FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2025396554> ?p ?o ?g. }

• W2025396554 endingPage "1569" @default.
• W2025396554 startingPage "1561" @default.
• W2025396554 abstract "Rat 3-mercaptopyruvate sulfurtransferase (MST) contains three exposed cysteines as follows: a catalytic site cysteine, Cys247, in the active site and Cys154 and Cys263 on the surface of MST. The corresponding cysteine to Cys263 is conserved in mammalian MSTs, and Cys154 is a unique cysteine. MST has monomer-dimer equilibrium with the assistance of oxidants and reductants. The monomer to dimer ratio is maintained at ∼92:8 in 0.2 m potassium phosphate buffer containing no reductants under air-saturated conditions; the dimer might be symmetrical via an intersubunit disulfide bond between Cys154 and Cys154 and between Cys263 and Cys263, or asymmetrical via an intersubunit disulfide bond between Cys154 and Cys263. Escherichia coli reduced thioredoxin (Trx) cleaved the intersubunit disulfide bond to activate MST to 2.3- and 4.9-fold the levels of activation of dithiothreitol (DTT)-treated and DTT-untreated MST, respectively. Rat Trx also activated MST. On the other hand, reduced glutathione did not affect MST activity. E. coli C35S Trx, in which Cys35 was replaced with Ser, formed some adducts with MST and activated MST after treatment with DTT. Thus, Cys32 of E. coli Trx reacted with the redox-active cysteines, Cys154 and Cys263, by forming an intersubunit disulfide bond and a sulfenyl Cys247. A consecutively formed disulfide bond between Trx and MST must be cleaved for the activation. E. coli C32S Trx, however, did not activate MST. Reduced Trx turns on a redox switch for the enzymatic activation of MST, which contributes to the maintenance of cellular redox homeostasis. Rat 3-mercaptopyruvate sulfurtransferase (MST) contains three exposed cysteines as follows: a catalytic site cysteine, Cys247, in the active site and Cys154 and Cys263 on the surface of MST. The corresponding cysteine to Cys263 is conserved in mammalian MSTs, and Cys154 is a unique cysteine. MST has monomer-dimer equilibrium with the assistance of oxidants and reductants. The monomer to dimer ratio is maintained at ∼92:8 in 0.2 m potassium phosphate buffer containing no reductants under air-saturated conditions; the dimer might be symmetrical via an intersubunit disulfide bond between Cys154 and Cys154 and between Cys263 and Cys263, or asymmetrical via an intersubunit disulfide bond between Cys154 and Cys263. Escherichia coli reduced thioredoxin (Trx) cleaved the intersubunit disulfide bond to activate MST to 2.3- and 4.9-fold the levels of activation of dithiothreitol (DTT)-treated and DTT-untreated MST, respectively. Rat Trx also activated MST. On the other hand, reduced glutathione did not affect MST activity. E. coli C35S Trx, in which Cys35 was replaced with Ser, formed some adducts with MST and activated MST after treatment with DTT. Thus, Cys32 of E. coli Trx reacted with the redox-active cysteines, Cys154 and Cys263, by forming an intersubunit disulfide bond and a sulfenyl Cys247. A consecutively formed disulfide bond between Trx and MST must be cleaved for the activation. E. coli C32S Trx, however, did not activate MST. Reduced Trx turns on a redox switch for the enzymatic activation of MST, which contributes to the maintenance of cellular redox homeostasis. Redox-active disulfide bonds have an important role in regulating protein function and enzymatic activity. Reduced thioredoxin (Trx) 2The abbreviations used are: Trx, thioredoxin; DTT, dithiothreitol; MST, mercaptopyruvate sulfurtransferase; TRD, thioredoxin reductase; HPLC, high pressure liquid chromatography. cleaves the disulfide bond, “turns on or off a redox switch,” and facilitates protein function or activates an enzyme that results from possible conformational changes (1Clancey C.J. Gilbert H.F. J. Biol. Chem. 1987; 262: 13545-13549Abstract Full Text PDF PubMed Google Scholar, 2Hawkins H.C. Blackburn E.C. Freedman R.B. Biochem. J. 1991; 275: 349-353Crossref PubMed Scopus (96) Google Scholar, 3Sasaki Y. Kozaki A. Hatano M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11096-11101Crossref PubMed Scopus (134) Google Scholar, 4Mora-Garcia S. Rodriguez-Suarez R. Wolosiuk R.A. J. Biol. Chem. 1998; 273: 16273-16280Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, 5Zheng M. Aslund F. Storz G. Science. 1998; 279: 1718-1721Crossref PubMed Scopus (979) Google Scholar, 6Reynolds C.M. Poole L.B. Biochemistry. 2001; 40: 3912-3919Crossref PubMed Scopus (24) Google Scholar, 7Buhrman G. Parker B. Sohn J. Rudolph J. Mattos C. Biochemistry. 2005; 44: 5307-5316Crossref PubMed Scopus (91) Google Scholar, 8Sevier C.S. Kaiser C.A. Mol. Biol. Cell. 2006; 17: 2256-2266Crossref PubMed Scopus (60) Google Scholar). These disulfide bonds are generally “intrasubunit or intramolecular disulfide bonds.” When these cysteines are adjacent, the redox change most effectively turns the redox switch on and off (9Park C. Raines R.T. Protein Eng. 2001; 14: 939-942Crossref PubMed Scopus (44) Google Scholar). As an exceptional case, hetero-oligomer ATP synthase is inhibited via the formation of an intersubunit disulfide bond between the bc′ and γ subunits because of a mechanical standstill of the molecular motor (10Suzuki T. Suzuki J. Mitome N. Ueno H. Yoshida M. J. Biol. Chem. 2000; 275: 37902-37906Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). This redox switch directly regulates enzymatic activity and can therefore be categorized as a direct and mechanical function. In the cases in which protein function is facilitated via a conformational change caused by cleavage of a disulfide bond, the redox switch is categorized as an indirect function. Rat 3-mercaptopyruvate sulfurtransferase (MST) (EC 2.8.1.2) is a 32.8-kDa simple protein enzyme (11Nagahara N. Nishino T. J. Biol. Chem. 1996; 271: 27395-27401Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). MST catalyzes the degradation of cysteine, detoxifies cyanide (12Nagahara N. Ito T. Minami M. Histol. Histopathol. 1999; 14: 1277-1286PubMed Google Scholar), and serves as anti-oxidant protein (13Nagahara N. Katayama A. J. Biol. Chem. 2005; 280: 34569-34576Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar). When oxidative stress builds up in the cells, a sulfur atom of the catalytic site Cys247 donates an electron to the oxidants, and the cysteine is transiently converted to a sulfenate, resulting in the inhibition of MST. Furthermore, as the sulfenate is at a low redox potential, Trx and DTT reduce it to restore its activity, but reduced glutathione does not affect the activity (13Nagahara N. Katayama A. J. Biol. Chem. 2005; 280: 34569-34576Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar). Under oxidizing conditions, the cysteine pool is increased because of post-translational inhibition of methionine synthase (14Taoka S. Ohja S. Shan X. Kruger W.D. Banerjee R. J. Biol. Chem. 1998; 273: 25179-25184Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar, 15Mosharov E. Cranford M.R. Banerjee R. Biochemistry. 2000; 39: 13005-13011Crossref PubMed Scopus (437) Google Scholar) and post-translational activation of cystathione β-synthase (14Taoka S. Ohja S. Shan X. Kruger W.D. Banerjee R. J. Biol. Chem. 1998; 273: 25179-25184Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar, 16Chen Z. Chakraborty S. Shan X. Kruger W.D. Banerjee R. J. Biol. Chem. 1995; 270: 19246-19249Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). Inhibition of MST conserves cysteine and contributes to increase the cysteine pool. An increase in the cysteine content in the cell results in an increase in the content of cellular reductants such as Trx and glutathione. Thus, MST contributes to maintain redox homeostasis. In a preliminary study, Escherichia coli reduced Trx activated rat recombinant MST after treatment with DTT, but DTT did not activate MST after treatment with reduced Trx. These findings suggested that reduced Trx reacted with cysteines other than Cys247. It is also possible that Trx reacted with Cys154 and Cys263 on the surface of MST. MST exhibits monomer-dimer equilibrium (17Nagahara N. Sawada N. Curr. Med. Chem. 2006; 13: 1219-1230Crossref PubMed Scopus (41) Google Scholar). The estimated tertiary structure of rat MST (18Nagahara N. Okazaki T. Nishino T. J. Biol. Chem. 1995; 270: 16230-16235Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar) using QUANTA/CHARMm (Molecular Simulations Inc., Tokyo, Japan), based on the x-ray structure of bovine rhodanese (19Ploegman J.H. Drent G. Kalk K.H. Hol W.J.G. Heinrikson R.L. Keim P. Weng L. Russell J. Nature. 1978; 273: 124-129Crossref PubMed Scopus (215) Google Scholar), suggests that Cys154 and Cys263 in the hydrophobic patch are too far from each other (32 Å) to form an intrasubunit disulfide bond. The dimer is therefore formed via intersubunit disulfide bonds, and reduced Trx would react with the disulfide bond or turn on “a redox switch.” Rat Trx has two redox-active cysteine residues (Cys31 and Cys34) and four structural cysteine residues (Cys45, Cys61, Cys68, and Cys72) (20Wang Y. De Keulenaer G.W. Lee R.T. J. Biol. Chem. 2002; 277: 26496-26500Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar), which are identical to those of human Trx except Cys45 (21Wollman E.E. d'Auriol L. Rimsky L. Shaw A. Jacquot J.P. Wingfield P. Graber P. Dessarps F. Robin P. Galibert F. J. Biol. Chem. 1988; 263: 15506-15512Abstract Full Text PDF PubMed Google Scholar). Cys72 is easily oxidized to form an intermolecular disulfide bond (22Powis G. Montfort W.R. Annu. Rev. Pharmacol. Toxicol. 2001; 41: 261-295Crossref PubMed Scopus (331) Google Scholar) and to undergo glutathionylation (23Casagrande S. Bonetto V. Fratellim M. Gianazza E. Eberini I. Massignan T. Salmona M. Chang G. Holmgren A. Ghezzi P. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9745-9749Crossref PubMed Scopus (305) Google Scholar). Furthermore, they modify the Trx reaction with a target protein, which makes a quantitative analysis of change in the target protein function complicated. On the other hand, exposed cysteines are only two redox-active cysteines (Cys32 and Cys35) in E. coli Trx (24Musso R. Di Lauro R. Rosenberg M. de Crombrugghe B. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 106-110Crossref PubMed Scopus (61) Google Scholar). Thus, E. coli Trx has been used to probe a Trx-dependent modification of mammalian protein function (25Holmgren A. J. Biol. Chem. 1979; 254: 9627-9632Abstract Full Text PDF PubMed Google Scholar, 26Park E.M. Thomas J.A. Arch. Biochem. Biophys. 1989; 272: 25-31Crossref PubMed Scopus (18) Google Scholar, 27Lundstrom J. Holmgren A. J. Biol. Chem. 1990; 265: 9114-9120Abstract Full Text PDF PubMed Google Scholar). In this study, we confirm that E. coli thioredoxin acts on rat MST. The results provide evidence that reduced Trx also regulates MST at the enzyme level via a redox regulation of intersubunit disulfide bonds. Rat wild type, C64S (in which Cys64 is replaced with serine), C154S, C254S, and C263S MST cDNAs were prepared according to a procedure described previously (13Nagahara N. Katayama A. J. Biol. Chem. 2005; 280: 34569-34576Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar). A cDNA coding a mutant MST, C154S/C263S (in which Cys154 and Cys263 are replaced with serine), was synthesized. A C154S MST cDNA inserted into a pET28a vector (Novagen, San Diego) between the NcoI/XhoI sites was used as a template for the mutagenesis. The primers, rC263S-s, GGGGCCTTCCTCTCTGGCAAACCCGATG, and rC263S-A, CATCGGGTTTGCCAGAGAGGAAGGCCCC, were used to replace of Cys263 with serine. The mutagenesis was performed using a QuikChange site-directed mutagenesis kit (Stratagene La Jolla, CA). The parameters for the PCR were as follows: for the first segment, one cycle of denaturation at 95 °C for 30 s; for the second segment, 13 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 1 min, and extension at 68 °C for 8.6 min. The PCR product was digested with DpnI and introduced into Epicurian Coli XL1-Blue using standard protocols except for preculture in Luria Bertani medium without antibiotics at 37 °C for 1 h before plating. Sequencing was performed to select each mutagenized cDNA using the synthesized antisense primer, AGGATGGTTCGGTGTCAC, to examine the replacement of Cys263 with serine. The mutant cDNA sequence was confirmed by DNA sequencing. Each pET28a vector containing cDNA of the wild type or mutant MST was introduced into E. coli, BL21 (DE3) cells transformed with a pSTV vector containing GroEL and GroES cDNAs. Each enzyme was overexpressed and purified according to the methods described previously (11Nagahara N. Nishino T. J. Biol. Chem. 1996; 271: 27395-27401Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). E. coli thioredoxin reductase (TRD), wild type (Trx 1), C32S, and C35S Trx cDNAs, rat wild type, and C34S Trx cDNAs were prepared according to the procedure of Abe et al. 3Y. Abe, T. Matsumura, K. Okamoto, S. Iwahara, H. Hori, Y. Takahashi, and T. Nishino, submitted for publication. These proteins were then overexpressed and purified accordingly. 3Y. Abe, T. Matsumura, K. Okamoto, S. Iwahara, H. Hori, Y. Takahashi, and T. Nishino, submitted for publication. Rat TRD was purchased from Sigma. The Trxs (2 mg) were incubated with 10 mm DTT on ice for 12 h in 100 μl of 20 mm potassium phosphate buffer, pH 7.4. After gel filtration with a Sephadex G-25 column (1 × 20 cm; GE Healthcare), Trx-containing fractions were collected and concentrated with a Microcon YM-3 filter (Millipore, Billerica, MA). Rat redox Trx would be easily oxidized to form a dimer via an intermolecular disulfide bond, after DTT is removed. Thus, the rat Trx, in which redox-active cysteines are reduced, is referred as a rat reduced Trx. In the Trx-TRD-NADPH system, after incubation of 12 μm wild type MST with NADPH (0, 12, 60, 120, and 300 μm), E. coli or rat Trx (0, 12, 24, 48, 60, and 120 μm), and E. coli or rat TRD (0, 12, 1.2, 0.6, 0.24, and 0.12 μm) in 10 μl of 20 mm potassium phosphate buffer, pH 7.4, on ice for 20 min, a 5-μl aliquot of the mixture was used for the rhodanese activity assay. In the E. coli or rat reduced Trx system, after incubation of 12 μm wild type MST with E. coli or rat reduced Trx (0, 12, 24, 48, 60, and 120 μm) in 10 μl of 20 mm potassium phosphate buffer, pH 7.4, on ice for 20 min, a 5-μl aliquot of the mixture was used for the rhodanese activity assay. Additionally the rat reduced Trx system with 1.2 mm DTT was also examined. Time-dependent activation of MST (12 μm) in the E. coli or rat reduced Trx system ([MST]:[reduced Trx] = 5:1) or the Trx-TRD-NADPH system ([MST]:[E. coli Trx]:[E. coli TRD]:[NADPH] = 1:5:0.02:12.5 or [MST]:[rat Trx]:[rat TRD]:[NADPH] = 1:1:0.05: 12.5) was examined in 5 μl of 20 mm potassium phosphate buffer, pH 7.4, on ice for 1, 5, 10, 15, and 20 min, and the mixture was used for the rhodanese activity assay. Furthermore, the rat reduced Trx system with 1.2 mm DTT and the Trx-TRD-NADPH system with 1.2 mm DTT were also examined. To remove an outer sulfur of some persulfurated MST, MST was incubated with a 100-fold molar dose of potassium cyanide (Wako Pure Chemicals, Osaka, Japan) in 20 mm potassium phosphate buffer, pH 7.4, on ice for 40 min, and cyanide was removed using a PD10 column (GE Healthcare). Enzyme-containing fractions were collected and concentrated with a VIVASPIN (10,000 molecular weight cutoff; Sartorius, Goettingen, Germany). In an activation system using DTT, or E. coli or rat reduced Trx, after incubation of wild type MST with a 100-fold molar dose of DTT or a 5-fold molar dose of reduced Trx in 20 mm potassium phosphate buffer, pH 7.4, on ice for 20 min, DTT was removed using a PD10 column, and enzyme-containing fractions were collected and concentrated with a VIVASPIN. When MST was activated in the Trx-TRD-NADPH system, wild type MST was incubated in a mixture ([MST]:[E. coli Trx]:[E. coli TRD]:[NADPH] = 1:5:0.02:12.5 or [MST]:[rat Trx]:[rat TRD]: [NADPH] = 1:1:0.05:12.5) in 20 mm potassium phosphate buffer, pH 7.4, on ice for 20 min. After each single or serially combined MST treatment, rhodanese activity was measured, and the ratio of the specific activity of one experimental result to another was calculated. To investigate the mechanism of MST activation by reduced Trx, kinetic studies of untreated and activated wild type, C64S, C254S, and C154/236S MSTs by reduced Trx were performed. As the double-reciprocal plots of velocity versus potassium cyanide concentration were not linear when rhodanese activities were measured with MSTs (18Nagahara N. Okazaki T. Nishino T. J. Biol. Chem. 1995; 270: 16230-16235Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar), apparent Km and kcat values for thiosulfate were determined with a constant concentration of potassium cyanide at 60 mm. After incubation of 6 μm of mutant MSTs with 0 or 30 μm (5-fold molar dose), reduced Trx in 10 μl of 20 mm potassium phosphate buffer, pH 7.4, on ice for 20 min, rhodanese activity was measured using an assay mixture containing 60 mm potassium cyanide and 20, 30, 40, 50, or 60 mm thiosulfate. For the study of wild type MST, after 6 μm of MST was incubated with 0, 3, 6, 12, or 30 μm reduced Trx or 0.6 mm DTT, rhodanese activity was measured using an assay mixture containing 60 mm potassium cyanide, and 12.5, 20, 30, 40, 50, or 60 mm thiosulfate. For titration of the enzymes under reducing conditions, oxygen in the solvent was removed using a glass apparatus by sequential evacuation and re-equilibration with oxygen-free argon. Oxygen-free argon was prepared by passing commercially obtained pure argon through a column of a Chromatopack Gas-Clean Oxygen Filter CP17970 (Varian, Inc., Palo Alto, CA). After incubation of 300 μm wild type, C154S, C263S, and C153S/C236S MSTs with 5 mm DTT in 30 μl of 20 mm potassium phosphate buffer, pH 7.4, on ice overnight under anaerobic conditions, DTT was removed from each sample with a NAP 5 column before analysis. Each enzyme (20 μm) was incubated with 0.5 mm 5,5′-dithiobis(2-nitrobenzoic acid) in 20 mm potassium phosphate buffer, pH 8.0, at 25 °C for 60 min, and the change in absorbance at 412 nm (ϵ412 = 13,600 m–1) was measured. The ratio of free SH groups of each enzyme under air-saturated conditions to that under reducing conditions was calculated. HPLC Analysis during Trx Activation of MSTs—Wild type, C154S, C263S, and C154S/C263S MSTs (0.3 nmol) were incubated with E. coli reduced wild type, E. coli C32S, or E. coli C35S Trx (1.5 nmol) in 20 μl of 20 mm potassium phosphate buffer, pH 7.0, on ice for 20 min. Untreated and C35S Trx-treated wild type MST were incubated with 1.5 mm DTT in 20 μl of 20 mm potassium phosphate buffer, pH 7.0, on ice for 20 min and 12 h. All samples were analyzed using an HPLC system (PU-2080Plus and UV2075Plus, JUSCO, Tokyo, Japan) equipped with two TSK gel filtration columns (G3000SWXL, 7.8 mm × 30 cm and G2000SWXL, 7.8 mm × 30 cm, TOSOH Corp., Tokyo, Japan), which were connected in series. The mobile phase was composed of 0.2 m potassium phosphate buffer, pH 7.0; the flow rate was 0.5 ml/min, and detection was made at 280 nm. For the calibration curve, a gel filtration standard (Bio-Rad) containing thyroglobulin (670 kDa), bovine gamma globulin (158 kDa), chicken ovalbumin (44 kDa), and equine myoglobin (17 kDa) was used. Trx Attack Mode—After wild type MST (12 μm) was incubated with E. coli reduced C32S Trx (0, 36, 60, or 120 μm) or reduced C35S Trx (0, 36, 60, 120, or 360 μm) in 10 μl of 20 mm potassium phosphate buffer, pH 7.4, on ice for 30 min, a 10-μl aliquot of the mixture was assayed for the rhodanese activity. Another 5-μl aliquot was further incubated with DTT (1.2 mm) on ice for 30 min and then assayed for rhodanese activity. A procedure to measure rhodanese activity by catalyzing the trans-sulfuration from mercaptopyruvate to β-mercaptoethanol would not be appropriate for this experiment, because β-mercaptoethanol reduces disulfide bonds formed between subunits during incubation in the assay mixture. MST possesses rhodanese activity, which catalyzes trans-sulfuration from thiosulfate to cyanide (11Nagahara N. Nishino T. J. Biol. Chem. 1996; 271: 27395-27401Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar, 18Nagahara N. Okazaki T. Nishino T. J. Biol. Chem. 1995; 270: 16230-16235Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar); therefore, it was this rhodanese activity of MST that was measured. The protein concentrations were determined with a Coomassie protein assay kit (Pierce) with crystalline bovine serum albumin (ICN Biochemicals, Irvine, CA) as the standard. Time and Dose Dependence of Enzymatic Activity of MST by Reduced Trx and Trx-TRD-NADPH Systems—MST was activated in a time-dependent manner by the E. coli or rat reduced Trx system, and also by the E. coli or rat reduced Trx-TRD-NADPH system (Fig. 1A). MST activation quickly proceeded with increasing concentrations of reagents in each reducing system (Fig. 1, B–E). These findings suggest that, similar to rat Trx, E. coli Trx reacts with rat MST. In the E. coli Trx-TRD-NADPH system, MST activity increased to 4.5-fold that of the control with 48 μm E. coli Trx and 0.24 μm E. coli TRD (Fig. 1, C and D). In the rat Trx-TRD-NADPH system, MST activity increased to 3-fold that of the control with 12 μm rat Trx and 0.6 μm rat TRD (Fig. 1, C and D). In the E. coli reduced Trx system, MST activity increased to 4.5-fold that of the control with 48 μm E. coli Trx (Fig. 1E). In the rat reduced Trx system, MST activity increased to 3.0-fold that of the control with 60 μm rat Trx (Fig. 1E). It is noteworthy that additional treatment with DTT (1.2 mm) increased MST activity to 5-fold that of the control, implying that DTT acted on rat Trx to modify its function and/or directly activated MST (Fig. 1E). For the Trx-TRD-NADPH system in this study, we determined that the ratio of [MST] to [E. coli reduced Trx], [E. coli TRD], and [NADPH] was 1 to 5, 0.02, and 12.5, respectively, and the ratio of [MST] to [rat reduced Trx], [rat TRD], and [NADPH] was 1 to 1, 0.05, and 12.5, respectively. For the reduced Trx system, we determined that the ratio of [MST] to [reduced Trx] was 1 to 5. MST Activation by DTT, Reduced Trx, and Trx-TRD-NADPH System—E. coli reduced Trx, the E. coli Trx-TRD-NADPH system, and DTT activated wild type, C64S, C154S, C254S, and C263S MSTs under air-saturated conditions (Table 1). The effect of E. coli reduced Trx on the activation of each MST was similar to that of the E. coli Trx-TRD-NADPH system. Wild type, C64S, and C254S MSTs responded well to the reducing systems, and for C154S/C263S MST little responded. C154S and C263S MSTs were low responsive to the reducing systems, and their activities were increased to 1.9- and 3.1-fold that of each control group, respectively.TABLE 1MST activation by the Trx-TRD-NADPH system, reduced Trx (RedTrx), and DTTEnzymeTrx + TRD/untreatedaSpecific activity of a group in which 12 μm MST was treated with 60 μm E. coli Trx combined with 0.24 μm TRD and 150 μm NADPH.,bSpecific activity of an untreated control group.RedTrx/untreatedcSpecific activity of a group in which MST was treated with 60 μm E. coli reduced (Red) Trx.DTT/untreateddSpecific activity of a group in which DTT was removed on a PD10 column after treatment of MST with 1.2 mm DTT.RedTrx (DTT-)/DTTeSpecific activity of a group in which DTT was removed on a PD10 column after treatment of MST with 1.2 mm DTT, and the DTT-treated MST was incubated by 60 μm E. coli reduced Trx.DTT (RedTrx+)/RedTrxfSpecific activity of a group in which 1.2 mm DTT was added after MST was treated by 60 μm E. coli reduced Trx. MST cannot be separated from the mixture of MST and Trx.Wild type4.7 (3.1)gThe same experiments were carried out using rat Trx and rat TRD. Data are shown as a ratio of each mean specific activity to that of untreated, DTT-treated, or reduced Trx-treated MST. Each standard error is within 8% of the mean number (n = 3, data not shown).5.1 (3.0)gThe same experiments were carried out using rat Trx and rat TRD. Data are shown as a ratio of each mean specific activity to that of untreated, DTT-treated, or reduced Trx-treated MST. Each standard error is within 8% of the mean number (n = 3, data not shown).1.3 (1.9)gThe same experiments were carried out using rat Trx and rat TRD. Data are shown as a ratio of each mean specific activity to that of untreated, DTT-treated, or reduced Trx-treated MST. Each standard error is within 8% of the mean number (n = 3, data not shown).2.3 (1.8)gThe same experiments were carried out using rat Trx and rat TRD. Data are shown as a ratio of each mean specific activity to that of untreated, DTT-treated, or reduced Trx-treated MST. Each standard error is within 8% of the mean number (n = 3, data not shown).1.1 (5.0)gThe same experiments were carried out using rat Trx and rat TRD. Data are shown as a ratio of each mean specific activity to that of untreated, DTT-treated, or reduced Trx-treated MST. Each standard error is within 8% of the mean number (n = 3, data not shown).C64S7.08.42.42.21.2C154S2.32.41.91.31.2C254S3.73.31.42.51.2C263S2.11.91.51.01.1C154S/C263S1.41.31.21.11.0a Specific activity of a group in which 12 μm MST was treated with 60 μm E. coli Trx combined with 0.24 μm TRD and 150 μm NADPH.b Specific activity of an untreated control group.c Specific activity of a group in which MST was treated with 60 μm E. coli reduced (Red) Trx.d Specific activity of a group in which DTT was removed on a PD10 column after treatment of MST with 1.2 mm DTT.e Specific activity of a group in which DTT was removed on a PD10 column after treatment of MST with 1.2 mm DTT, and the DTT-treated MST was incubated by 60 μm E. coli reduced Trx.f Specific activity of a group in which 1.2 mm DTT was added after MST was treated by 60 μm E. coli reduced Trx. MST cannot be separated from the mixture of MST and Trx.g The same experiments were carried out using rat Trx and rat TRD. Data are shown as a ratio of each mean specific activity to that of untreated, DTT-treated, or reduced Trx-treated MST. Each standard error is within 8% of the mean number (n = 3, data not shown). Open table in a new tab DTT also activated MSTs to between 1.1- and 2.4-fold the activity of each control. Furthermore, we previously revealed that reduced Trx quickly restored hydrogen peroxide-inhibited MST, in which oxidants formed a sulfenate at a catalytic Cys247, and DTT equivalently or more efficiently restored the activity (13Nagahara N. Katayama A. J. Biol. Chem. 2005; 280: 34569-34576Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar). This finding and the results of this study indicate that Cys154 and Cys263, other than the catalytic Cys247, are sites of action for Trx and DTT, and DTT acts mainly on a sulfenyl Cys247. To minimize the action of Trx on a sulfenyl Cys247, after the MSTs were treated with DTT and the DTT was removed, MSTs were treated with E. coli reduced Trx. Wild type, C64S, and C254S MSTs were activated to 2.3-, 2.2-, 2.8-fold that of each DTT-treated MSTs, respectively. On the other hand, after MSTs were treated with E. coli reduced Trx, MSTs were then treated with DTT. Their activities ranged between 1.0- and 1.2-fold that of each Trx-treated MST. The results confirm that E. coli reduced Trx acts on Cys154 and Cys263 other than Cys247 in the activation of MST. The results of a comparative study using rat Trx and rat TRD are shown in Table 1 and Fig. 1. The rat Trx-TRD-NADPH system and rat reduced Trx activated wild type MST to 3.1- and 3.0-fold that of the control, respectively. It is noteworthy that, although DTT co-existed in the reducing systems using rat Trx, these activities further increased to 4.8- and 5.0-fold that of the control, respectively (Fig. 1E and Table 1). These findings are similar to those of experiments using E. coli Trx and E. coli TRD. It is strongly suggested that DTT modifies rat Trx function to further activate MST probably because of reduction of an intersubunit disulfide bond at Cys72 in a rat Trx dimer, which dissolved oxygen would easily form. The reducing system using rat Trx is not suitable for a quantitative study of Trx function on a protein. Kinetic Studies of the Enzymatic Activation—As the action of E. coli wild type Trx on Cys154, Cys263, and Cys247 of MSTs cannot be clearly discriminated, the results of the overall activation kinetics were compared. Lineweaver-Burk plots and kinetic parameters for wild type, C64S, C154S, C254S, C263S, and C154S/C263S MSTs are shown in Fig. 2 and Table 2. In wild type MST, Lineweaver-Burk plots for 1/[thiosulfate] versus 1/[velocity] showed that the activation followed pseudo-first order Michaelis-Menten kinetics. Furthermore, all of the lines did not intersect at a single point, suggesting that the activation process with various concentrations of reduced Trx involved an increase in kcat(app) and a decrease in Km(app). The activation proceeded via “cleavage of the covalent intermediate of a single enzyme molecule with Trx” (see also under “Attack Mode of Trx to MST”) and resulted from possible conformational changes.TABLE 2Change in kinetic parameters for rhodanese activity of MST in enzymatic activationEnzymeUntreatedaAn untreated control group is indicated.Thioredoxin-treatedeA group in which MST was treated by E. coli reduced Trx is shown.Km(app)bKm(app) value for thiosulfate (TS) as a substrate used a constant concentration of KCN at 60 mm.kcat(app)ckcat(app) value is for rhodanese activity.kcat/KmdRatio of mean value for kcat(app) for rhodanese activity to that for Km(app) for thiosulfate is shown.Km(app)bKm(app) value for thiosulfate (TS) as a substrate used a constant concentration of KCN at 60 mm.kcat(app)ckcat(app) value is for" @default.
• W2025396554 created "2016-06-24" @default.
• W2025396554 creator A5000848869 @default.
• W2025396554 creator A5032820216 @default.
• W2025396554 creator A5076749307 @default.
• W2025396554 creator A5083058948 @default.
• W2025396554 date "2007-01-01" @default.
• W2025396554 modified "2023-10-14" @default.
• W2025396554 title "Thioredoxin-dependent Enzymatic Activation of Mercaptopyruvate Sulfurtransferase" @default.
• W2025396554 cites W1523887533 @default.
• W2025396554 cites W1539041260 @default.
• W2025396554 cites W1550909330 @default.
• W2025396554 cites W1563176897 @default.
• W2025396554 cites W1570884869 @default.
• W2025396554 cites W1584729364 @default.
• W2025396554 cites W1788190869 @default.
• W2025396554 cites W1881010148 @default.
• W2025396554 cites W1971440804 @default.
• W2025396554 cites W1975751186 @default.
• W2025396554 cites W1982145118 @default.
• W2025396554 cites W1982341626 @default.
• W2025396554 cites W1984697058 @default.
• W2025396554 cites W1990216696 @default.
• W2025396554 cites W1995152432 @default.
• W2025396554 cites W1996671717 @default.
• W2025396554 cites W1997676478 @default.
• W2025396554 cites W1999317362 @default.
• W2025396554 cites W2001444438 @default.
• W2025396554 cites W2008820074 @default.
• W2025396554 cites W2020902432 @default.
• W2025396554 cites W2037917982 @default.
• W2025396554 cites W2038652228 @default.
• W2025396554 cites W2040045189 @default.
• W2025396554 cites W2042503798 @default.
• W2025396554 cites W2045787232 @default.
• W2025396554 cites W2048391247 @default.
• W2025396554 cites W2052634837 @default.
• W2025396554 cites W2074408049 @default.
• W2025396554 cites W2085601435 @default.
• W2025396554 cites W2086406769 @default.
• W2025396554 cites W2099847370 @default.
• W2025396554 cites W2108222684 @default.
• W2025396554 cites W2110076050 @default.
• W2025396554 cites W2121800047 @default.
• W2025396554 cites W2125625153 @default.
• W2025396554 cites W2141874177 @default.
• W2025396554 cites W2164252436 @default.
• W2025396554 cites W2165601698 @default.
• W2025396554 cites W2331083962 @default.
• W2025396554 cites W2338163565 @default.
• W2025396554 doi "https://doi.org/10.1074/jbc.m605931200" @default.
• W2025396554 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17130129" @default.
• W2025396554 hasPublicationYear "2007" @default.
• W2025396554 type Work @default.
• W2025396554 sameAs 2025396554 @default.
• W2025396554 citedByCount "85" @default.
• W2025396554 countsByYear W20253965542012 @default.
• W2025396554 countsByYear W20253965542013 @default.
• W2025396554 countsByYear W20253965542014 @default.
• W2025396554 countsByYear W20253965542015 @default.
• W2025396554 countsByYear W20253965542016 @default.
• W2025396554 countsByYear W20253965542017 @default.
• W2025396554 countsByYear W20253965542018 @default.
• W2025396554 countsByYear W20253965542019 @default.
• W2025396554 countsByYear W20253965542020 @default.
• W2025396554 countsByYear W20253965542021 @default.
• W2025396554 countsByYear W20253965542022 @default.
• W2025396554 countsByYear W20253965542023 @default.
• W2025396554 crossrefType "journal-article" @default.
• W2025396554 hasAuthorship W2025396554A5000848869 @default.
• W2025396554 hasAuthorship W2025396554A5032820216 @default.
• W2025396554 hasAuthorship W2025396554A5076749307 @default.
• W2025396554 hasAuthorship W2025396554A5083058948 @default.
• W2025396554 hasBestOaLocation W20253965541 @default.
• W2025396554 hasConcept C181199279 @default.
• W2025396554 hasConcept C185592680 @default.
• W2025396554 hasConcept C2779033446 @default.
• W2025396554 hasConcept C2779201268 @default.
• W2025396554 hasConcept C2780637352 @default.
• W2025396554 hasConcept C3623737 @default.
• W2025396554 hasConcept C55493867 @default.
• W2025396554 hasConcept C86803240 @default.
• W2025396554 hasConcept C95444343 @default.
• W2025396554 hasConceptScore W2025396554C181199279 @default.
• W2025396554 hasConceptScore W2025396554C185592680 @default.
• W2025396554 hasConceptScore W2025396554C2779033446 @default.
• W2025396554 hasConceptScore W2025396554C2779201268 @default.
• W2025396554 hasConceptScore W2025396554C2780637352 @default.
• W2025396554 hasConceptScore W2025396554C3623737 @default.
• W2025396554 hasConceptScore W2025396554C55493867 @default.
• W2025396554 hasConceptScore W2025396554C86803240 @default.
• W2025396554 hasConceptScore W2025396554C95444343 @default.
• W2025396554 hasIssue "3" @default.
• W2025396554 hasLocation W20253965541 @default.
• W2025396554 hasOpenAccess W2025396554 @default.
• W2025396554 hasPrimaryLocation W20253965541 @default.
• W2025396554 hasRelatedWork W1860791487 @default.
• W2025396554 hasRelatedWork W1967853349 @default.

• next