FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2024722013> ?p ?o ?g. }

• W2024722013 endingPage "8850" @default.
• W2024722013 startingPage "8844" @default.
• W2024722013 abstract "Two DNA clones encoding rabbit β-galactoside α1,2-fucosyltransferase (RFT-I and RFT-II) have been isolated from a rabbit genomic DNA library. The DNA sequences revealed open reading frames coding for 373 (RFT-I) and 354 (RFT-II) amino acids, respectively. The deduced amino acid sequences of RFT-I and RFT-II showed 56% identity with each other, and that of RFT-I showed 80% identity with that of human H blood type α1,2-fucosyltransferase. Northern blot analysis of embryo and adult rabbit tissues revealed that the RFT-I gene was expressed in adult brain, and that the RFT-II gene was expressed in salivary and lactating mammary glands. The identities of these enzymes were confirmed by constructing recombinant fucosyltransferases in which the N-terminal part including the cytoplasmic tail and signal anchor domain was replaced with the immunoglobulin signal peptide sequence. RFT-I expressed in COS-7 cells exhibited similar transferase activity to that of human H blood type α1,2-fucosyltransferase. RFT-II expressed in COS-7 cells showed higher affinity for type 1 (Galβ1,3GlcNAc) and type 3 (Galβ1,3GalNAc) acceptors than type 2 (Galβ1,4GlcNAc) ones, which suggested that RFT-II was a putative secretor-type α1,2-fucosyltransferase. Two DNA clones encoding rabbit β-galactoside α1,2-fucosyltransferase (RFT-I and RFT-II) have been isolated from a rabbit genomic DNA library. The DNA sequences revealed open reading frames coding for 373 (RFT-I) and 354 (RFT-II) amino acids, respectively. The deduced amino acid sequences of RFT-I and RFT-II showed 56% identity with each other, and that of RFT-I showed 80% identity with that of human H blood type α1,2-fucosyltransferase. Northern blot analysis of embryo and adult rabbit tissues revealed that the RFT-I gene was expressed in adult brain, and that the RFT-II gene was expressed in salivary and lactating mammary glands. The identities of these enzymes were confirmed by constructing recombinant fucosyltransferases in which the N-terminal part including the cytoplasmic tail and signal anchor domain was replaced with the immunoglobulin signal peptide sequence. RFT-I expressed in COS-7 cells exhibited similar transferase activity to that of human H blood type α1,2-fucosyltransferase. RFT-II expressed in COS-7 cells showed higher affinity for type 1 (Galβ1,3GlcNAc) and type 3 (Galβ1,3GalNAc) acceptors than type 2 (Galβ1,4GlcNAc) ones, which suggested that RFT-II was a putative secretor-type α1,2-fucosyltransferase. The H antigen, the fucosylated structure of the terminal β- D-Gal residue, is synthesized by GDP- L-fucose:β- D-galactoside 2-α- L-fucosyltransferase (α1,2-FT) 1The abbreviations used are:α1,2-FTGDP- L-fucose:β- D-galactoside 2-α- L-fucosyltransferasekbkilobase(s)bpbase pair(s)PCRpolymerase chain reactionPBSphosphate-buffered salineMES2-(N-morpholino)ethanesulfonic acidFITCfluorescein isothiocyanateHPTLChigh performance thin layer chromatographyDRGdorsal root gangliaUEA-1Ulex europaeus agglutinin 1Se-typesecretor-type; nomenclature for gangliosides and glycolipids follows the system of Svennerholm (27Svennerholm L. Adv. Exp. Biol. Med. 1980; 125: 533-544Crossref PubMed Scopus (125) Google Scholar). 1The abbreviations used are:α1,2-FTGDP- L-fucose:β- D-galactoside 2-α- L-fucosyltransferasekbkilobase(s)bpbase pair(s)PCRpolymerase chain reactionPBSphosphate-buffered salineMES2-(N-morpholino)ethanesulfonic acidFITCfluorescein isothiocyanateHPTLChigh performance thin layer chromatographyDRGdorsal root gangliaUEA-1Ulex europaeus agglutinin 1Se-typesecretor-type; nomenclature for gangliosides and glycolipids follows the system of Svennerholm (27Svennerholm L. Adv. Exp. Biol. Med. 1980; 125: 533-544Crossref PubMed Scopus (125) Google Scholar). (reviewed in Ref. 1Watkins W.M. Adv. Hum. Genet. 1980; 10: 1-136PubMed Google Scholar). The expression of H determinants is strictly regulated temporally and spatially during vertebrate development (2Szulman A.E. J. Exp. Med. 1962; 115: 977-996Crossref PubMed Scopus (159) Google Scholar, 3Szulman A.E. J. Exp. Med. 1964; 119: 503-516Crossref PubMed Scopus (95) Google Scholar, 4Fenderson B.A. Holmes E.H. Fukushi Y. Hakomori S. Dev. Biol. 1986; 114: 12-21Crossref PubMed Scopus (79) Google Scholar). We previously reported histochemical investigation of glycoconjugates containing a terminal Fucα1,2Gal residue in the human and rabbit nervous systems, using polyclonal and monoclonal anti-fucosyl GM1antibodies, and UEA-1 lectin (5Kusunoki S. Inoue K. Iwamori M. Nagai Y. Mannen T. Brain Res. 1989; 494: 391-395Crossref PubMed Scopus (19) Google Scholar, 6Kusunoki S. Inoue K. Iwamori M. Nagai Y. Mannen T. Neurosci. Lett. 1991; 126: 159-162Crossref PubMed Scopus (20) Google Scholar, 7Kusunoki S. Inoue K. Iwamori M. Nagai Y. Mannen T. Kanazawa I. Neurosci. Res. 1992; 15: 74-80Crossref PubMed Scopus (18) Google Scholar, 8Kusunoki S. Chiba A. Shimizu T. Kanazawa I. Biochim. Biophys. Acta. 1994; 1214: 27-31Crossref PubMed Scopus (11) Google Scholar). The anti-fucosyl GM1antibodies and UEA-1 lectin recognized a subpopulation of neurons in the dorsal root ganglia (DRG) and dorsal horn of the spinal cord. The anti-fucosyl GM1antibodies also bound to the satellite cells surrounding the fucosyl GM1-positive neurons (5Kusunoki S. Inoue K. Iwamori M. Nagai Y. Mannen T. Brain Res. 1989; 494: 391-395Crossref PubMed Scopus (19) Google Scholar, 7Kusunoki S. Inoue K. Iwamori M. Nagai Y. Mannen T. Kanazawa I. Neurosci. Res. 1992; 15: 74-80Crossref PubMed Scopus (18) Google Scholar). In addition, in rabbits, the anti-fucosyl GM1antibodies bound to the axons and the myelin of the small myelinated fibers in the dorsal root, and the large neurons in the ventral horn (8Kusunoki S. Chiba A. Shimizu T. Kanazawa I. Biochim. Biophys. Acta. 1994; 1214: 27-31Crossref PubMed Scopus (11) Google Scholar). GDP- L-fucose:β- D-galactoside 2-α- L-fucosyltransferase kilobase(s) base pair(s) polymerase chain reaction phosphate-buffered saline 2-(N-morpholino)ethanesulfonic acid fluorescein isothiocyanate high performance thin layer chromatography dorsal root ganglia Ulex europaeus agglutinin 1 secretor-type; nomenclature for gangliosides and glycolipids follows the system of Svennerholm (27Svennerholm L. Adv. Exp. Biol. Med. 1980; 125: 533-544Crossref PubMed Scopus (125) Google Scholar). GDP- L-fucose:β- D-galactoside 2-α- L-fucosyltransferase kilobase(s) base pair(s) polymerase chain reaction phosphate-buffered saline 2-(N-morpholino)ethanesulfonic acid fluorescein isothiocyanate high performance thin layer chromatography dorsal root ganglia Ulex europaeus agglutinin 1 secretor-type; nomenclature for gangliosides and glycolipids follows the system of Svennerholm (27Svennerholm L. Adv. Exp. Biol. Med. 1980; 125: 533-544Crossref PubMed Scopus (125) Google Scholar). Since these fucosylated glycoconjugates showed developmental changes, especially during the perinatal period (7Kusunoki S. Inoue K. Iwamori M. Nagai Y. Mannen T. Kanazawa I. Neurosci. Res. 1992; 15: 74-80Crossref PubMed Scopus (18) Google Scholar), they may function as important molecules in the development of the nervous system, such as axon elongation or myelination. Some fucosylated glycoconjugates are known to play an important role in cell adhesion (9Bird J.M. Kimber S.J. Dev. Biol. 1984; 104: 449-460Crossref PubMed Scopus (159) Google Scholar, 10Fenderson B.A. Zehavi U. Hakomori S. J. Exp. Med. 1984; 160: 1591-1596Crossref PubMed Scopus (249) Google Scholar, 11Eggens I. Fenderson B. Toyokuni T. Dean B. Stroud M. Hakomori S. J. Biol. Chem. 1989; 264: 9476-9484Abstract Full Text PDF PubMed Google Scholar). However, the significance of glycoconjugates bearing a Fucα1,2Gal residue remains to be clarified. To elucidate the mechanisms underlying the regulation of fucosylation and the possible functional roles of the glycoconjugates with a Fucα1,2Gal residue, molecular analysis of the α1,2-FT gene is indispensable. Recent genetic and biochemical studies indicated that human H blood-type α1,2-FT and Se-type α1,2-FT are encoded by distinct but closely linked structural genes, the H and Se genes (12Le Pendu J. Lemieux R.U. Lambert F. Dalix A.-M. Oriol R. Am. J. Hum. Genet. 1982; 34: 402-415PubMed Google Scholar, 13Le Pendu J. Cartron J.P. Lemieux R.U. Oriol R. Am. J. Hum. Genet. 1985; 37: 749-760PubMed Google Scholar). Enzymatic characterization of the two α1,2-FTs revealed differences in the Kmvalues for various oligosaccharide acceptors (14Sarnesto A. Köhlin T. Thurin J. Blaszczyk-Thurin M. J. Biol. Chem. 1990; 265: 15067-15075Abstract Full Text PDF PubMed Google Scholar, 15Sarnesto A. Köhlin T. Hindsgaul O. Thurin J. Blaszczyk-Thurin M. J. Biol. Chem. 1992; 267: 2737-2744Abstract Full Text PDF PubMed Google Scholar). Further analysis of the structures and in their regulation of the α1,2-FT genes requires molecular cloning, and one α1,2-FT gene for an H blood-type determinant has been cloned so far (16Larsen R.D. Ernst L.K. Nair R.P. Lowe J.B. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 6674-6678Crossref PubMed Scopus (303) Google Scholar). We have tried to clone rabbit α1,2-FTs in order to reveal the role of the Fucα1,2Gal epitope in the development of the nervous system. A rabbit genomic DNA library was screened, because the entire open reading frame of human H blood-type α1,2-FT is encoded by one exon (17Kelly R.J. Ernst L.K. Larsen R.D. Bryant J.G. Robinson J.S. Lowe J.B. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 5843-5847Crossref PubMed Scopus (155) Google Scholar). Here we report the molecular cloning of two types of rabbit α1,2-FTs, one of which is a counterpart of human H blood-type α1,2-FT and the other a putative Se-type α1,2-FT as judged on kinetic analysis. GDP-Fuc, phenyl-β- D-Gal, p-nitrophenyl-α- D-Gal, p-nitrophenyl-β- D-Gal, p-nitrophenyl-β- D-GalNAc, galactose β1,3- N-acetyl-glucosaminide (Galβ1,3GlcNAc), Galβ1,4GlcNAc, Galβ1,3GalNAc, lactose, Fucα1,2lactose, lacto- N-tetraose, lacto- N-neotetraose, asialofetuin, α1-acid glycoprotein, bovine submaxillary mucin, and FITC-labeled UEA-1 lectin were from Sigma. Asialo-α1-acid glycoprotein and bovine submaxillary asialomucin were obtained by mild acid treatment of the respective glycoproteins. GDP-[14C]Fuc (10.5 GBq/mmol) was from DuPont Corp. (France). GM1was from Biosynth AG (Switzerland). Paragloboside was from Dia-Iatron (Tokyo, Japan). Monoclonal antibodies to blood groups A and B were from Biomeda (Foster City, CA). FITC-labeled anti-mouse Ig(G and M) was from Tago (Burlingame, CA). Restriction endonucleases were from Takara (Kyoto, Japan). The standard molecular cloning techniques described by Maniatis and co-workers were used (18Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). DNA was prepared from rabbit brain and then partially digested with Sau3AI. Size-fractionated DNA (10-15 kb) was ligated to λ-EMBL3 (Stratagene) and then packaged in vitro with the Gigapack II Gold packaging extract (Stratagene). The resulting genomic DNA library was plated using Escherichia coli strain MRA as a host for screening. The PCR fragments used as probes for screening of the rabbit genomic DNA library were amplified using primers as to the deduced catalytic region of human H blood-type α1,2-FT. Sense primer FT12, TCGTGGTCACCAGCAACGGCATG, and antisense primer FT14, TCAGAGTCTGGCAGGGTGAAGTT, were synthesized with an Applied Biosystem 394 DNA Synthesizer, and rabbit genomic DNA was used as a template for PCR. PCR amplification was carried out using a DNA thermal cycler (Perkin-Elmer), with 40 cycles consisting of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s. The PCR products (229 bp) were blunt-ended, phosphorylated, and then subcloned into the EcoRV site of plasmid pBluescript SK(+). About 2 × 106plaques of the rabbit genomic DNA library were screened by the standard hybridization method with the 32P-labeled random-primed (Amersham Corp.) PCR product (229 bp) as a probe. Two independent positive plaques containing 12.6-kb (RG11) and 14.9-kb (RG101) inserts were isolated to homogeneity. The RG11 and RG101 DNA fragments were digested with appropriate restriction enzymes and then subcloned into vector plasmid pUC 119. The DNA sequences were determined by the dideoxynucleotide chain-termination method using an Autocycle DNA sequencing kit and an ALF DNA sequencer (Pharmacia Biotech Inc.). The sequences were analyzed using a PC/Gene (Teijin System Technology, Japan). Total RNA was prepared by the guanidium thiocyanate method and purified by ultracentrifugation through 5.7 M CsCl. Poly(A)-rich RNA was purified with Oligotex-dT30 (Takara). The poly(A)-rich RNA (5 μg) was fractionated on a denaturing formaldehyde-agarose gel (1.2%), and then transferred onto a nylon membrane (Nytran; Schleicher & Schell). Genomic DNA (10 μg) was digested for 2 h with several restriction enzymes and then loaded onto a 0.6% agarose gel. After electrophoresis, the gel was denatured (1 h) with 0.5 N NaOH and 1.5 M NaCl, and then the DNA was transferred to a nylon membrane. Both Northern and Southern filters were prehybridized in 50% formamide, 5 × SSPE, 5 × Denhardt's, 0.5% SDS, 0.25% sodium lauryl sarcosine, and 100 μg/ml denatured salmon sperm DNA at 37°C for 2 h. Hybridization was then performed overnight at 37°C with the PstI fragment (680 bp) for RFT-I and with the NaeI fragment (446 bp) for RFT-II labeled with 32P, using the random priming method. The filters were washed twice in 2 × SSC, 0.1% SDS at 65°C, and finally in 0.5 × SSC, 0.1% SDS at 65°C for 30 min. A SmaI fragment (1.5 kb) of RG11 DNA containing the full open reading frame of RFT-I was ligated into mammalian expression vector pcD-SRα (19Takebe Y. Seiki M. Fujisawa J. Hoy P. Yokota K. Arai K. Yoshida M. Arai N. Mol. Cell. Biol. 1988; 8: 466-472Crossref PubMed Google Scholar), which had previously been digested with EcoRI, blunt-ended with T4 DNA polymerase, and dephosphorylated with bacterial alkaline phosphatase. RG101 DNA was digested with SalI and partially digested with XhoI, and a XhoI- SalI fragment (2.3 kb) containing the full open reading frame of RFT-II was ligated into pcD-SRα, which had previously been digested with XhoI and then dephosphorylated. The single insertion in the correct orientation was finally analyzed with restriction enzymes. To express the soluble forms of RFT-I and RFT-II, comprising recombinant fucosyltransferases in which the N-terminal part was replaced with the immunoglobulin signal peptide sequence, expression plasmids pUGS-RFT-I and pUGS-RFT-II were constructed. The genes encoding the putative catalytic domain and 3′-untranslated region were specifically amplified by PCR using a synthetic sense primer, 5′-TGTCTGGAATTCCAGCCGGTGCCAGCCCC-3′, and an antisense primer, 5′-TCTCCCGAATTCTGCCCAGGTAGAATCACT-3′, for RFT-I, and another sense primer, 5′-GTGGTCGAATTCCCCGGACACCTACCCC-3′, and another antisense primer, 5′-AAGTCTGAATTCAGACTCCGTGTGGGATCC-3′, for RFT-II (synthetic EcoRI site underlined). The amplified DNA fragments were digested with EcoRI and then ligated into the EcoRI site of pUGS (20Kurosawa N. Hamamoto T. Lee Y.-C. Nakaoka T. Kojima N. Tsuji S. J. Biol. Chem. 1994; 269: 1402-1409Abstract Full Text PDF PubMed Google Scholar) to generate pUGS-RFT-I and pUGS-RFT-II. The fusion constructs were verified by DNA sequencing to confirm fusion junction sequences. COS-7 cells (100-mm culture dish) were transiently transfected with 10 μg of pcD-SRα-RFT-I or pcD-SRα-RFT-II using the DEAE-dextran procedure (21McCutchan J.H. Pagano J.S. J. Natl. Cancer Inst. 1968; 41: 351-357PubMed Google Scholar). The cells were trypsinized and divided into several smaller dishes 24 h post-transfection. The cells were stained with FITC-labeled UEA-1 lectin or with monoclonal antibodies to blood group A or B at 72 h post-transfection. After washing with PBS, the cells were fixed with formaldehyde for 3 min, washed, and then incubated in 3% bovine serum albumin/PBS. After washing briefly with PBS, the cells were incubated in 2 ng/ml FITC-labeled UEA-1 lectin in 3% bovine serum albumin/PBS for 1.5 h, or in monoclonal antibodies to blood group A or B for 1.5 h, and then washed with PBS, followed by incubation with FITC-labeled anti-mouse Ig(G and M) for 1 h. After washing three times with PBS, the cells were observed under a fluorescence microscope. The cells from another dish were washed with PBS and then with 25 m M MES for 10 min, and then collected with a rubber policemen and pelleted by centrifugation. The pellets were resuspended in cold 1% Triton X-100 and then sonicated briefly (22Rajan V.P. Larsen R.D. Ajmera S. Ernst L.K. Lowe J.B. J. Biol. Chem. 1989; 264: 11158-11167Abstract Full Text PDF PubMed Google Scholar). To obtain the soluble forms, COS-7 cells (100-mm culture dish) were transiently transfected with 10 μg of pUGS-RFT-I or pUGS-RFT-II by the DEAE-dextran method. The culture medium was concentrated 10-fold on Centricon 30 filters (Amicon) and then subjected to the fucosyltransferase assay. The fucosyltransferase assays were performed according to the previous report (22Rajan V.P. Larsen R.D. Ajmera S. Ernst L.K. Lowe J.B. J. Biol. Chem. 1989; 264: 11158-11167Abstract Full Text PDF PubMed Google Scholar), in a mixture of 25 m M sodium phosphate (pH 6.1), 5 m M ATP, 30 μM GDP-fucose, 3 μM GDP-[14C]fucose (10.5 Bq/pmol), the enzyme solution and substrates in a final volume of 10 μl. Each reaction mixture was incubated at 37°C for 2 h, and then applied to a Silica Gel 60 HPTLC plate (Merck, Germany). The plate was developed with ethanol:pyridine:1-butanol:water:acetic acid (100:10:10:30:3) for oligosaccharide acceptors, and with chloroform:methanol:0.5% CaCl2(55:45:10) for glycolipid acceptors, respectively. When glycolipids and benzyl-oligosaccharides were used as substrates, the reaction mixture was applied to C-18 Sep-Pak cartridge (Waters-Millipore), washed with 2 ml of water, and then eluted with 1 ml of methanol. The eluate was then applied to a HPTLC plate and developed. The radioactivity on each plate was visualized and determined with a BAS2000 radioimage analyzer (Fuji Film, Japan). A DNA fragment (229 bp; Fig. 2 A, underlined) was obtained by PCR amplification with sense primer FT-12 and antisense primer FT-14 from rabbit genomic DNA. To obtain DNA encoding rabbit α1,2-FT, a rabbit genomic DNA library was screened with the PCR product as a probe. Two positive clones, RG11 (Fig. 1 A) and RG101 (Fig. 1 B), were obtained. Sequence analysis revealed that RG11 contained an entire open reading frame, encoding 373 amino acids with a predicted molecular mass of 42 kDa (RFT-I, Fig. 2 A) and that RG101 contained an entire open reading frame, encoding 354 amino acids with a predicted molecular mass of 40 kDa (RFT-II, Fig. 2 B).FIG. 1Restriction maps for RG11 (A) and RG101 (B), and the sequence-analysis strategy. The coding region is depicted as a shaded box and the non-coding region as a solid line. The arrows indicate the direction and extent of sequencing.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Comparison of the primary structure of RFT-I and RFT-II revealed 56% of significant amino acid identity (Fig. 2 C). Deduced amino acid sequences of RFT-I and RFT-II showed 80% and 55% identity with that of human α1,2-FT, respectively. When the entire coding region was used as a probe, more than one band was detected on genomic Southern blot analysis. We then used the PstI fragment (680 bp) of RFT-I and the NaeI fragment (446 bp) of RFT-II as probes that hybridized to one band on Southern blotting (data not shown). Northern blot analysis revealed that a 3.8-kb mRNA of RFT-I was expressed in adult cerebrum and cerebellum (Fig. 3 A), and that a 1.6-kb mRNA of RFT-II was detected in salivary and lactating mammary glands (Fig. 3 B). The transcription of RFT-I in brain was first detected on embryonic day 28 and increased thereafter. The probe for RFT-II did not hybridize to embryonic tissues. Cell extracts from COS-7 cells transfected with pcD-SRα-RFT-I or pcD-SRα-RFT-II, and concentrated culture medium from COS-7 cells transfected with pUGS-RFT-I or pUGS-RFT-II were subjected to the fucosyltransferase assay. When phenyl-β- D-Gal was used as a substrate, radiolabeled fucose was incorporated into the substrate with any of the enzyme preparations (Fig. 4), which meant both RFT-I and RFT-II were fucosyltransferases. FITC-labeled UEA-1 lectin staining, however, showed that pcD-SRα-RFT-I transfected COS-7 cells were positive but that pcD-SRα-RFT-II transfected COS-7 cells were negative (Fig. 5), which suggested differences in acceptor specificity between RFT-I and RFT-II. COS-7 cells transfected with pcD-SRα-RFT-I or pcD-SRα-RFT-II were positive for blood group A, but both were negative for blood group B (Fig. 5).FIG. 5Expression of UEA-1 lectin-reactive glycoconjugates and blood group A antigens on RFT-I and RFT-II transfected COS-7 cells. COS-7 cells were transiently transfected with 10 μg of pcD-SRα, pcD-SRα-RFT-I, or pcD-SRα-RFT-II using the DEAE-dextran procedure. The cells were divided into five dishes by trypsinization 24 h post-transfection, and were stained with UEA-1 lectin, anti-blood group A or B antibodies, or negative control IgG 72 h post-transfection. Transfection of RFT-I or RFT-II was verified by measuring fucosyltransferase activity using cell extract from another dish.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Because the fucosyltransferase activity of the cell extracts was virtually identical with and stronger than that of concentrated culture medium, respectively, the cell extracts were used for further kinetic analysis. Both RFT-I and RFT-II could transfer fucose to pNP-β-Gal but not to pNP-α-Gal or pNP-β-GalNAc. Both enzymes could also fucosylate lactose to form fucosyl lactose, which comigrated with Fucα1,2lactose on HPTLC with several solvent systems. As shown in Table I, RFT-I exhibited almost the same reactivity with type 1 (Galβ1,3GlcNAc), type 2 (Galβ1,4GlcNAc), and type 3 (Galβ1,3GalNAc) acceptors, but RFT-II showed higher reactivity with type 1 or type 3 than type 2 acceptors. Lineweaver-Burk plots for LNT, LNnT, phenyl-β- D-Gal, and types 1, 2, and 3 oligosaccharides are shown in Fig. 6. RFT-I and RFT-II could transfer fucose not only to asialoglycoproteins but also to glycolipids. Experiments were performed in triplicate, and typical plots and values of Kmand Vmax / Kmwere shown in Fig. 6 and Table I, respectively.Table I:Acceptor specificities of RFT-I and RFT-IIThe table shows the apparent Kmand Vmax / Kmvalues and relative activities as to the incorporation of fucose into phenyl-β- D-Gal as a substrate.FIG. 6Lineweaver-Burk plots. Lineweaver-Burk plots for RFT-I (closed circles) and RFT-II (closed squares) used to calculate the K and Vmax / K values are shown. Experiments were performed in triplicate, and typical plots are shown.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The table shows the apparent Kmand Vmax / Kmvalues and relative activities as to the incorporation of fucose into phenyl-β- D-Gal as a substrate. RFT-I and RFT-II catalyze the transfer of GDP-fucose to a β-Gal residue but not to α-Gal or β-GalNAc. Fucosyl lactose formed from fucose and lactose by both enzymes comigrated with standard Fucα1,2lactose on HPTLC with several solvent systems. COS-7 cells transfected with RFT-I were stained with UEA-1 lectin, which is thought to recognize the fucosylated type 2 chain of glycoproteins with an α1,2 linkage (23Pereira M.E.A. Kisailus E.C. Gruezo F. Kabat E.A. Arch. Biochem. Biophys. 1978; 185: 108-115Crossref PubMed Scopus (210) Google Scholar). Whereas COS-7 cells maintain N-acetylgalactosaminyltransferase activity, both RFT-I and RFT-II transfected COS-7 cells were positive for monoclonal antibodies to blood group A, which is specific to GalNAcα1,4-(Fucα1,2)-β-galactoside. These observations support the notion that RFT-I and RFT-II could be α1,2-FTs. The deduced amino acid sequence of RFT-I showed 80% identity with that of human H blood-type α1,2-FT (16Larsen R.D. Ernst L.K. Nair R.P. Lowe J.B. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 6674-6678Crossref PubMed Scopus (303) Google Scholar), whereas the deduced amino acid sequence of RFT-II showed 55% and 56% identity with those of RFT-I and human H blood-type α1,2-FT, respectively. The Km values of RFT-I are comparable for phenyl-β- D-Gal, and types 1, 2, and 3 acceptors, which suggests that the binding specificity of RFT-I is primarily restricted to terminal β- D-Gal residues of acceptors. This observation is consistent with the kinetic properties of human H blood-type α1,2-FT (14Sarnesto A. Köhlin T. Thurin J. Blaszczyk-Thurin M. J. Biol. Chem. 1990; 265: 15067-15075Abstract Full Text PDF PubMed Google Scholar). RFT-I exhibited reactivity with glycolipids that share the same terminal determinant with a free oligosaccharide, but there were some discrepancies regarding the reactivity of H blood-type α1,2-FT with glycolipids among previous reports (14Sarnesto A. Köhlin T. Thurin J. Blaszczyk-Thurin M. J. Biol. Chem. 1990; 265: 15067-15075Abstract Full Text PDF PubMed Google Scholar, 24Pacuszka T. Koscielak J. Eur. J. Biochem. 1976; 64: 499-506Crossref PubMed Scopus (35) Google Scholar, 25Beyer T.A. Hill R.L. J. Biol. Chem. 1980; 255: 5373-5379Abstract Full Text PDF PubMed Google Scholar). The structural and kinetic characteristics support that RFT-I is a rabbit counterpart of human H blood-type α1,2-FT. Human H blood-type α1,2-FT is expressed in tissues of mesodermal origin (1Watkins W.M. Adv. Hum. Genet. 1980; 10: 1-136PubMed Google Scholar, 12Le Pendu J. Lemieux R.U. Lambert F. Dalix A.-M. Oriol R. Am. J. Hum. Genet. 1982; 34: 402-415PubMed Google Scholar), whereas the expression of RFT-I is limited in the brain. It is not uncommon that an expression pattern differs from species to species. RFT-II has higher affinity to types 1 and 3 acceptors than type 2 ones. It exhibits significantly lower affinity for phenyl-β- D-Gal and type 2 acceptors, compared with RFT-I. The kinetic parameters of RFT-II are comparable with those of human Se-type α1,2-FT, which has higher affinity for types 1 and 3 acceptors than type 2 ones and phenyl-β- D-Gal (15Sarnesto A. Köhlin T. Hindsgaul O. Thurin J. Blaszczyk-Thurin M. J. Biol. Chem. 1992; 267: 2737-2744Abstract Full Text PDF PubMed Google Scholar). The transcription distribution of RFT-II in secretory glands is similar to that of human Se-type α1,2-FT (13Le Pendu J. Cartron J.P. Lemieux R.U. Oriol R. Am. J. Hum. Genet. 1985; 37: 749-760PubMed Google Scholar). We conclude that RFT-II is a rabbit counterpart of putative human Se-type α1,2-FT. RFT-II transfected COS-7 cells were negative for UEA-1 lectin staining but were positive for blood group A. RFT-II is possibly unable to accept type 2 glycochains as acceptors, and, in this case, the blood group A antigens of RFT-II transfected COS-7 cells comprise type 1 glycochains. Another possible explanation is that RFT-II transfers fucose in a lower amount to type 2 glycochains, which are then completely converted to blood group A active molecules. Comparison of the rabbit α1,2-FTs and recently cloned rat DNA fragments of the putative α1,2-FTs (26Piau J.-P. Labarriere N. Dabouis G. Denis M.G. Biochem. J. 1994; 300: 623-626Crossref PubMed Scopus (35) Google Scholar) revealed that the deduced amino acid sequence of RFT-I showed more homology with that of rat FTA (84% identity) than with that of rat FTB (72% identity). The deduced amino acid sequence of RFT-II showed 74% and 80% identity with those of rat FTA and rat FTB, respectively. However, this does not necessarily mean that rat FTA and FTB are genes corresponding to RFT-I and RFT-II, respectively, because there might be additional and closely related α1,2-FTs other than RFT-I and RFT-II. Molecular cloning of the entire genes and kinetic analysis of putative rat α1,2-FTs are necessary before coming to a conclusion regarding the relationship between RFT-I, RFT-II, and rat FTA and FTB. Our previous histochemical study revealed that the expression of fucosyl GM1and UEA-1 lectin reactive antigens was strictly regulated during development, especially during the perinatal period (7Kusunoki S. Inoue K. Iwamori M. Nagai Y. Mannen T. Kanazawa I. Neurosci. Res. 1992; 15: 74-80Crossref PubMed Scopus (18) Google Scholar, 8Kusunoki S. Chiba A. Shimizu T. Kanazawa I. Biochim. Biophys. Acta. 1994; 1214: 27-31Crossref PubMed Scopus (11) Google Scholar). In rabbit DRG neurons, fucosyl GM1is readily detected immunohistochemically on embryonic day 25, followed by the appearance of UEA-1 lectin-reactive antigens postnatally (7Kusunoki S. Inoue K. Iwamori M. Nagai Y. Mannen T. Kanazawa I. Neurosci. Res. 1992; 15: 74-80Crossref PubMed Scopus (18) Google Scholar). UEA-1 lectin-reactive antigens of DRG neurons in postnatal rabbits could be formed through fucosylation catalyzed by RFT-I, although we could not analyze the developmental expression pattern of RFT-I in DRG because of the scarcity of the tissue and the relative non-abundance of RFT-I expression. On the contrary, fucosyl GM1observed in DRG neurons of embryonic day 25 rabbits might not be the product of RFT-I because UEA-1 lectin-reactive antigens are not detected at that stage. This observation suggests the existence of another type of α1,2-FT that catalyzes preferential fucosylation of glycolipids. We thank Drs. Nobuyuki Kurosawa, Takashi Nakaoka, Naoya Kojima, and Toshiro Hamamoto for helpful discussions." @default.
• W2024722013 created "2016-06-24" @default.
• W2024722013 creator A5014113547 @default.
• W2024722013 creator A5034777871 @default.
• W2024722013 creator A5036040469 @default.
• W2024722013 creator A5060389174 @default.
• W2024722013 date "1995-04-01" @default.
• W2024722013 modified "2023-10-03" @default.
• W2024722013 title "Molecular Cloning and Expression of Two Types of Rabbit β-Galactoside α1,2-Fucosyltransferase" @default.
• W2024722013 cites W1493639935 @default.
• W2024722013 cites W1510285220 @default.
• W2024722013 cites W1522003637 @default.
• W2024722013 cites W1570592551 @default.
• W2024722013 cites W1636416079 @default.
• W2024722013 cites W1659796181 @default.
• W2024722013 cites W1972452895 @default.
• W2024722013 cites W1987034586 @default.
• W2024722013 cites W1993934770 @default.
• W2024722013 cites W1997825004 @default.
• W2024722013 cites W2025552036 @default.
• W2024722013 cites W2031034856 @default.
• W2024722013 cites W2041217789 @default.
• W2024722013 cites W2055691615 @default.
• W2024722013 cites W2067436498 @default.
• W2024722013 cites W2067934657 @default.
• W2024722013 cites W2085555653 @default.
• W2024722013 cites W2091692594 @default.
• W2024722013 cites W2113406360 @default.
• W2024722013 cites W2414395870 @default.
• W2024722013 cites W4255858411 @default.
• W2024722013 cites W4376052236 @default.
• W2024722013 cites W656670205 @default.
• W2024722013 doi "https://doi.org/10.1074/jbc.270.15.8844" @default.
• W2024722013 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7721792" @default.
• W2024722013 hasPublicationYear "1995" @default.
• W2024722013 type Work @default.
• W2024722013 sameAs 2024722013 @default.
• W2024722013 citedByCount "53" @default.
• W2024722013 countsByYear W20247220132015 @default.
• W2024722013 crossrefType "journal-article" @default.
• W2024722013 hasAuthorship W2024722013A5014113547 @default.
• W2024722013 hasAuthorship W2024722013A5034777871 @default.
• W2024722013 hasAuthorship W2024722013A5036040469 @default.
• W2024722013 hasAuthorship W2024722013A5060389174 @default.
• W2024722013 hasBestOaLocation W20247220131 @default.
• W2024722013 hasConcept C104317684 @default.
• W2024722013 hasConcept C105795698 @default.
• W2024722013 hasConcept C121050878 @default.
• W2024722013 hasConcept C150194340 @default.
• W2024722013 hasConcept C181199279 @default.
• W2024722013 hasConcept C185592680 @default.
• W2024722013 hasConcept C19924922 @default.
• W2024722013 hasConcept C199360897 @default.
• W2024722013 hasConcept C2776392439 @default.
• W2024722013 hasConcept C2777762822 @default.
• W2024722013 hasConcept C2779884254 @default.
• W2024722013 hasConcept C33923547 @default.
• W2024722013 hasConcept C41008148 @default.
• W2024722013 hasConcept C55493867 @default.
• W2024722013 hasConcept C86803240 @default.
• W2024722013 hasConceptScore W2024722013C104317684 @default.
• W2024722013 hasConceptScore W2024722013C105795698 @default.
• W2024722013 hasConceptScore W2024722013C121050878 @default.
• W2024722013 hasConceptScore W2024722013C150194340 @default.
• W2024722013 hasConceptScore W2024722013C181199279 @default.
• W2024722013 hasConceptScore W2024722013C185592680 @default.
• W2024722013 hasConceptScore W2024722013C19924922 @default.
• W2024722013 hasConceptScore W2024722013C199360897 @default.
• W2024722013 hasConceptScore W2024722013C2776392439 @default.
• W2024722013 hasConceptScore W2024722013C2777762822 @default.
• W2024722013 hasConceptScore W2024722013C2779884254 @default.
• W2024722013 hasConceptScore W2024722013C33923547 @default.
• W2024722013 hasConceptScore W2024722013C41008148 @default.
• W2024722013 hasConceptScore W2024722013C55493867 @default.
• W2024722013 hasConceptScore W2024722013C86803240 @default.
• W2024722013 hasIssue "15" @default.
• W2024722013 hasLocation W20247220131 @default.
• W2024722013 hasOpenAccess W2024722013 @default.
• W2024722013 hasPrimaryLocation W20247220131 @default.
• W2024722013 hasRelatedWork W1523026250 @default.
• W2024722013 hasRelatedWork W1543300912 @default.
• W2024722013 hasRelatedWork W1643469489 @default.
• W2024722013 hasRelatedWork W1991887201 @default.
• W2024722013 hasRelatedWork W2008557803 @default.
• W2024722013 hasRelatedWork W2022324712 @default.
• W2024722013 hasRelatedWork W2352038341 @default.
• W2024722013 hasRelatedWork W2414702703 @default.
• W2024722013 hasRelatedWork W2889246275 @default.
• W2024722013 hasRelatedWork W3105369823 @default.
• W2024722013 hasVolume "270" @default.
• W2024722013 isParatext "false" @default.
• W2024722013 isRetracted "false" @default.
• W2024722013 magId "2024722013" @default.
• W2024722013 workType "article" @default.