FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2024879932> ?p ?o ?g. }

• W2024879932 endingPage "3914" @default.
• W2024879932 startingPage "3909" @default.
• W2024879932 abstract "We have isolated a full-length murine clone corresponding to the rat neuronal p1A75 partial cDNA (Sutcliffe, J. G., Milner, R. J., Shinnick, T. M., and Bloom, F. E. (1983) Cell 33, 671–682). It encodes a 185-residue polypeptide that displays 56% identity with p19, a protein selectively expressed in the Golgi apparatus of neural cells (Sabéran-Djoneidi, D., Marey-Semper, I., Picart, R., Studler, J.-M., Tougard, C., Glowinski, J., and Lévi-Strauss, M. (1995)J. Biol. Chem. 270, 1888–1893). An antibody directed against the recombinant polypeptide allowed us to demonstrate the existence of the natural 21-kDa protein (p21) in brain and its prominent juxtanuclear Golgi-like localization in cultured neurons. Ultrastructural observation of cultured neurons and analysis of transfected COS cells revealed a specific labeling of the Golgi apparatus, suggesting, as for p19, the presence of a Golgi targeting signal in its primary sequence. Surprisingly, p21, which is much more strongly expressed in the olfactory epithelium than p19, is also present in the Golgi complex of spermatocytes and in the flagellar middle piece of late spermatids. We have isolated a full-length murine clone corresponding to the rat neuronal p1A75 partial cDNA (Sutcliffe, J. G., Milner, R. J., Shinnick, T. M., and Bloom, F. E. (1983) Cell 33, 671–682). It encodes a 185-residue polypeptide that displays 56% identity with p19, a protein selectively expressed in the Golgi apparatus of neural cells (Sabéran-Djoneidi, D., Marey-Semper, I., Picart, R., Studler, J.-M., Tougard, C., Glowinski, J., and Lévi-Strauss, M. (1995)J. Biol. Chem. 270, 1888–1893). An antibody directed against the recombinant polypeptide allowed us to demonstrate the existence of the natural 21-kDa protein (p21) in brain and its prominent juxtanuclear Golgi-like localization in cultured neurons. Ultrastructural observation of cultured neurons and analysis of transfected COS cells revealed a specific labeling of the Golgi apparatus, suggesting, as for p19, the presence of a Golgi targeting signal in its primary sequence. Surprisingly, p21, which is much more strongly expressed in the olfactory epithelium than p19, is also present in the Golgi complex of spermatocytes and in the flagellar middle piece of late spermatids. We have previously described a 19-kDa murine protein (p19) selectively expressed in the Golgi apparatus of neural and neuroendocrine cells whose human corresponding gene has been localized in 5q35 (1Sabéran-Djoneidi D. Marey-Semper I. Picart R. Studler J.-M. Tougard C. Glowinski J. Lévi-Strauss M. J. Biol. Chem. 1995; 270: 1888-1893Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar, 2Diriong S. Sabéran-Djoneidi D. Lévi-Strauss M. Bernheim A. Nguyen V.C. Hum. Genet. 1994; 93: 703-706Crossref PubMed Scopus (1) Google Scholar). The primary sequence of p19 showed a 57% similarity with the translation product of an open reading frame of the rat neuronal p1A75 (3Sutcliffe J.G. Milner R.J. Shinnick T.M. Bloom F.E. Cell. 1983; 33: 671-682Abstract Full Text PDF PubMed Scopus (118) Google Scholar) partial cDNA, which was isolated 14 years ago and whose human corresponding gene is localized in 4p16 (4Schuler G.D. et al.Science. 1996; 274: 540-546Crossref PubMed Scopus (919) Google Scholar). Searches in protein data bases for other members of this new family have only revealed that these two proteins share a highly similar short segment with secretogranin III, which is expressed in intracellular vesicles of neural cells (1Sabéran-Djoneidi D. Marey-Semper I. Picart R. Studler J.-M. Tougard C. Glowinski J. Lévi-Strauss M. J. Biol. Chem. 1995; 270: 1888-1893Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar, 5Ottiger H.-P. Battenberg E.F. Tsou A.-P. Bloom F.E. Sutcliffe J.G. J. Neurosci. 1990; 10: 3135-3147Crossref PubMed Google Scholar). The co-localization, in two paralogous chromosomal regions (5q35 and 4p16), of the human p19 and p1A75 genes with other couples of homologous genes such as, for instance, the D1 and D5 dopamine receptors and the FGFR3 and FGFR4 fibroblast growth factor receptors suggested that these genes originated from the same large gene duplication event, which is thought to be the remnant of an ancient round of tetraploidization (6Lundin L.G. Genomics. 1993; 16: 1-19Crossref PubMed Scopus (405) Google Scholar). To characterize this new protein family and to study the functional consequences of a well defined large duplication event, we undertook the thorough analysis of the protein encoded by the p1A75 cDNA. This encoded protein is a 21-kDa protein (p21) that is expressed, like p19, in the Golgi apparatus of neural and neuroendocrine cells. However, unlike p19, which is absent from the testis and faintly expressed in the olfactory epithelium, p21 is very strongly expressed in the olfactory epithelium and in male germ cells. Total cellular RNA was extracted from fresh tissue or cells by the guanidium thiocyanate/phenol chloroform extraction method (7Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (62897) Google Scholar). Timed pregnant OFA rats (Iffa-Credo) provided a source of fetal and neonatal brains of precise gestational or postnatal ages. Other brain structures or non-neural tissues were dissected from adult Sprague-Dawley (Charles River) male rats. Dissociated neurons from cerebral hemispheres of embryonic day 17 rat embryos were plated at high density (6 × 104/cm2) according to Di Porzio et al. (8Di Porzio U. Daguet M.C. Glowinski J. Prochiantz A. Nature. 1980; 288: 370-373Crossref PubMed Scopus (249) Google Scholar) and cultured for 2–4 days; astrocyte cultures were prepared from the same cerebral areas as described by Denis-Donini et al. (9Denis-Donini S. Glowinski J. Prochiantz A. Nature. 1984; 307: 641-643Crossref PubMed Scopus (286) Google Scholar). Total cellular RNA (5 μg/lane) was fractionated on 1.2% agarose gel containing 3.7% (w/v) formaldehyde, using standard procedures (10Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Gels were blotted onto Hybond N (Amersham Corp.) nylon membranes. The 18 and 28 S ribosomal RNAs observed on the filter by UV light were used to check that equal amounts of RNA were loaded on each lane. Hybridization conditions were as follows: 65 °C, 16 h in the presence of 2 106 cpm/ml of probe in the 5× SSC, 5× Denhardt's solution, 50 mm sodium phosphate, pH 6.5, and 0.4% SDS. Final washes were done in 0.2 × SSC and 0.1% SDS at 65 °C. Whole heads from 3-day-old Sprague-Dawley rats were sectioned on a cryostat, and the sections (10–20 μm thick) were thaw-mounted on silanized glass slides, fixed with 4% paraformaldehyde, dehydrated, and stocked at −20 °C until use. Frozen sections were thawed, fixed with paraformaldehyde, permeabilized with Pronase, and again fixed with paraformaldehyde. Prehybridization and hybridization were performed at 42 °C using an oligodeoxynucleotide (CTCTGCAGCTTCGGTCTCCTGTTCCGACAGCTTCTCTTCTGA) labeled with [α-33P]dATP and terminal transferase according to Burgaya et al. (12Burgaya F. Menegon A. Menegoz M. Valtorta F. Girault J.-A. Eur. J. Neurosci. 1995; 7: 1810-1821Crossref PubMed Scopus (76) Google Scholar). Control experiments were performed in the presence of a 10-fold excess of unlabeled probe. Finally, sections were dehydrated and exposed to β-Max films (Amersham) for 1–3 weeks. The cDNA library was constructed in λgt10, as described previously (13Studler J.-M. Glowinski J. Lévi-Strauss M. Eur. J. Neurosci. 1993; 5: 614-623Crossref PubMed Scopus (55) Google Scholar), from poly(A)+ RNA prepared from cerebral hemispheres of newborn BALB/c mice. A p21 cDNA probe was amplified by nested RT-PCR from rat brain cDNA using the four following primers designed using the published p1A75 sequence (3Sutcliffe J.G. Milner R.J. Shinnick T.M. Bloom F.E. Cell. 1983; 33: 671-682Abstract Full Text PDF PubMed Scopus (118) Google Scholar): first PCR, AATCACTACAACCTGGCCAA and GGCTTTCTTCCTATCTAGCA; second PCR, ATCACGCGCTCAGTGTCA and ATCCTCGTGTTCTGCGCA. This cDNA, labeled by random priming (11Feinberg A.P. Vogelstein B. Anal. Biochem. 1983; 132: 6-13Crossref PubMed Scopus (16562) Google Scholar), was used as a probe to screen 2 × 105 cDNA clones. Among 104 positive clones, 15 were analyzed by Southern blot, and the insert of the largest one was subcloned in the pBluescript plasmid vector. Both strands of this cDNA (pBS64) were sequenced using the dideoxynucleotide chain termination technique (14Sanger F. Nicklen S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Crossref PubMed Scopus (52240) Google Scholar) and the modified T7 polymerase (15Tabor S. Richardson C.C. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 4767-4771Crossref PubMed Scopus (1677) Google Scholar) using internal primers. The plasmid containing the p21 cDNA was amplified with Taq DNA polymerase (16Saiki R.K. Scharf S. Faloona F. Mullis K.B. Horn G.T. Erlich H.A. Arnheim N. Science. 1985; 230: 1350-1354Crossref PubMed Scopus (6654) Google Scholar) using the two following primers: A (5′-TTCGGATCCATGGTGAAGTTGGGGAATTTC-3′) and B (5′-TAAGGATCCTGCCCGCTTGCTA-3′). These primers were designed to addBamHI restriction sites on both extremities of the p21 coding sequence. The amplified DNA fragment was restricted usingBamHI endonuclease and cloned in the BamHI site of the pQE-30 (Qiagen) expression vector, which produces a recombinant protein with a His6 tag on the N terminus. The construction was sequenced to verify the absence of mutations, and the synthesis of the recombinant protein was demonstrated by immunoblot using an antibody directed against a synthetic peptide (HYNLAKQSITRSVSPWMS) that corresponded to residues 149–166 of p21 and whose sequence was deduced from the rat cDNA (3Sutcliffe J.G. Milner R.J. Shinnick T.M. Bloom F.E. Cell. 1983; 33: 671-682Abstract Full Text PDF PubMed Scopus (118) Google Scholar). The recombinant p21 protein was produced and purified using nickel-chelate affinity chromatography (17Hochuli E. Döbeli H. Schacher A. J. Chromatogr. 1987; 411: 177-184Crossref PubMed Scopus (970) Google Scholar) in denaturing conditions according to the protocols provided by Qiagen. The recombinant protein (0.5 mg) solubilized in 8 m urea was loaded onto a 14% preparative SDS-polyacrylamide gel electrophoresis. The gel was stained in 0.25 m KCl, and the band corresponding to the p21 protein was cut and washed in phosphate-buffered saline. New Zealand White rabbits were immunized three times subcutaneously with a piece of gel containing approximately 100 μg of protein. Subcellular fractions were prepared from rat postnatal day 1 brain according to Huttner et al. (18Huttner W.B. Schiebler W. Greengard P. de Camilli P. J. Cell Biol. 1983; 96: 1374-1388Crossref PubMed Scopus (879) Google Scholar). Briefly, neonatal rat brains were homogenized in buffered sucrose (320 mm sucrose, 4 mm Hepes, pH 7.4) using a glass-Teflon homogenizer. This homogenate was centrifuged for 10 min at 800 × g; the pellet was discarded, and the supernatant was centrifuged for 15 min at 10,200 × g to yield a pellet (P2) and a supernatant (S2). The S2 fraction was then centrifuged for 1 h at 165,000 × g to yield a pellet (P3) fraction and a cytosolic fraction (S3). Equivalent fractions of each preparation, corresponding to 100 μg of homogenate, were run on a 14% SDS-polyacrylamide gel electrophoresis and blotted onto polyvinylidene difluoride membranes (Bio-Rad) (19Towbin H. Gordon J. J. Immunol. Methods. 1984; 72: 313-340Crossref PubMed Scopus (790) Google Scholar). Carbonate extractability was tested on the P2 fraction as described previously (20Fujiki Y. Hubbard A.L. Fowler S. Lazarow P.B. J. Cell. Biol. 1982; 93: 97-102Crossref PubMed Scopus (1372) Google Scholar). Briefly, pellets were resuspended in a large volume of ice-cold 100 mm Na2CO3 buffer, pH 11.5 (or phosphate-buffered saline for the control experiment), incubated for 1 h on ice, and centrifuged for 1 h at 200,000 ×g. After saturation with 5% nonfat dry milk and 0.05% Tween 20, membranes were incubated with a 1:10,000 dilution of the rabbit serum followed by a goat anti-rabbit IgG coupled to peroxidase. Enzymatic activity was revealed using a chemiluminescence detection kit (Amersham). Dissociated neurons from cerebral hemispheres of embryonic day 17 rat embryos were plated in 35-mm culture dishes at high density (6 × 104/cm2) in serum-free medium according to Di Porzio et al. (8Di Porzio U. Daguet M.C. Glowinski J. Prochiantz A. Nature. 1980; 288: 370-373Crossref PubMed Scopus (249) Google Scholar) and cultured for 8 days. Neurons were seeded on glass coverslips and fixed with periodate/lysine/paraformaldehyde (21McLean I.W. Nakane P.K. J. Histochem. Cytochem. 1974; 22: 1077-1083Crossref PubMed Scopus (3172) Google Scholar) for 2 h at room temperature, permeabilized with 0.005% saponin, and immunocytochemically stained using the rabbit anti p21 antiserum or preimmune serum diluted 1:500 and then goat immunoglobulins (IgG) against rabbit IgG labeled with tetramethylrhodamine (Biosys, Compiègne, France). For transient transfection experiments, theBamHI-BamHI restriction fragment used for prokaryotic expression in the vector pQE-30 (see above) was excised and inserted in the pcDNA3 eukaryotic expression vector (Invitrogen). Transfections of COS-7 cells with this construction were performed on polyornithine-treated glass coverslips using the DOTAP (Boehringer Mannheim) protocol and reagents. 48 h after transfection, cells were fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton X-100, and stained with anti-p21 antiserum followed by goat anti-rabbit IgG labeled with fluorescein (Biosys). Immunocytochemistry was performed on mouse testis prints and isolated germ cells obtained by seminiferous tubule dilaceration. Prints and cells were fixed for 15 min with 1% formaldehyde in phosphate-buffered saline containing 3% sucrose, treated for 5 min with Triton X-100, and incubated for 1 h in 5% fat milk in phosphate-buffered saline. Cell preparations were incubated for 40 min with preimmune serum or anti-p21 antiserum diluted 1:750 and immunolabeled using biotinylated donkey anti-rabbit immunoglobulins and streptavidin-biotinylated horseradish peroxidase complexes (Amersham). Enzymatic activity was revealed using aminoethyl carbazole as a chromogen, and the cell preparations were counterstained with Harris hematoxylin and mounted in aqueous medium (Glycergel, Dakopatts). Stages of mouse spermatogenesis were identified according to Russellet al. (22Russell L.D. Ettlin R.A. Sinha Hikim A.P. Clegg E.D. Histological and Histopathological Evaluation of the Testis. Cache River Press, Clearwater, FL1990: 120-161Google Scholar). The immunoperoxidase procedure was performed on dissociated neurons using a preembedding approach, in situ in the Petri dishes, as described previously (23Tougard C. Picart R. Am. J. Anat. 1986; 175: 161-177Crossref PubMed Scopus (24) Google Scholar). Briefly, cells were fixed with periodate/lysine/paraformaldehyde (as described above) and permeabilized with 0.005% saponin before incubation with the rabbit anti-p21 antiserum and then with sheep IgG against rabbit IgG labeled with peroxidase (Institut Pasteur, Paris). After postfixation in 1% glutaraldehyde, detection of peroxidase activity, and postfixation in 1% osmium tetroxide, cells were embedded in situ in Epon according to Brinkley et al. (24Brinkley B.R. Murphy P. Richardson L.C. J. Cell Biol. 1967; 35: 279-283Crossref PubMed Scopus (236) Google Scholar). After observation at the light microscopic level, selected areas of immunoreactive cells were sectioned, and ultrathin sections were examined under the electron microscope without further staining. Since the previously described, 1126-base pair-long p1A75 cDNA (3Sutcliffe J.G. Milner R.J. Shinnick T.M. Bloom F.E. Cell. 1983; 33: 671-682Abstract Full Text PDF PubMed Scopus (118) Google Scholar) is shorter than the 1700-base-long mRNA on which it hybridizes on a Northern blot (3Sutcliffe J.G. Milner R.J. Shinnick T.M. Bloom F.E. Cell. 1983; 33: 671-682Abstract Full Text PDF PubMed Scopus (118) Google Scholar), we decided to isolate a full-length cDNA. To this end, our newborn mouse (BALB/c) brain cDNA library (13Studler J.-M. Glowinski J. Lévi-Strauss M. Eur. J. Neurosci. 1993; 5: 614-623Crossref PubMed Scopus (55) Google Scholar) constructed in the λgt10 phage vector was screened with a probe synthesized by nested reverse transcription-polymerase chain reaction from rat brain cDNA and corresponding to nucleotides 136–881 of the p1A75 cDNA (3Sutcliffe J.G. Milner R.J. Shinnick T.M. Bloom F.E. Cell. 1983; 33: 671-682Abstract Full Text PDF PubMed Scopus (118) Google Scholar). Among 15 positive clones analyzed by Southern blot, the clone pBS64 had the largest cDNA insert. Its length (2083 bases without the poly(A) tract) corresponded to our estimation of the size of the rat mRNA whose migration was slightly faster than that of the 18 S rRNA (see below). The cDNA terminates by a poly(A) tract preceded by a typical polyadenylation signal (AATAAA) at position 2062 (Fig.1 A). The longest open reading frame encodes a polypeptide of 185 residues with a predicted molecular mass of 21 kDa. This open reading frame is initiated by the first ATG (position 53) surrounded by a sequence matching very well the proposed consensus for the initiation of translation (25Kozak M. Nucleic Acids Res. 1984; 12: 857-872Crossref PubMed Scopus (2376) Google Scholar) (consensus, CC(A/G)CCATGG; p21cDNA, CAACCATGG). Comparison of the complete sequence of this polypeptide with that of p19 (1Sabéran-Djoneidi D. Marey-Semper I. Picart R. Studler J.-M. Tougard C. Glowinski J. Lévi-Strauss M. J. Biol. Chem. 1995; 270: 1888-1893Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar) confirmed their highly significant similarity (Fig.1 B). If one excepts an insertion of 12 residues in p21 (residues 74–85) (16 for p19 and 19 for p21), these two polypeptides display 56% identity (96 of 171 identical residues) (Fig. 1 B). Study of hydropathy of this polypeptide by the method of Kyte and Doolittle (26Kyte J. Doolittle R.F. J. Mol. Biol. 1982; 157: 105-132Crossref PubMed Scopus (16890) Google Scholar) indicated that it is moderately hydrophilic with the exception of two adjoining stretches, being, respectively, strongly hydrophilic (residues 47–68) or hydrophobic (residues 83–103) (Fig.2). The N terminus of the polypeptide does not fit the outline proposed for signal sequences (27von Heijne G. Nucleic Acids Res. 1986; 14: 4683-4690Crossref PubMed Scopus (3684) Google Scholar). The p21 mRNA was further characterized by Northern blot analysis (Fig.3, A and B) and in situ hybridization (Fig.4). The p21 cDNA probe recognized an apparently unique mRNA with a migration rate slightly faster than the 18 S ribosomal RNA (Fig. 3 A). Its pattern of hybridization to RNAs from a variety of rat tissues revealed an absence of expression in liver, spleen, kidney, and heart and a strong but variable signal in all brain and spinal cord samples tested (Fig.3 A). The p21 mRNA was also strongly expressed in the pituitary, in a crude preparation of the olfactory epithelium, and, to a lesser extent, in the adrenal gland and in the testis (Fig.3 A). Comparison of the p21 hybridization signal in RNA samples extracted from cultured astrocytes or neurons suggested a neuronal origin for this RNA, which was absent from the astrocyte culture (Fig. 3 A). As shown in Fig. 3 B, the p21 mRNA was present as early as embryonic day 14 in cerebral hemispheres, where its expression increased during embryogenesis. The maximal abundance of this mRNA was found around embryonic day 20, and its expression faded afterward to reach adult levels at P15 (Fig.3 B).Figure 4In situ hybridization to p21 mRNA. Horizontal section of a 3-day-old rat head. Note the labeling of the olfactory epithelium and of the retinas.View Large Image Figure ViewerDownload (PPT) Since the olfactory epithelium RNA sample was extracted from a crude homogenate of the inside of nasal cavities, attempts were made to further demonstrate that the marked p21 mRNA expression occurred indeed in the epithelium. We therefore performed an in situhybridization experiment on a postnatal day 3 horizontal section of a rat head. As expected, an intense labeling was observed in the olfactory epithelium (Fig. 4). Moreover, the brain area and the retinas were clearly labeled. Western blot analysis of p21 expression using rabbit antiserum raised against recombinant p21 showed the existence of a single band in the brain of the postnatal day 1 rat (Fig. 5 A). The migration level (21 kDa) of the corresponding protein corresponded exactly to the calculated molecular mass of p21. p21 was absent from the soluble cytosolic fraction and was found at comparable levels in the postnuclear pellet (P2) and the supernatant (S2), in which it was fully associated with the pellet (P3) obtained after ultracentrifugation (Fig. 5 A). A carbonate treatment, which allows discrimination between integral and peripheral membrane proteins (26Kyte J. Doolittle R.F. J. Mol. Biol. 1982; 157: 105-132Crossref PubMed Scopus (16890) Google Scholar), was also performed on the P2 fraction (Fig. 5 B). Fig.5 B shows that p21 is not released from the P2 fraction following carbonate treatment. Control experiments, performed with an anti-synapsin antibody indicated that this peripheral protein is, as expected, completely extracted from the P2 pellet by the carbonate treatment (Fig. 5 B). In primary neuronal cultures from the embryonic striatum and cerebral cortex, the anti p21 antiserum labeled a prominent juxtanuclear Golgi-like area in the majority of neurons (Fig. 6). In contrast, the few contaminating glial cells were devoid of immunolabeling (not shown). Analysis of the same preparation by immunoelectron microscopy showed a specific labeling of all the saccules and of some vesicles in the Golgi zone (Fig.7 A). The perinuclear cistern was also labeled (Fig. 7 C) as well as some dispersed small vacuolar structures and multivesicular bodies in the cell body or in neurites (Fig. 7 B).Figure 7Ultrastructural localization of p21 in cultured neurons. A, the stack of Golgi saccules is labeled as well as a small vesicle (arrowhead) in the Golgi zone (G). B, two labeled multivesicular bodies.C, a conspicuous labeling of the perinuclear cisterna.Bars, 0.5 μm.View Large Image Figure ViewerDownload (PPT) An immunocytochemical analysis of testis prints and isolated germ cells was performed to identify, within this highly heterogenous tissue, the p21-expressing cell type. Fig.8 A shows a labeling of the Golgi complex of primary spermatocytes as early as the pachytene stage. The Golgi complex was found to be stained at all the subsequent stages of meiosis (data not shown). In mature spermatids, both the whole acrosomal region and the flagellar middle piece were labeled (Fig.8 C). At this latter level, the staining was localized in the flagellar layer surrounding the axial structures (i.e.axoneme and dense fibers) with a periodical transversal pattern related to the mitochondrial sheath. No staining of the spermatocytes and spermatids was observed with the preimmune serum at the same dilution (Fig. 8, B and D). Immunocytochemical analysis of transfected COS cells expressing the p21 cDNA revealed a conspicuous immunolabeling of a juxtanuclear zone (Fig. 9). No specific immunoreactivity was detected in wild-type COS cells (data not shown). In this study, we have characterized the product of the p1A75 cDNA (3Sutcliffe J.G. Milner R.J. Shinnick T.M. Bloom F.E. Cell. 1983; 33: 671-682Abstract Full Text PDF PubMed Scopus (118) Google Scholar), which belongs to the same new family as the p19 protein (1Sabéran-Djoneidi D. Marey-Semper I. Picart R. Studler J.-M. Tougard C. Glowinski J. Lévi-Strauss M. J. Biol. Chem. 1995; 270: 1888-1893Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). This 21-kDa protein (p21) is, like p19, expressed in the Golgi apparatus of neural cells. However, in contrast to p19, which is absent from the testis and faintly expressed in the olfactory epithelium, p21 is very strongly expressed in the olfactory epithelium and in male gametes at the late stages of their differentiation. The similarity (56% identity) of the primary sequences of murine p19 and p21 indicates that these proteins belong to the same family. The main differences between these two proteins consist in the presence of a 12-amino acid-long insertion (TEGVTERFKVSV) in the p21 sequence and in a complete divergence of their 15 most carboxyl-terminal residues. Searches in data banks for related sequences yielded a wealth of overlapping human expressed sequence tags that exhibit a very high similarity level with either of the two murine sequences. These overlapping expressed sequence tags allowed the reconstruction of the primary sequence of human p19 and p21 (data not shown). The very high similarity of the murine and human p19 and p21 sequences (respectively, 95 and 98% identity for p19 and p21) suggests that these proteins are submitted to a strong selection pressure. In addition to these expressed sequence tags, searches in protein data bases revealed that the highly similar short segment that is shared by p19, p21, and secretogranin III (5Ottiger H.-P. Battenberg E.F. Tsou A.-P. Bloom F.E. Sutcliffe J.G. J. Neurosci. 1990; 10: 3135-3147Crossref PubMed Google Scholar) is also found in a subset of highly related members of the yeast ABC protein family (28Decottignies A. Goffeau A. Nat. Genet. 1997; 15: 137-145Crossref PubMed Scopus (387) Google Scholar) (Fig.10). Western blot experiments performed with an antiserum made against the recombinant protein indicated the existence of a single band in the brain of the postnatal day 1 rat whose migration rate (21 kDa) corresponded to the calculated molecular mass of p21 (Fig.5 A). This molecular mass differs from the one (25 or 28 kDa) determined by Sutcliffe et al. (3Sutcliffe J.G. Milner R.J. Shinnick T.M. Bloom F.E. Cell. 1983; 33: 671-682Abstract Full Text PDF PubMed Scopus (118) Google Scholar) for the same polypeptide using hybridization translation or immunoprecipitation experiments, respectively. This difference is probably due to a lack of accuracy in the determination of the molecular mass rather than to the recognition of another protein by the antipeptide antiserum used by these authors. Indeed, the organelle-like pattern observed in their immunocytochemistry experiments corresponds very well to the Golgi apparatus localization of p21 (3Sutcliffe J.G. Milner R.J. Shinnick T.M. Bloom F.E. Cell. 1983; 33: 671-682Abstract Full Text PDF PubMed Scopus (118) Google Scholar). This subcellular localization of p21 is closely similar to that of p19. Indeed, similar patterns of localization were found for these two proteins using either immunoelectron microscopy or immunofluorescence analysis. The Golgi-like localization of transfected p21 in COS cells (Fig. 9) indicated that, like p19 (1Sabéran-Djoneidi D. Marey-Semper I. Picart R. Studler J.-M. Tougard C. Glowinski J. Lévi-Strauss M. J. Biol. Chem. 1995; 270: 1888-1893Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar), its primary sequence contains a Golgi targeting signal. Moreover, the presence, in p21 and p19, of a highly hydrophobic segment and their carbonate-resistant membrane association indicated that they are both integral membrane proteins. The absence of a signal peptide in the p21 sequence suggests that, like p19, this protein could be inserted in the membrane by a C-terminal anchor (1Sabéran-Djoneidi D. Marey-Semper I. Picart R. Studler J.-M. Tougard C. Glowinski J. Lévi-Strauss M. J. Biol. Chem. 1995; 270: 1888-1893Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar,29Kutay U. Hartmann E. Rapoport T.A. Trends Cell Biol. 1993; 3: 72-75Abstract Full Text PDF PubMed Scopus (262) Google Scholar). The main difference between p19 and p21 seems to reside in their tissular pattern of expression. p21 mRNA is indeed prominently produced in the olfactory epithelium and to a lesser extent in testis, two tissues in which p19 expression is, respectively, weak and undetectable (1Sabéran-Djoneidi D. Marey-Semper I. Picart R. Studler J.-M. Tougard C. Glowinski J. Lévi-Strauss M. J. Biol. Chem. 1995; 270: 1888-1893Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). The high expression of p21 in cultured neurons and in neural and neuroendocrine tissues, on the one hand, and its absence from all other organs except testis, on the other hand, strongly suggest a neuronal localization of p21 within the olfactory epithelium. Very likely, the extremely high hybridization signal observed for p21 mRNA in Northern blot analysis (Fig. 3 A) of a crude olfactory epithelium preparation (which also contains supporting tissues) probably underestimates the real concentration of p21 mRNA in the epithelium. Immunohistochemistry experiments (Fig. 8) indicated that, within the testis, p21 is expressed, as expected, in the Golgi complex of primary spermatocytes and in the acrosomal region of mature spermatids. More surprisingly, p21 is also expressed in the flagellar middle piece of late spermatids, which contains the mitochondrial sheath. This surprising localization of a protein in olfactory neurons and in germinal cells of the testis, two apparently unrelated cell types, has already been described in the case of a subset of odorant receptors and their transducing proteins (30Parmentier M. Libert F. Schurmans S. Schiffmann S. Lefort A. Eggerickx D. Ledent C. Mollereau C. Gérard C. Perret J. Grootegoed A. Vassort G. Nature. 1992; 355: 453-455Crossref PubMed Scopus (327) Google Scholar, 31Vanderhaeghen P. Schurmans S. Vassart G. Parmentier M. J. Cell Biol. 1993; 123: 1441-1452Crossref PubMed Scopus (155) Google Scholar, 32Walensky L.D. Roskams A.J. Lefkowitz R.J. Snyder S.H. Ronnett G.V. Mol. Med. 1995; 1: 130-141Crossref PubMed Google Scholar). These proteins, which are mainly located in the flagellar middle piece of sperm cells, could be responsible for the marked augmentation of the respiratory activity that is associated with chemotaxis (32Walensky L.D. Roskams A.J. Lefkowitz R.J. Snyder S.H. Ronnett G.V. Mol. Med. 1995; 1: 130-141Crossref PubMed Google Scholar). The localization of p21 in the tail middle piece of sperm cells suggests that this protein could also be involved in this process, reinforcing therefore the hypothesis of a resemblance, at the molecular level, between olfaction and germ cell chemotaxis. In addition, the presence of p21 in the acrosomal region, which originates from Golgi vesicles, can also be related to sperm chemoattraction. Cohen-Dayag et al. (33Cohen-Dayag A. Tur-Kaspa I. Dor J. Mashiach S. Eisenbach M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11039-11043Crossref PubMed Scopus (183) Google Scholar) have indeed shown that the potential to undergo the acrosome reaction (sperm capacitation) is correlated with sperm chemotactic activity. Future studies will be necessary to investigate the role of p21 in olfactory neurons and in sperm cells. In addition to their interest for the biology of these two cell types, these studies should also help to understand the functional consequences of a large gene duplication event, which, in addition to p19 and p21, gave rise to numerous other couples of genes located, in the human genome, on the telomeric ends of the long arms of chromosomes 4 and 5 (6Lundin L.G. Genomics. 1993; 16: 1-19Crossref PubMed Scopus (405) Google Scholar). Interestingly, as seems to be the case for p19 and p21, the other couples of genes suspected to originate from this large gene duplication event differ mostly by their tissular pattern of expression. For instance, the dopamine receptors D1 and D5 (34Sunahara R.K. Guan H.-C. O'Dowd B.F. Seeman P. Laurier L.G. Ng G. George S.R. Torchia J. Van Tol H.H.M. Niznik H.B. Nature. 1991; 350: 614-619Crossref PubMed Scopus (919) Google Scholar) and the fibroblast growth factor receptors FGFR4 and FGFR3 (35Givol D. Yayon A. FASEB J. 1992; 6: 3362-3369Crossref PubMed Scopus (398) Google Scholar), which exhibit 50–60% similarity within each couple and whose genes are located in 5q35 (D1 and FGFR4) and 4p16 (D5 and FGFR3), have retained similar binding specificities and transducing activities but differ by their expression pattern. We are grateful to Dr. Ferran Burgaya for help with the in situ hybridization experiments, to Françoise Arnos for technical assistance, and to Eric Etienne for the microscopy pictures." @default.
• W2024879932 created "2016-06-24" @default.
• W2024879932 creator A5002704963 @default.
• W2024879932 creator A5005549596 @default.
• W2024879932 creator A5016142788 @default.
• W2024879932 creator A5045902442 @default.
• W2024879932 creator A5065027110 @default.
• W2024879932 creator A5065773508 @default.
• W2024879932 creator A5068689393 @default.
• W2024879932 creator A5089130452 @default.
• W2024879932 date "1998-02-01" @default.
• W2024879932 modified "2023-09-27" @default.
• W2024879932 title "A 21-kDa Polypeptide Belonging to a New Family of Proteins Is Expressed in the Golgi Apparatus of Neural and Germ Cells" @default.
• W2024879932 cites W1559391131 @default.
• W2024879932 cites W1687425191 @default.
• W2024879932 cites W1944551911 @default.
• W2024879932 cites W1975304761 @default.
• W2024879932 cites W1979282423 @default.
• W2024879932 cites W1993185022 @default.
• W2024879932 cites W1996563400 @default.
• W2024879932 cites W2000250937 @default.
• W2024879932 cites W2006178968 @default.
• W2024879932 cites W2007472184 @default.
• W2024879932 cites W2008780831 @default.
• W2024879932 cites W2008951867 @default.
• W2024879932 cites W2009105413 @default.
• W2024879932 cites W2014669590 @default.
• W2024879932 cites W2017549779 @default.
• W2024879932 cites W2039102874 @default.
• W2024879932 cites W2046157585 @default.
• W2024879932 cites W2047043554 @default.
• W2024879932 cites W2049896656 @default.
• W2024879932 cites W2050717506 @default.
• W2024879932 cites W2061792951 @default.
• W2024879932 cites W2070543174 @default.
• W2024879932 cites W2074363005 @default.
• W2024879932 cites W2076636373 @default.
• W2024879932 cites W2138270253 @default.
• W2024879932 cites W2138879032 @default.
• W2024879932 cites W2148560401 @default.
• W2024879932 cites W2154158554 @default.
• W2024879932 cites W2156575590 @default.
• W2024879932 cites W2160107586 @default.
• W2024879932 cites W2164620775 @default.
• W2024879932 cites W2167247054 @default.
• W2024879932 cites W2954030 @default.
• W2024879932 cites W4294216491 @default.
• W2024879932 cites W4322384960 @default.
• W2024879932 doi "https://doi.org/10.1074/jbc.273.7.3909" @default.
• W2024879932 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9461575" @default.
• W2024879932 hasPublicationYear "1998" @default.
• W2024879932 type Work @default.
• W2024879932 sameAs 2024879932 @default.
• W2024879932 citedByCount "24" @default.
• W2024879932 countsByYear W20248799322012 @default.
• W2024879932 countsByYear W20248799322014 @default.
• W2024879932 countsByYear W20248799322015 @default.
• W2024879932 countsByYear W20248799322017 @default.
• W2024879932 countsByYear W20248799322021 @default.
• W2024879932 countsByYear W20248799322022 @default.
• W2024879932 crossrefType "journal-article" @default.
• W2024879932 hasAuthorship W2024879932A5002704963 @default.
• W2024879932 hasAuthorship W2024879932A5005549596 @default.
• W2024879932 hasAuthorship W2024879932A5016142788 @default.
• W2024879932 hasAuthorship W2024879932A5045902442 @default.
• W2024879932 hasAuthorship W2024879932A5065027110 @default.
• W2024879932 hasAuthorship W2024879932A5065773508 @default.
• W2024879932 hasAuthorship W2024879932A5068689393 @default.
• W2024879932 hasAuthorship W2024879932A5089130452 @default.
• W2024879932 hasBestOaLocation W20248799321 @default.
• W2024879932 hasConcept C119062480 @default.
• W2024879932 hasConcept C158617107 @default.
• W2024879932 hasConcept C185592680 @default.
• W2024879932 hasConcept C2780258238 @default.
• W2024879932 hasConcept C86803240 @default.
• W2024879932 hasConcept C95444343 @default.
• W2024879932 hasConceptScore W2024879932C119062480 @default.
• W2024879932 hasConceptScore W2024879932C158617107 @default.
• W2024879932 hasConceptScore W2024879932C185592680 @default.
• W2024879932 hasConceptScore W2024879932C2780258238 @default.
• W2024879932 hasConceptScore W2024879932C86803240 @default.
• W2024879932 hasConceptScore W2024879932C95444343 @default.
• W2024879932 hasIssue "7" @default.
• W2024879932 hasLocation W20248799321 @default.
• W2024879932 hasOpenAccess W2024879932 @default.
• W2024879932 hasPrimaryLocation W20248799321 @default.
• W2024879932 hasRelatedWork W2016948813 @default.
• W2024879932 hasRelatedWork W2018933503 @default.
• W2024879932 hasRelatedWork W2070194181 @default.
• W2024879932 hasRelatedWork W2099343588 @default.
• W2024879932 hasRelatedWork W2102163611 @default.
• W2024879932 hasRelatedWork W2342724047 @default.
• W2024879932 hasRelatedWork W3018787070 @default.
• W2024879932 hasRelatedWork W4239345442 @default.
• W2024879932 hasRelatedWork W4312213758 @default.
• W2024879932 hasRelatedWork W4383370858 @default.
• W2024879932 hasVolume "273" @default.
• W2024879932 isParatext "false" @default.

• next