin B was titrated by CA-074.Cell CultureProliferation AssaysHUVEC cells were seeded in a 96-well plate (10,000 cells/well) for 24 h in complete medium before adding VEGF (20 ng/ml) in basal medium (PromoCell). Moreover, either 0.1 mm endostatin, 0.1 mm hydrolysis products, or peptides G10T and K15T (10−14 to 10−7 m) were combined to the medium in the presence of 20 mm E-64. 24 h later, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (Promega) was added (20 ml/well), and absorbance was measured after a 2-h incubation (l = 490 nm; Thermomax microplate reader, Molecular Devices). Correspondingly, HUVEC cells were seeded 24 h after siRNA transfection. 24 h later, the medium was replaced by basal medium in the presence or not of 20 mm E-64. After 2 h, both VEGF (20 ng/ml) and endostatin (10−14 to 10−6 m) were added. Cell proliferation was determined as described previously.Caspase-3 ActivityHUVEC cells were seeded in a 24-well plate (100,000 cells/well) for 24 h before addition of VEGF (20 ng/ml) in basal medium together with endostatin or its hydrolysis products (0.1 mm) or endostatin-derived peptides (G10T and K15T, 10−8 to 10−6 m). After 10 h, cells were rinsed with PBS and then lysed (buffer lysis, 20 mm Tris buffer, pH 7.5, 150 mm NaCl, 2 mm EDTA, 2 ml of EGTA, 1 mm sodium orthovanadate, 100 mm PMSF, 10 mg/ml leupeptin, 10 mg/ml aprotinin, 5 mg/ml pepstatin, and 0.2% Nonidet P40). The proteolytic activity of caspase-3 was measured in the presence of 50 mm Z-DEVD-AMC (excitation wavelength = 380 nm, emission wavelength = 450 nm; Spectramax Gemini) in 0.1 m sodium phosphate buffer, pH 7.4, 0.1 m NaCl, 5% sucrose, 0.1% CHAPS, 10 mm DTT. Assays were repeated in the presence of 50 mm Z-DEVD-FMK, an irreversible caspase-3 inhibitor.Migration AssaysFibronectin-coated (50 ng/ml, 1 h, 37 °C) filter inserts (pores, 8-mm diameter) were positioned on 24-well plates (Becton Dickinson) in the presence of VEGF (20 ng/ml) as chemoattractant. Control was performed in the absence of VEGF. Trypsinized HUVEC cells (250,000 cells/ml) were treated for 15 min at 37 °C with endostatin (0.1 mm) or its hydrolysis fragments (0.1 mm) and then placed in inserts (50,000 cells/insert) for 5 h. After fixation for 10 min in methanol and staining with hematoxylin for 2 min, cells present in the lower section were counted (median of three fields/insert) using an inverted microscope (magnification ×200). Experiments were repeated with both G10T and K15T (10−8 to 10−6 m). Alternatively, siRNA-transfected cells were seeded 24 h after transfection in 24-well plates (250,000 cells per well). After 24 h, complete medium was replaced with basal medium in the presence or absence of E-64 (20 mm) and recombinant endostatin was added (10−9 to 10−7 m). After 12 h, cells were taken off and placed on inserts, and migration assays were carried out as described previously.Aminopeptidase N AssayAssays were carried out by preincubating APN (20 ng) for 15 min at 37 °C in 50 mm Tris buffer, pH 7.0, prior adding H-Ala-AMC (100 mm) as recommended by the supplier (excitation wavelength, 380 nm; emission wavelength, 460 nm; Spectramax Gemini). Inhibitory assays were performed in the presence of bestatin, G10T, and Sc-G10T (0–200 mm), and results were reported as means ± S.D. (triplicate experiments).Endothelial Tube Formation AssayTwo hundred microliters of Matrigel (10 mg/ml, BD Biosciences) was applied to pre-cooled 48-well plates, incubated for 10 min at 4 °C, and then allowed to polymerize for 1 h at 37 °C. HUVECs (1 × 105 cells per well, TCS Cellworks, Buckingham, England) were incubated with a range of predetermined concentrations of bestatin, G10T, Sc-G10T, or vehicle-only controls. After incubation at 37 °C and 5% CO2 for 16 h, cells were viewed using a Nikon Eclipse TE300 microscope and images taken using a Nikon DXM1200 digital camera (×20 magnification). Total tubule branching was counted, and results were expressed as the total length of tubule formation per field of view. All variables were performed in duplicate, and seven images were taken from each replicate before analysis (17Burden R.E. Gormley J.A. Jaquin T.J. Small D.M. Quinn D.J. Hegarty S.M. Ward C. Walker B. Johnston J.A. Olwill S.A. Scott C.J. Clin. Cancer Res. 2009; 15: 6042-6051Crossref PubMed Scopus (84) Google Scholar).Statistical AnalysisAnalysis of cell proliferation, migration, apoptosis, and tube formation assays were performed by using a non-parametric multiple comparison test (Kruskal and Wallis test). Data were presented as median ± lower and upper quartile (*, p < 0.1; **, p < 0.05; ***, p < 0.001).DISCUSSIONProteases are key players in angiogenesis due to their ability to activate and release cytokines and angiogenic factors (matrikines) from constituents of the basement membrane and extracellular matrix. As such, they are potential therapeutic targets in the regulation of neovascularization, particularly during neoplastic processes. However, the failure of early clinical trials using MMP inhibitors clearly indicates that the sustainable molecular mechanisms remain poorly understood. Since the late 1990s, an increasing number of anti-angiogenic factors released by proteases were identified, and most studies have focused on their therapeutic impact in high pharmaceutical doses, particularly in controlling tumor progression (37Nyberg P. Xie L. Kalluri R. Cancer Res. 2005; 65: 3967-3979Crossref PubMed Scopus (467) Google Scholar). In contrast, few studies have investigated their physiological and pathophysiological roles. These latter observations demonstrate the importance of studying the regulation of these anti-angiogenic factors and raise the question of the ambivalent role of proteases involved in their homeostasis. Cysteine cathepsins are commonly reported to participate to and enhance cell growth, migration, invasion, angiogenesis, and metastasis, and comprehensible relationships have been established between their deregulation and cancer progression (25Mohamed M.M. Sloane B.F. Nat. Rev. Cancer. 2006; 6: 764-775Crossref PubMed Scopus (995) Google Scholar, 26Vasiljeva O. Reinheckel T. Peters C. Turk D. Turk V. Turk B. Curr. Pharm. Des. 2007; 13: 387-403Crossref PubMed Scopus (194) Google Scholar, 38Turk B. Nat. Rev. Drug Discov. 2006; 5: 785-799Crossref PubMed Scopus (1025) Google Scholar). For instance, cathepsin S, which can degrade anti-angiogenic collagen IV-derived peptides and release proangiogenic fragments from laminin, has been described to favor angiogenesis and microvessel formation in physiological neovascularization (39Wang B. Sun J. Kitamoto S. Yang M. Grubb A. Chapman H.A. Kalluri R. Shi G.P. J. Biol. Chem. 2006; 281: 6020-6029Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar). Nevertheless, our current perception of the role of cathepsins is evolving. In addition to digestive and executioner enzymes, cathepsins that are subject to complex and contrasting controls and checkpoints (transcription, translation, trafficking, and microenvironment) may also act as signaling and regulatory molecules (40Reiser J. Adair B. Reinheckel T. J. Clin. Invest. 2010; 120: 3421-3431Crossref PubMed Scopus (427) Google Scholar). More than 30 proteases, including cysteine cathepsins, have been catalogued with beneficial tumor-suppressive roles in opposition to the currently established rule that their up-regulation is synonymous with tumor progression and poor clinical prognosis (41López-Otín C. Matrisian L.M. Nat. Rev. Cancer. 2007; 7: 800-808Crossref PubMed Scopus (638) Google Scholar). Contrary to other previous studies, cathepsin L KO mice displayed early onset aggressive tumors and an hyperproliferation of keratinocytes in a skin carcinogenesis model, proving that cathepsin L may have a protective role in cancer in association with its critical role for the termination of growth factor signaling (42Reinheckel T. Hagemann S. Dollwet-Mack S. Martinez E. Lohmüller T. Zlatkovic G. Tobin D.J. Maas-Szabowski N. Peters C. J. Cell Sci. 2005; 118: 3387-3395Crossref PubMed Scopus (99) Google Scholar, 43Dennemärker J. Lohmüller T. Mayerle J. Tacke M. Lerch M.M. Coussens L.M. Peters C. Reinheckel T. Oncogene. 2010; 29: 1611-1621Crossref PubMed Scopus (92) Google Scholar). These statements emphasize that proteases may have dual roles and exert for instance opposing proangiogenic and angiostatic effects. Such proteases do not represent rare exceptions and, most probably, in a defined biological context, their number will grow depending on tissue type, cellular microenvironment, and surrounding signaling events (13Mason S.D. Joyce J.A. Trends Cell Biol. 2011; 21: 228-237Abstract Full Text Full Text PDF PubMed Scopus (390) Google Scholar, 41López-Otín C. Matrisian L.M. Nat. Rev. Cancer. 2007; 7: 800-808Crossref PubMed Scopus (638) Google Scholar). As a consequence this also means a supplementary level of difficulty to delineate proangiogenic and anti-angiogenic properties of proteases with challenging activities and to assign a specific role to them. Our current findings support that cathepsins L and S release endostatin fragments with superior proapoptotic and angiostatic properties than its precursor, although they are both better known for their opposite action. Also our results suggest that, besides recycling properties with respect to the release and hydrolysis of the NC1 domain of collagen XVIII, cysteine cathepsins could have a likely regulatory function of angiogenesis via the generation of angiostatic peptides K15T and G10T. In conclusion, earlier reports have proposed that endostatin may be released proteolytically from collagen XVIII by various potential proteases including cathepsins, elastase, and MMPs. Furthermore, some cysteine cathepsins and acid cathepsin D, in contrast to MMPs, were also candidates to degrade endostatin, suggesting a complex role for cathepsins in the regulation of its anti-angiogenic potential (19Ferreras M. Felbor U. Lenhard T. Olsen B.R. Delaissé J. FEBS Lett. 2000; 486: 247-251Crossref PubMed Scopus (332) Google Scholar). Here, we showed that cathepsins S and L liberate human endostatin by cleavage in the C-terminal sensitive hinge region of collagen XVIII (Fig. 7). Cathepsins L and S may then further cleave human endostatin and generate peptides (i.e. G10T and K15T), which display significantly increased angiostatic properties. Specifically, we have demonstrated that the endostatin-derived G10T peptide potently inhibits proliferation of HUVECs, is an effective proapoptotic molecule, and significantly impairs tube formation, suggesting that it could participate in the homeostasis of vascularization. In addition, we hypothesized that the bioactive NGR-containing G10T peptide act, at least in part, through targeting of aminopeptidase N.Given the superior anti-angiogenic efficacy of such peptides, they could be of enhanced therapeutic value compared with commercial full-size endostatin (also known as Endostar). Furthermore, due to the presence of the NGR neovasculature homing motif that targets and binds to APN as does bestatin, endostatin-derived peptides could also represent attractive cargos by conjugation to additional anticancer drugs to improve anti-angiogenic efficiency and bioavailability. IntroductionEndostatin, first discovered by Folkman and collaborators (1O'Reilly M.S. Boehm T. Shing Y. Fukai N. Vasios G. Lane W.S. Flynn E. Birkhead J.R. Olsen B.R. Folkman J. Cell. 1997; 88: 277-285Abstract Full Text Full Text PDF PubMed Scopus (4211) Google Scholar), is a potent therapeutic agent through its ability to inhibit the formation of new blood vessels and reduce tumor growth as a single drug or in combination with chemotherapy and/or radiotherapy (2Marneros A.G. Olsen B.R. Matrix Biol. 2001; 20: 337-345Crossref PubMed Scopus (174) Google Scholar, 3Ling Y. Yang Y. Lu N. You Q.D. Wang S. Gao Y. Chen Y. Guo Q.L. Biochem. Biophys. Res. Commun. 2007; 361: 79-84Crossref PubMed Scopus (228) Google Scholar). Endostatin, which corresponds to the C-terminal domain of collagen XVIII (NC-1 domain), is released by cleavage of a proteolysis-sensitive unstructured hinge region. Endostatin prevents the proliferation, migration, and adhesion of endothelial cells, blocks cell intravasation, and may also induce apoptosis (4Dhanabal M. Volk R. Ramchandran R. Simons M. Sukhatme V.P. Biochem. Biophys. Res. Commun. 1999; 258: 345-352Crossref PubMed Scopus (197) Google Scholar, 5Dixelius J. Cross M. Matsumoto T. Sasaki T. Timpl R. Claesson-Welsh L. Cancer Res. 2002; 62: 1944-1947PubMed Google Scholar, 6Folkman J. Exp. Cell Res. 2006; 312: 594-607Crossref PubMed Scopus (585) Google Scholar). Inhibition of the migration of human umbilical vein endothelial cells (HUVECs) 3The abbreviations used are: HUVEChuman umbilical vein endothelial cellAMC7-amino-4-methyl coumarinAPN/CD13aminopeptidase NCA-074N-(l-3-trans-propylcarbomoyl-oxirane-2-carbonyl)-l-isoleucyl-l-prolineE-64L-trans-epoxysuccinyl-leucylamido-(4-guanidio)butaneFMKfluoromethyl ketoneMMPmatrix metalloproteinaseRPreverse phaseZbenzyloxycarbonyl. occurs in response to VEGF (7Yamaguchi N. Anand-Apte B. Lee M. Sasaki T. Fukai N. Shapiro R. Que I. Lowik C. Timpl R. Olsen B.R. EMBO J. 1999; 18: 4414-4423Crossref PubMed Scopus (424) Google Scholar). The various effects that endostatin elicits on cells is indicative of its multiple modes of action and molecular partners (e.g. integrin αVβ3 and integrin α5β1, glypicans, heparin and heparan sulfates) that form the so-called “endostatin interaction network” (8Faye C. Inforzato A. Bignon M. Hartmann D.J. Muller L. Ballut L. Olsen B.R. Day A.J. Ricard-Blum S. Biochem. J. 2010; 427: 467-475Crossref PubMed Scopus (40) Google Scholar).Alterations in endostatin levels that are frequently observed in pathophysiological processes are of crucial importance. Nevertheless, the molecular mechanisms involved in the production and catabolism of endostatin remains poorly characterized. Although endostatin is generally described as a single protein of ∼20 kDa, several forms of varying lengths have been identified in vivo in both humans and mice (9John H. Preissner K.T. Forssmann W.G. Ständker L. Biochemistry. 1999; 38: 10217-10224Crossref PubMed Scopus (59) Google Scholar). The first protease identified as responsible for the release of murine endostatin (20-kDa form) was cathepsin L (10Felbor U. Dreier L. Bryant R.A. Ploegh H.L. Olsen B.R. Mothes W. EMBO J. 2000; 19: 1187-1194Crossref PubMed Scopus (400) Google Scholar). Matrix metalloproteinases (MMPs) have also been implicated in the release of high molecular mass endostatin forms (24–30 kDa) (11Wen W. Moses M.A. Wiederschain D. Arbiser J.L. Folkman J. Cancer Res. 1999; 59: 6052-6056PubMed Google Scholar). Despite high primary structural identity in collagen XVIII between human and mice, their hinge regions display some critical differences in their amino acid sequences (9John H. Preissner K.T. Forssmann W.G. Ständker L. Biochemistry. 1999; 38: 10217-10224Crossref PubMed Scopus (59) Google Scholar, 12Ständker L. Schrader M. Kanse S.M. Jürgens M. Forssmann W.G. Preissner K.T. FEBS Lett. 1997; 420: 129-133Crossref PubMed Scopus (113) Google Scholar). Consequently, the proteases involved in the release of human endostatin from collagen XVIII have not been clearly identified.The aim of this study was to delineate the role of cysteine cathepsins in the production and/or degradation of human collagen XVIII-derived endostatin and to analyze the consequences in its anti-angiogenic properties on endothelial cells. Our results suggest that cathepsins may finely tune release and breakdown of endostatin and give new molecular insights into its angiogenic mechanisms. These data also advocate that through endostatin-derived peptides, cysteine cathepsins and aminopeptidase N (APN/CD13) may both participate in the multidirectional network of proteolytic interactions that occur during angiogenesis (13Mason S.D. Joyce J.A. Trends Cell Biol. 2011; 21: 228-237Abstract Full Text Full Text PDF PubMed Scopus (390) Google Scholar)." @default.
• W2024583791 created "2016-06-24" @default.
• W2024583791 creator A5001695628 @default.
• W2024583791 creator A5005209374 @default.
• W2024583791 creator A5012048428 @default.
• W2024583791 creator A5031359497 @default.
• W2024583791 creator A5032106230 @default.
• W2024583791 creator A5040414611 @default.
• W2024583791 creator A5059973323 @default.
• W2024583791 date "2011-10-01" @default.
• W2024583791 modified "2023-10-03" @default.
• W2024583791 title "Cysteine Cathepsins S and L Modulate Anti-angiogenic Activities of Human Endostatin" @default.
• W2024583791 cites W1966336232 @default.
• W2024583791 cites W1969762227 @default.
• W2024583791 cites W1971100023 @default.
• W2024583791 cites W1972687991 @default.
• W2024583791 cites W1976451311 @default.
• W2024583791 cites W1979343718 @default.
• W2024583791 cites W1994531766 @default.
• W2024583791 cites W1997104566 @default.
• W2024583791 cites W2007748264 @default.
• W2024583791 cites W2025041219 @default.
• W2024583791 cites W2028768078 @default.
• W2024583791 cites W2037272596 @default.
• W2024583791 cites W2041116703 @default.
• W2024583791 cites W2048293656 @default.
• W2024583791 cites W2049644040 @default.
• W2024583791 cites W2054484461 @default.
• W2024583791 cites W2058873146 @default.
• W2024583791 cites W2070404132 @default.
• W2024583791 cites W2073347425 @default.
• W2024583791 cites W2074231269 @default.
• W2024583791 cites W2074362136 @default.
• W2024583791 cites W2075503331 @default.
• W2024583791 cites W2075780259 @default.
• W2024583791 cites W2076493325 @default.
• W2024583791 cites W2079861151 @default.
• W2024583791 cites W2084544719 @default.
• W2024583791 cites W2085396553 @default.
• W2024583791 cites W2090985686 @default.
• W2024583791 cites W2116238049 @default.
• W2024583791 cites W2123684807 @default.
• W2024583791 cites W2124145112 @default.
• W2024583791 cites W2128704535 @default.
• W2024583791 cites W2130004564 @default.
• W2024583791 cites W2130440034 @default.
• W2024583791 cites W2131798870 @default.
• W2024583791 cites W2140315590 @default.
• W2024583791 cites W2145951150 @default.
• W2024583791 cites W2169872465 @default.
• W2024583791 cites W2170331522 @default.
• W2024583791 cites W2171744625 @default.
• W2024583791 doi "https://doi.org/10.1074/jbc.m111.284869" @default.
• W2024583791 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3199463" @default.
• W2024583791 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21896479" @default.
• W2024583791 hasPublicationYear "2011" @default.
• W2024583791 type Work @default.
• W2024583791 sameAs 2024583791 @default.
• W2024583791 citedByCount "54" @default.
• W2024583791 countsByYear W20245837912012 @default.
• W2024583791 countsByYear W20245837912013 @default.
• W2024583791 countsByYear W20245837912014 @default.
• W2024583791 countsByYear W20245837912015 @default.
• W2024583791 countsByYear W20245837912016 @default.
• W2024583791 countsByYear W20245837912017 @default.
• W2024583791 countsByYear W20245837912018 @default.
• W2024583791 countsByYear W20245837912019 @default.
• W2024583791 countsByYear W20245837912020 @default.
• W2024583791 countsByYear W20245837912021 @default.
• W2024583791 countsByYear W20245837912022 @default.
• W2024583791 countsByYear W20245837912023 @default.
• W2024583791 crossrefType "journal-article" @default.
• W2024583791 hasAuthorship W2024583791A5001695628 @default.
• W2024583791 hasAuthorship W2024583791A5005209374 @default.
• W2024583791 hasAuthorship W2024583791A5012048428 @default.
• W2024583791 hasAuthorship W2024583791A5031359497 @default.
• W2024583791 hasAuthorship W2024583791A5032106230 @default.
• W2024583791 hasAuthorship W2024583791A5040414611 @default.
• W2024583791 hasAuthorship W2024583791A5059973323 @default.
• W2024583791 hasBestOaLocation W20245837911 @default.
• W2024583791 hasConcept C167844969 @default.
• W2024583791 hasConcept C181199279 @default.
• W2024583791 hasConcept C185592680 @default.
• W2024583791 hasConcept C2779201268 @default.
• W2024583791 hasConcept C2780394083 @default.
• W2024583791 hasConcept C502942594 @default.
• W2024583791 hasConcept C55493867 @default.
• W2024583791 hasConcept C75920679 @default.
• W2024583791 hasConcept C86803240 @default.
• W2024583791 hasConcept C98274493 @default.
• W2024583791 hasConceptScore W2024583791C167844969 @default.
• W2024583791 hasConceptScore W2024583791C181199279 @default.
• W2024583791 hasConceptScore W2024583791C185592680 @default.
• W2024583791 hasConceptScore W2024583791C2779201268 @default.
• W2024583791 hasConceptScore W2024583791C2780394083 @default.
• W2024583791 hasConceptScore W2024583791C502942594 @default.
• W2024583791 hasConceptScore W2024583791C55493867 @default.
• W2024583791 hasConceptScore W2024583791C75920679 @default.

• next