FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2025421399> ?p ?o ?g. }

• W2025421399 endingPage "20737" @default.
• W2025421399 startingPage "20729" @default.
• W2025421399 abstract "The pili expressed by Streptococcus pyogenes and certain other Gram-positive bacterial pathogens are based on a polymeric backbone in which individual pilin subunits are joined end-to-end by covalent isopeptide bonds through the action of sortase enzymes. The crystal structure of the major pilin of S. pyogenes, Spy0128, revealed that each domain of the two domain protein contained an intramolecular isopeptide bond cross-link joining a Lys side chain to an Asn side chain. In the present work, mutagenesis was used to create mutant proteins that lacked either one isopeptide bond (E117A, N168A, and E258A mutants) or both isopeptide bonds (E117A/E258A). Both the thermal stability and proteolytic stability of Spy0128 were severely compromised by loss of the isopeptide bonds. Unfolding experiments, monitored by circular dichroism, revealed a transition temperature Tm of 85 °C for the wild type protein. In contrast, mutants with only one isopeptide bond showed biphasic unfolding, with the domain lacking an isopeptide bond having a Tm that was ∼30 °C lower than the unaltered domain. High resolution crystal structures of the E117A and N168A mutants showed that the loss of an isopeptide bond did not change the overall pilin structure but caused local disturbance of the protein core that was greater for E117A than for N168A. These effects on stability appear also to be important for pilus assembly. The pili expressed by Streptococcus pyogenes and certain other Gram-positive bacterial pathogens are based on a polymeric backbone in which individual pilin subunits are joined end-to-end by covalent isopeptide bonds through the action of sortase enzymes. The crystal structure of the major pilin of S. pyogenes, Spy0128, revealed that each domain of the two domain protein contained an intramolecular isopeptide bond cross-link joining a Lys side chain to an Asn side chain. In the present work, mutagenesis was used to create mutant proteins that lacked either one isopeptide bond (E117A, N168A, and E258A mutants) or both isopeptide bonds (E117A/E258A). Both the thermal stability and proteolytic stability of Spy0128 were severely compromised by loss of the isopeptide bonds. Unfolding experiments, monitored by circular dichroism, revealed a transition temperature Tm of 85 °C for the wild type protein. In contrast, mutants with only one isopeptide bond showed biphasic unfolding, with the domain lacking an isopeptide bond having a Tm that was ∼30 °C lower than the unaltered domain. High resolution crystal structures of the E117A and N168A mutants showed that the loss of an isopeptide bond did not change the overall pilin structure but caused local disturbance of the protein core that was greater for E117A than for N168A. These effects on stability appear also to be important for pilus assembly. The stability of a globular protein is in general a fine balance between large numbers of weak, noncovalent stabilizing forces (hydrophobic interactions, hydrogen bonds, and ion pairs) and the destabilizing loss of conformational entropy (1Pace C.N. Shirley B.A. McNutt M. Gajiwala K. FASEB J. 1996; 10: 75-83Crossref PubMed Scopus (558) Google Scholar). Stability can be greatly enhanced, however, by the presence of a small number of strategically placed covalent bonds, for example those provided by disulfide bonds between Cys residues or by a bound metal ion that bonds to several amino acid side chains. Indeed, some striking examples have been reported in which the introduction of disulfide bonds that link sequentially distant parts of a polypeptide chain can result in large increases in protein stability (2Matsumura M. Becktel W.J. Levitt M. Matthews B.W. Proc. Natl. Acad. Sci. U.S.A. 1989; 86: 6562-6566Crossref PubMed Scopus (256) Google Scholar). Our recent discovery of cross-linking isopeptide bonds within the protein subunits of the pili expressed by the Gram-positive organism Streptococcus pyogenes (3Kang H.J. Coulibaly F. Clow F. Proft T. Baker E.N. Science. 2007; 318: 1625-1628Crossref PubMed Scopus (272) Google Scholar) has raised questions as to how these bonds are formed and what they contribute to stability. These pili, which are extremely thin (2–5 nm in diameter) but can extend up to 4 μm from the bacterial cell surface (4Mora M. Bensi G. Capo S. Falugi F. Zingaretti C. Manetti A.G. Maggi T. Taddei A.R. Grandi G. Telford J.L. Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 15641-15646Crossref PubMed Scopus (301) Google Scholar), are formed as covalently linked polymers through the action of cysteine transpeptidase enzymes called sortases. In this process, which is common to a number of Gram-positive bacterial pathogens, the pilus backbone is formed from a single protein subunit, the so-called major pilin, by the covalent, end-to-end polymerization of major pilin subunits, generating an assembly resembling beads on a string (5Ton-That H. Schneewind O. Mol. Microbiol. 2003; 50: 1429-1438Crossref PubMed Scopus (285) Google Scholar, 6Telford J.L. Barocchi M.A. Margarit I. Rappuoli R. Grandi G. Nat. Rev. Microbiol. 2006; 4: 509-519Crossref PubMed Scopus (359) Google Scholar, 7Budzik J.M. Marraffini L.A. Souda P. Whitelegge J.P. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U.S.A. 2008; 105: 10215-10220Crossref PubMed Scopus (74) Google Scholar). Polymerization requires recognition, by the sortase, of an LPXTG-type sequence motif near the pilin C terminus, cleavage after the Thr residue, and transfer to a specific Lys residue in the next pilin subunit. The resulting amide bond, between the terminal COOH of one subunit and the Lys ϵ-amino group of the next subunit, is referred to as an isopeptide bond. Surprisingly, the three-dimensional structure of Spy0128, the major pilin from the M1 strain of S. pyogenes (group A streptococcus; GAS), 2The abbreviations used are: GASgroup A streptococcusESI-TOFelectrospray ionization-time of flightWTwild typeMOPS4-morpholinepropanesulfonic acidN domainN-terminal domainC domainC-terminal domain. revealed the presence of additional isopeptide bonds as internal cross-links within the protein. These bonds, which were confirmed by mass spectrometry, joined lysine and asparagine side chains (3Kang H.J. Coulibaly F. Clow F. Proft T. Baker E.N. Science. 2007; 318: 1625-1628Crossref PubMed Scopus (272) Google Scholar). One such bond was found within each domain of the two domain protein and, in a similar location, between the first and last strands of the domain (Fig. 1). Isopeptide bonds have until now been recognized for their importance in the intermolecular cross-linking of a variety of proteins, such as in ubiquitination (8Pickart C.M. Annu. Rev. Biochem. 2001; 70: 503-533Crossref PubMed Scopus (2944) Google Scholar), transglutamination (9Greenberg C.S. Birckbichler P.J. Rice R.H. FASEB J. 1991; 5: 3071-3077Crossref PubMed Scopus (936) Google Scholar), and sortase-mediated cell wall anchoring of surface proteins (10Ton-That H. Marraffini L.A. Schneewind O. Biochim. Biophys. Acta. 2004; 1694: 269-278Crossref PubMed Scopus (213) Google Scholar), as well as pilus polymerization. In this context, the presence of the intramolecular isopeptide bonds in Spy0128 seemed highly unusual. There has been speculation in the past that such internal bonds could exist, but no mechanism has been put forward, and none has previously been proven to exist. group A streptococcus electrospray ionization-time of flight wild type 4-morpholinepropanesulfonic acid N-terminal domain C-terminal domain. The locations of the two internal Lys-Asn isopeptide bonds in Spy0128 immediately suggested that they are self-generated, each being the result of an intramolecular reaction. Mutagenesis showed that bond formation was in each case dependent on an adjacent Glu residue, Glu117 in the N-terminal domain and Glu258 in the C-terminal domain; mutation of either of these Glu residues to Ala abrogated the formation of the associated isopeptide bond (3Kang H.J. Coulibaly F. Clow F. Proft T. Baker E.N. Science. 2007; 318: 1625-1628Crossref PubMed Scopus (272) Google Scholar). A close parallel exists in the self-generated Lys-Asn isopeptide bonds that form during maturation of the protein coat of the bacteriophage HK97, where a nearby Glu residue is essential for the reaction, and the capsid subunits become covalently linked to form interlocked circular rings referred to as chain mail (11Duda R.L. Cell. 1998; 94: 55-60Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar, 12Wikoff W.R. Liljas L. Duda R.L. Tsuruta H. Hendrix R.W. Johnson J.E. Science. 2000; 289: 2129-2133Crossref PubMed Scopus (571) Google Scholar). Further investigations have shown that similar isopeptide bonds can be found as internal cross-links in other proteins. Examination of previously determined structures of a minor pilin GBS52 from Streptococcus agalactiae (13Krishnan V. Gaspar A.H. Ye N. Mandlik A. Ton-That H. Narayana S.V.L. Structure. 2007; 15: 893-903Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar) and the CnaA and CnaB domains of a collagen-binding adhesin from Staphylococcus aureus (14Symersky J. Patti J.M. Carson M. House-Pompeo K. Teale M. Moore D. Jin L. Schneider A. DeLucas L.J. Höök M. Narayana S.V.L. Nat. Struct. Biol. 1997; 4: 833-838Crossref PubMed Scopus (123) Google Scholar, 15Deivanayagam C.C. Rich R.L. Carson M. Owens R.T. Danthuluri S. Bice T. Höök M. Narayana S.V. Structure. 2000; 8: 67-78Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar, 16Zong Y. Xu Y. Liang X. Keene D.R. Höök A. Gurusiddappa S. Höök M. Narayana S.V. EMBO J. 2005; 24: 4224-4236Crossref PubMed Scopus (182) Google Scholar) revealed constellations of Lys-Asn-Glu/Asp residues similar to those that form the internal cross-links in Spy0128, and examination of the electron density confirmed their probable presence in those cases where the x-ray data were available (3Kang H.J. Coulibaly F. Clow F. Proft T. Baker E.N. Science. 2007; 318: 1625-1628Crossref PubMed Scopus (272) Google Scholar). Sequence comparisons showed that similar domains, with corresponding Lys-Asn-Glu/Asp residues, are present in many cell surface proteins of Gram-positive bacteria. Recently the Bacillus cereus major pilin BcpA was shown, by mass spectral analyses, to contain internal isopeptide bonds similar to those in Spy0128 (7Budzik J.M. Marraffini L.A. Souda P. Whitelegge J.P. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U.S.A. 2008; 105: 10215-10220Crossref PubMed Scopus (74) Google Scholar), and sequence comparisons point to similar bonds in the major pilins of other species. These data suggest that isopeptide bond cross-links could be important features in many surface proteins involved in adhesive functions, where stability against physical and chemical stresses is important. Here we describe the preparation of mutants of Spy0128 that lack one or both of the internal isopeptide bonds, using mass spectrometry to confirm their absence. We show by x-ray crystallography that the overall structure of Spy0128 is not significantly affected by the loss of an isopeptide bond. We also show, however, that the proteolytic and thermal stability of Spy0128 is severely compromised when the internal isopeptide bonds are removed and thereby establish their important stabilizing role in proteins of this type. The DNA sequence encoding amino acids 18–311 of Spy0128 was amplified from GAS serotype M1 genomic DNA, using the primer pairs listed in Table 1. The amplified DNA product was double-digested with restriction enzymes EcoRI and BamHI and ligated into the vector pGEX3C. The ligation reaction was transformed into Escherichia coli DH5α cells, and positive colonies were screened by colony PCR. DNA sequencing was carried out to confirm the sequence. The resulting plasmid pGEX3C-Spy012818–311 contained the desired Spy0128 sequence, a linker with sequence GPGS, a picornavirus 3C protease cleavage site, and a glutathione S-transferase tag.TABLE 1Primers used in this studyPrimerSequence 5′ → 3′pGEX3C-Spy012818–311 ForwardCGGGATCCGCTACAACAGTTCACGG ReverseGCGAATTCTTATGTTGGCACTTCAAAGSpy012818–308/311 E117A ForwardGTAACTGCGGAGAAGATAGATAAAG ReverseCTTCTCCGCAGTTACTTTGTAATAATAAACSpy012818–308/311 N168A ForwardGTTCAAAGCTAGCTTAGATTCTACTAC ReverseCTAAGCTAGCTTTGAACTGAATTGGCACSpy012818–308/311 E258A ForwardGTTGTCACTGCAGACGATTACAAATCAG ReverseATCGTCTGCAGTGACAACATAATCCAC Open table in a new tab Mutations were introduced to Spy0128 by the PCR-based site-directed mutagenesis of double-stranded DNA. Forward and reverse primer pairs for each mutation were designed, as listed in Table 1. Two alternative wild type constructs were used as templates for PCR amplification: pGEX3C-Spy012818–311, prepared as described above, and pGEX3C-Spy012818–308, prepared as described earlier (3Kang H.J. Coulibaly F. Clow F. Proft T. Baker E.N. Science. 2007; 318: 1625-1628Crossref PubMed Scopus (272) Google Scholar). After amplification with Pfu Turbo DNA polymerase (Stratagene), each reaction was incubated with DpnI restriction enzyme at 37 °C to remove template DNA and then transformed into E. coli DH5α cells. The sequences of the resulting constructs were confirmed by DNA sequencing. The plasmids for pGEX3C-Spy012818–311, pGEX3C-Spy012818–308, and their mutants were transformed into E. coli BL21 (DE3) pRP cells for expression. Protein overexpression was carried out in ZYP-5052 autoinduction medium (17Studier F.W. Protein Expr. Purif. 2005; 41: 207-234Crossref PubMed Scopus (4193) Google Scholar). The cells were grown initially at 37 °C for 4 h followed by 20 h at 28 °C. Harvested cells were lysed in a buffer (buffer A) containing 25 mm Tris-HCl, pH 8.0, 50 mm NaCl using sonication or a cell disruptor (Constant Systems). Cell debris was removed by centrifugation, and the final supernatant was filtered through a 0.2-μm filter prior to protein purification. Spy012818–311 and Spy012818–308 were purified as described previously (3Kang H.J. Coulibaly F. Clow F. Proft T. Baker E.N. Science. 2007; 318: 1625-1628Crossref PubMed Scopus (272) Google Scholar). Briefly, the proteins were first purified using a glutathione-Sepharose column (GE Healthcare) followed by cleavage of the glutathione S-transferase tag on the column using recombinant picornavirus 3C protease. The untagged protein was further purified by anion exchange chromatography using a HiTrap QFF column with a NaCl gradient (0–1 m) in buffer A, followed by size exclusion chromatography using a Superdex 200 HR10/30 gel filtration column (GE Healthcare) in buffer A. For the mutant proteins, purification was carried out at 4 °C, and the duration for the glutathione S-transferase tag cleavage was reduced to 4 h instead of overnight, because some mutants were susceptible to degradation. Gel filtration fractions containing pure Spy012818–311 or mutants were pooled and concentrated, and protein concentrations were spectrophotometrically determined using the extinction coefficient of 26,360 m−1 cm−1 at 280 nm. Accurate molecular masses of proteins were determined by infusion ESI-TOF mass spectrometry undertaken on a Q-STAR XL hybrid tandem mass spectrometry system (Applied Biosystems) in 50% acetonitrile and 0.1% formic acid. The raw mass spectrometry data were deconvoluted using the Bayesian protein reconstruction tool in BioAnalyst software (Applied Biosystems). CD spectroscopy experiments were conducted on a JASCO J-815 CD spectrophotometer equipped with a Peltier temperature control (JASCO Inc.). The proteins were used at a concentration of 0.1 mg/ml (∼ 3 × 10−6m), in 10 mm potassium phosphate buffer, pH 8.0. For CD data collection, 1 ml of each protein was used in a 1-cm path length quartz cuvette. Wavelength scans between 200 and 250 nm were collected at 20 °C using 1.0-nm bandwidth, 0.1-nm step size, and an averaging time of 1 s. For thermal melting, temperature was increased from 20 to 95 °C at a heating rate of 1 °C/min, and CD signals at 222 nm were collected at 0.5 °C intervals. Reversibility of thermal denaturation was checked by cooling and reheating the same samples. The raw data in millidegree units were corrected for background absorbance and converted to molar ellipticity [θ]. Thermal denaturation curves were determined by plotting changes in CD molar ellipticity as a function of temperature. The experimental curves were fit to the Boltzmann equation describing a two-state folding transition, and the melting temperature Tm was obtained from the inflection point of the curve. Spy012818–311 and mutant proteins were diluted in 25 mm NH4HCO3 to 0.3 mg/ml and mixed with 0.3% (w/w) trypsin. The reaction was carried out at 37 °C. At different time points between 1 min and 16 h from incubation, 15 μl of each reaction was drawn out and mixed with boiling SDS sample buffer. The samples were analyzed by running on a 15% SDS-PAGE gel followed by Coomassie Blue staining. Crystallization trials were performed at 18 °C by the vapor diffusion sitting drop method. In each case equal volumes of protein (concentration, 100 mg/ml in 25 mm Tris-HCl, pH 8.0, 50 mm NaCl) and precipitant were mixed using a Cartesian nanoliter dispensing robot (Genome Solutions). The best crystals were obtained for mutants of the Spy012818–308 construct. The E117A mutant produced crystals with a precipitant comprising 0.2 m potassium acetate and 20% polyethylene glycol 3350, whereas for the N168A mutant, the best crystals were obtained using 0.2 m MOPS/KOH, pH 7.5, and 21% polyethylene glycol 6000. Prior to data collection, the crystals were soaked for 5 s in cryoprotectant solutions comprising mother liquor solution supplemented with 0–20% ethylene glycol (E117A) or polyethylene glycol 400 (N168A) and were then immediately cryo-cooled in liquid nitrogen. Diffraction data were collected to 2.0 Å resolution at 100 K using the MicroMax-007HF rotating anode generator (Rigaku) equipped with a Mar345 image plate detector. The data sets were processed and scaled with the HKL2000 package (18Otwinowski Z. Minor W. Carter J.C.W. Sweet R.M. Methods in Enzymology. 276. Academic Press, New York1997: 307-326Google Scholar). The crystals of both the E117A and N168A mutant proteins belong to space group P21, with three molecules/asymmetric unit and unit cell dimensions very similar to those of the WT crystals. The E117A crystals were isomorphous with WT Spy012818–308, but N168A crystals showed slightly altered unit cell dimensions (Table 2). The WT Spy012818–308 structure (Protein Data Bank code 3B2M) was used as a phasing model for structure determination after omitting all solvent molecules. The isomorphism of the E117A mutant meant that this WT model could be placed into the E117A unit cell, and its position and orientation could be optimized by rigid body refinement with REFMAC (19Murshudov G.N. Vagin A.A. Dodson E.J. Acta Crystallogr. D. Biol. Crystallogr. 1997; 53: 240-255Crossref PubMed Scopus (13914) Google Scholar). For the less isomorphous N168A crystals, molecular replacement with PHASER (20McCoy A.J. Grosse-Kunstleve R.W. Adams P.D. Winn M.D. Storoni L.C. Read R.J. J. Appl. Crystallogr. 2007; 40: 658-674Crossref PubMed Scopus (14771) Google Scholar) was necessary, however, using the WT structure as search model. In both cases, the Rfree set of reflections used in the wild type structure refinement was transferred to the mutant reflection file before refinement commenced to avoid bias. Refinement was with REFMAC with TLS restraints (21Winn M.D. Isupov M.N. Murshudov G.N. Acta Crystallogr. D. Biol. Crystallogr. 2001; 57: 122-133Crossref PubMed Scopus (1654) Google Scholar), and manual model building was carried out using COOT (22Emsley P. Cowtan K. Acta Crystallogr. D. Biol. Crystallogr. 2004; 60: 2126-2132Crossref PubMed Scopus (23628) Google Scholar). The E117A structure was refined at 2.03 Å resolution to final values of r = 0.212 and Rfree = 0.260, and N168A was refined at 2.20 Å resolution to r = 0.205 and Rfree = 0.278. For both structures, over 90% of the residues are in the most favored regions of the Ramachandran plot, as defined by PROCHECK (23Laskowski R.A. MacArthur M.W. Moss D.S. Thornton J.M. J. Appl. Crystallogr. 1993; 26: 283-291Crossref Google Scholar) with no outliers. The data collection and refinement statistics are given in Table 2. The atomic coordinate and structure factor files were deposited with the RCSB Protein Data Bank with accession codes 3GLD (E117A) and 3GLE (N168A).TABLE 2Data collection and refinement statisticsSpy012818–308 E117ASpy012818–308 N168ASpace groupP21P21Unit cell dimensions (Å, deg)a = 67.31, b = 52.15, c = 127.32, β = 98.83°a = 64.71, b = 50.87, c = 123.20, β = 104.27°Data collection statistics Resolution range (Å)aThe values in parentheses are for the outermost shell of data.50–2.03 (2.10–2.03)50–2.20 (2.28–2.20) Wavelength (Å)1.541781.54178 Total reflections20793912274826 No. unique reflectionsaThe values in parentheses are for the outermost shell of data.54403 (4811)40313 (4012) RedundancyaThe values in parentheses are for the outermost shell of data.5.9 (4.7)10.4 (10.0) Completeness (%)aThe values in parentheses are for the outermost shell of data.95.8 (84.9)99.8 (100.0) Mean I/σ(I)aThe values in parentheses are for the outermost shell of data.32.6 (5.8)38.7 (6.6) Rsym (%)aThe values in parentheses are for the outermost shell of data.,bRsym = ΣhΣi[|Ii(h) − <I(h)>|/ΣhΣiIi(h)], where Ii is the ith measurement, and <I(h)> is the weighted mean of all measurement of Ii(h).4.9 (27.8)6.0 (39.5)Refinement Statistics Rwork/Rfree (%)aThe values in parentheses are for the outermost shell of data.21.2 (24.8)/26.0 (37.1)20.5 (25.4)/27.8 (36.6) Root mean square deviations from standard bond lengths (Å)0.0110.012 Root mean square deviations from standard bond angles (°)1.301.35 Average B-factor (Å2)33.125.8 Main chain atoms32.124.7 Side chains and waters34.126.8 No. of non-hydrogen atoms Protein66926690 Water550324Ramachandran plot Most favored regions (%)91.290.9 Additionally allowed (%)8.68.9 Generously allowed (%)0.30.1 Outliers (%)00a The values in parentheses are for the outermost shell of data.b Rsym = ΣhΣi[|Ii(h) − <I(h)>|/ΣhΣiIi(h)], where Ii is the ith measurement, and <I(h)> is the weighted mean of all measurement of Ii(h). Open table in a new tab The formation of the two internal isopeptide bonds in Spy0128 is dependent in each case on an associated acidic residue, Glu117 for the N-terminal domain isopeptide bond and Glu258 for the C-terminal domain isopeptide bond. These residues were mutated to Ala to generate the single-mutation proteins E117A and E258A, and the double-mutation protein E117A/E258A. In addition, Asn168, which forms the isopeptide bond with Lys36 in the N-terminal domain, was also changed to alanine, creating the N168A mutant, to compare with the glutamate substitution mutants. The appropriate mutations were made in a construct encoding residues 18–311 (Spy012818–311), which ends with Thr311, known to be the C-terminal residue after sortase cleavage. For crystallography, however, the slightly shorter construct Spy012818–308 was used as this gave much better crystals and allowed direct comparison with the WT structure (3Kang H.J. Coulibaly F. Clow F. Proft T. Baker E.N. Science. 2007; 318: 1625-1628Crossref PubMed Scopus (272) Google Scholar). Both wild type (WT) Spy0128 and the mutant proteins were expressed and purified, and the presence or absence of isopeptide bonds was analyzed by ESI-TOF mass spectrometry (Table 3). The molecular mass of WT Spy0128 was 34.8 Da less than that calculated from the amino acid sequence (Mcalc), indicating the loss of two units of NH3 through formation of two isopeptide bonds. For the single-Glu mutants E117A and E258A, loss of only one NH3 was observed in each case, indicating formation of one isopeptide bond. In contrast, no mass decrease was detected for the double mutant E117A/E258A, indicating no isopeptide bonds. These results confirm the essential role of the Glu residues in the isopeptide bond formation. Mutation of Asn168 to Ala in N168A also effectively removed the isopeptide bond, as shown by the loss of only one NH3 from the overall protein mass.TABLE 3ESI-TOF mass spectral analyses of wild type and mutant proteins of Spy0128ProteinMaverageaAverage molecular mass.Δ (Mexpected − Mobserved)bDifference between expected molecular mass and observed molecular mass.NH3 units lostExpectedObserved by ESI-TOFDaDaSpy012818–31132,756.432,721.634.82Spy012818–311 E117A32,698.332,682.016.31Spy012818–311 N168A32,713.332,696.516.81Spy012818–311 E258A32,698.332,681.516.81Spy012818–311 E117A/E258A32,640.332,640.50.20a Average molecular mass.b Difference between expected molecular mass and observed molecular mass. Open table in a new tab The secondary structures of Spy0128 and its mutants were estimated by CD spectroscopy. The crystal structure of Spy0128 shows that it is an all-β protein with no α-helices (3Kang H.J. Coulibaly F. Clow F. Proft T. Baker E.N. Science. 2007; 318: 1625-1628Crossref PubMed Scopus (272) Google Scholar). The CD spectrum at pH 8.0 (Fig. 2) displayed a distinctive minimum at 215 nm and positive peaks at ∼200 nm (not shown) and ∼227 nm. These features differ slightly from those seen for classic anti-parallel β-sheet proteins, which show positive bands at ∼195 nm and a minimum at ∼218 nm. The mutant proteins all displayed similar CD spectra to WT Spy0128, with only minor differences, mainly around the 215-nm region. The CD spectra of E117A and E258A were virtually identical, and both showed deeper 215-nm minima relative to WT, whereas N168A showed a lesser 215-nm minimum than WT. For the double mutant E117A/E258A, the overall spectra were shifted downward. The spectra are consistent with similar folding in all cases. The thermal stabilities of Spy0128 and its mutant proteins were probed by measuring the temperature dependence of their CD spectra in the far-UV region over a temperature range of 20–95 °C. Unfolding of the proteins was monitored by the loss of ellipticity at 222 nm. This wavelength was chosen because the spectra were often noisy around the 215-nm minimum. The reversibility of unfolding was tested by reheating the same samples and cooling back to the starting temperature, 20 °C. After heating to 95 °C, both WT and N168A proteins could be refolded with no apparent sign of aggregation (Fig. 2, B and D). In contrast, E117A, E258A, and E117A/E258A all precipitated with increasing temperature and showed significant loss of CD signal after heating and cooling, indicating irreversible thermal denaturation of these mutants. In particular, E117A/E258A showed a nearly complete loss of the characteristic CD maximum and minimum. These results indicate that the reversibility of Spy0128 thermal unfolding is significantly perturbed by the Glu to Ala mutations. N168A also lacks the N domain isopeptide bond, like E117A, but it does refold after thermal unfolding. This indicates that the presence of the Lys-Asn isopeptide bonds in Spy0128 is not solely responsible for the reversibility of its thermal unfolding. All of the proteins showed a gradual decrease in their 222-nm CD signal as the temperature was increased. This was more pronounced in the E117A, E258A, and E117A/E258A mutants, whereas the wild type and N168A showed much slower descent (Fig. 3). The WT protein followed a typical two-state unfolding mechanism, with a sharply defined transition temperature (Tm) of 85.1 °C and no evidence of a stable intermediate (Fig. 3). In contrast, all of the single mutants exhibited two transitions, the first between ∼50 and 60 °C and the second between ∼80 and 85 °C, similar to the single transition seen for WT (Table 4). The transitions that occurred in the mutant proteins were less sharp than that of WT, however, indicating less cooperative unfolding reactions. The CD signals of the glutamate mutants E117A and E258A decreased more rapidly than that of the N168A from the starting temperature. This indicates that the unfolding was well under way at the low temperatures for the Glu mutants, whereas it was less so for N168A. For the double mutant E117A/E258A, the CD signal decreased markedly beyond 50 °C and then stopped at 60–70 °C, and no post-transition base line could be established.TABLE 4Tm values of Spy0128 and mutantsProteinTm°CSpy012818–31185.1Spy012818–311 E117A50.2/84.2Spy012818–311 N168A60.3/83.6Spy012818–311 E258A57.5/79.4Spy012818–311 E117A/E258Andand, not determined.a nd, not determined. Open table in a new tab It has been known for decades that GAS Lancefield T antigens are resistant to trypsin digestion (24Lancefield R.C. Dole V.P. J. Exp. Med. 1946; 84: 449-471Crossref PubMed Scopus (28) Google Scholar). Because Spy0128 has been recently recognized as a Lancefield T1 antigen (4Mora M. Bensi G. Capo S. Falugi F. Zingaretti C. Manetti A.G. Maggi T. Taddei A.R. Grandi G. Telford J.L. Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 15641-15646Crossref PubMed Scopus (301) Google Scholar), tests were carried out to determine whether the intramolecular isopeptide bonds play a significant role in the resistance to proteolysis of this protein. To this end, Spy012818–311 and its mutant proteins were subject to trypsin digestion at 37 °C, with the progress of the digestion being followed by SDS-PAGE analysis of samples taken at various time points (Fig. 4). The WT protein remained essentially intact after 4 h digestion and was still largely intact after 16 h. In contrast, the mutant proteins showed significantly increased susceptibility to proteolysis. No full-length E117A/E258A could be detected after 5 min of digestion, and the single mutants showed varying degrees of pro" @default.
• W2025421399 created "2016-06-24" @default.
• W2025421399 creator A5054413817 @default.
• W2025421399 creator A5070213766 @default.
• W2025421399 date "2009-07-01" @default.
• W2025421399 modified "2023-10-18" @default.
• W2025421399 title "Intramolecular Isopeptide Bonds Give Thermodynamic and Proteolytic Stability to the Major Pilin Protein of Streptococcus pyogenes" @default.
• W2025421399 cites W1561893393 @default.
• W2025421399 cites W1646690512 @default.
• W2025421399 cites W1832030339 @default.
• W2025421399 cites W1880651972 @default.
• W2025421399 cites W1892184508 @default.
• W2025421399 cites W1931164952 @default.
• W2025421399 cites W194875141 @default.
• W2025421399 cites W1975864079 @default.
• W2025421399 cites W1978191506 @default.
• W2025421399 cites W1980188412 @default.
• W2025421399 cites W1982383374 @default.
• W2025421399 cites W1986191025 @default.
• W2025421399 cites W1988005268 @default.
• W2025421399 cites W2013151264 @default.
• W2025421399 cites W2038840577 @default.
• W2025421399 cites W2039817895 @default.
• W2025421399 cites W2056577988 @default.
• W2025421399 cites W2056680298 @default.
• W2025421399 cites W2057443486 @default.
• W2025421399 cites W2058498396 @default.
• W2025421399 cites W2076742934 @default.
• W2025421399 cites W2099580632 @default.
• W2025421399 cites W2105380128 @default.
• W2025421399 cites W2106246537 @default.
• W2025421399 cites W2111457654 @default.
• W2025421399 cites W2112200653 @default.
• W2025421399 cites W2131209038 @default.
• W2025421399 cites W2144081223 @default.
• W2025421399 cites W2144745984 @default.
• W2025421399 cites W2150931072 @default.
• W2025421399 cites W2163341755 @default.
• W2025421399 doi "https://doi.org/10.1074/jbc.m109.014514" @default.
• W2025421399 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2742838" @default.
• W2025421399 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19497855" @default.
• W2025421399 hasPublicationYear "2009" @default.
• W2025421399 type Work @default.
• W2025421399 sameAs 2025421399 @default.
• W2025421399 citedByCount "100" @default.
• W2025421399 countsByYear W20254213992012 @default.
• W2025421399 countsByYear W20254213992013 @default.
• W2025421399 countsByYear W20254213992014 @default.
• W2025421399 countsByYear W20254213992015 @default.
• W2025421399 countsByYear W20254213992016 @default.
• W2025421399 countsByYear W20254213992017 @default.
• W2025421399 countsByYear W20254213992018 @default.
• W2025421399 countsByYear W20254213992019 @default.
• W2025421399 countsByYear W20254213992020 @default.
• W2025421399 countsByYear W20254213992021 @default.
• W2025421399 countsByYear W20254213992022 @default.
• W2025421399 countsByYear W20254213992023 @default.
• W2025421399 crossrefType "journal-article" @default.
• W2025421399 hasAuthorship W2025421399A5054413817 @default.
• W2025421399 hasAuthorship W2025421399A5070213766 @default.
• W2025421399 hasBestOaLocation W20254213991 @default.
• W2025421399 hasConcept C104317684 @default.
• W2025421399 hasConcept C174832134 @default.
• W2025421399 hasConcept C185592680 @default.
• W2025421399 hasConcept C2776803919 @default.
• W2025421399 hasConcept C2779306812 @default.
• W2025421399 hasConcept C2779489039 @default.
• W2025421399 hasConcept C523546767 @default.
• W2025421399 hasConcept C54355233 @default.
• W2025421399 hasConcept C55493867 @default.
• W2025421399 hasConcept C60987743 @default.
• W2025421399 hasConcept C71240020 @default.
• W2025421399 hasConcept C75079739 @default.
• W2025421399 hasConcept C86803240 @default.
• W2025421399 hasConcept C89423630 @default.
• W2025421399 hasConceptScore W2025421399C104317684 @default.
• W2025421399 hasConceptScore W2025421399C174832134 @default.
• W2025421399 hasConceptScore W2025421399C185592680 @default.
• W2025421399 hasConceptScore W2025421399C2776803919 @default.
• W2025421399 hasConceptScore W2025421399C2779306812 @default.
• W2025421399 hasConceptScore W2025421399C2779489039 @default.
• W2025421399 hasConceptScore W2025421399C523546767 @default.
• W2025421399 hasConceptScore W2025421399C54355233 @default.
• W2025421399 hasConceptScore W2025421399C55493867 @default.
• W2025421399 hasConceptScore W2025421399C60987743 @default.
• W2025421399 hasConceptScore W2025421399C71240020 @default.
• W2025421399 hasConceptScore W2025421399C75079739 @default.
• W2025421399 hasConceptScore W2025421399C86803240 @default.
• W2025421399 hasConceptScore W2025421399C89423630 @default.
• W2025421399 hasIssue "31" @default.
• W2025421399 hasLocation W20254213991 @default.
• W2025421399 hasLocation W20254213992 @default.
• W2025421399 hasLocation W20254213993 @default.
• W2025421399 hasLocation W20254213994 @default.
• W2025421399 hasOpenAccess W2025421399 @default.
• W2025421399 hasPrimaryLocation W20254213991 @default.
• W2025421399 hasRelatedWork W1865591512 @default.
• W2025421399 hasRelatedWork W1893680130 @default.

• next