FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2025448306> ?p ?o ?g. }

• W2025448306 endingPage "20273" @default.
• W2025448306 startingPage "20268" @default.
• W2025448306 abstract "The incorporation of ammonia into glutamine, catalyzed by glutamine synthetase, is thought to be important in the detoxification of ammonia in animals. During early fish development, ammonia is continuously formed as yolk proteins and amino acids are catabolized. We followed the changes in ammonia and urea-nitrogen content, ammonia and urea-nitrogen excretion, glutamine synthetase activity, and mRNA expression of four genes coding for glutamine synthetase (Onmy-GS01–GS04) over 3–80 days post fertilization and in adult liver and skeletal muscle of the rainbow trout (Oncorhynchus mykiss). Both ammonia and urea-nitrogen accumulate before hatching, although the rate of ammonia excretion is considerably higher relative to urea-nitrogen excretion. All four genes were expressed during early development, but only Onmy-GS01 and -GS02 were expressed at appreciable levels in adult liver, and expression was very low in muscle tissue. The high level of expression of Onmy-GS01 and -GS03 prior to hatching corresponded to a linear increase in glutamine synthetase activity. We propose that the induction of glutamine synthetase genes early in development and the subsequent formation of the active protein are preparatory for the increased capacity of the embryo to convert the toxic nitrogen end product, ammonia, into glutamine, which may then be utilized in the ornithine-urea cycle or other pathways. The incorporation of ammonia into glutamine, catalyzed by glutamine synthetase, is thought to be important in the detoxification of ammonia in animals. During early fish development, ammonia is continuously formed as yolk proteins and amino acids are catabolized. We followed the changes in ammonia and urea-nitrogen content, ammonia and urea-nitrogen excretion, glutamine synthetase activity, and mRNA expression of four genes coding for glutamine synthetase (Onmy-GS01–GS04) over 3–80 days post fertilization and in adult liver and skeletal muscle of the rainbow trout (Oncorhynchus mykiss). Both ammonia and urea-nitrogen accumulate before hatching, although the rate of ammonia excretion is considerably higher relative to urea-nitrogen excretion. All four genes were expressed during early development, but only Onmy-GS01 and -GS02 were expressed at appreciable levels in adult liver, and expression was very low in muscle tissue. The high level of expression of Onmy-GS01 and -GS03 prior to hatching corresponded to a linear increase in glutamine synthetase activity. We propose that the induction of glutamine synthetase genes early in development and the subsequent formation of the active protein are preparatory for the increased capacity of the embryo to convert the toxic nitrogen end product, ammonia, into glutamine, which may then be utilized in the ornithine-urea cycle or other pathways. Glutamine synthetase (l-glutamate:ammonia ligase (ADP forming), EC 6.3.1.2) catalyzes the ATP-dependent conversion of glutamate and ammonium to glutamine. Glutamine formation plays a key role in nitrogen metabolism, including nucleotide, amino acid, and urea biosynthesis. Glutamine synthetase is critical in the detoxification process of the highly mobile and toxic ammonia (for reviews, see Refs. 1Korsgaard B. Mommsen T.P. Wright P.A. Walsh P.J. Wright P.A. Nitrogen Metabolism and Excretion. CRC Press, Boca Raton1995: 259-287Google Scholar, 2Ip Y.K. Chew S.F. Randall D.J. Wright P.A. Anderson P.M. Fish Physiology, Vol. 20: Nitrogen Excretion. Academic Press, San Diego2001: 109-148Google Scholar, 3Randall D.J. Tsui T.K.N. Mar. Pollut. Bull. 2002; 45: 17-23Crossref PubMed Scopus (751) Google Scholar). During early fish development, endogenously feeding embryos rely on the catabolism of yolk protein and amino acids for fuel, resulting in a high rate of ammonia production (for review see Ref. 4Wright P.A. Fyhn H.J. Wright P.A. Anderson P.M. Fish Physiology, Vol. 20: Nitrogen Excretion. Academic Press, San Diego2001: 149-186Google Scholar). Indeed, in both the rainbow trout, Oncorhynchus mykiss (5Wright P.A. Felskie A. Anderson P.M. J. Exp. Biol. 1995; 198: 127-135Crossref PubMed Google Scholar), and African catfish, Clarias gariepinus (6Terjesen B.F. Verreth J. Fyhn H.J. Fish Physiol. Biochem. 1997; 16: 311-321Crossref Scopus (34) Google Scholar), ammonia levels steadily rise during embryogenesis and peak after hatch. Although the egg capsule or chorion is permeable to ammonia (7Smith S. Brown M.E. Metabolism. Academic Press, New York1957: 323-359Google Scholar, 8Rahaman-Noronha E. O'Donnell M.J. Pilley C.M. Wright P.A. J. Exp. Biol. 1996; 199: 2713-2723Crossref PubMed Google Scholar), elimination is slow in the absence of respiratory convection (9Rombough P.J. Moroz B.M. J. Exp. Biol. 1990; 154: 1-12Crossref Google Scholar, 10Rombough P.J. Moroz B.M. J. Exp. Biol. 1997; 200: 2459-2468Crossref PubMed Google Scholar) and direct contact with bulk water. Thus, glutamine synthetase may play a central role in maintaining low tissue levels of ammonia throughout the critical time of organ development during embryogenesis. Glutamine may be further utilized to synthesize urea in the rainbow trout embryo. In fish, glutamine is the nitrogen-donating substrate for the first step in the ornithine urea cycle (OUC) 1The abbreviations used are: OUC, ornithine urea cycle; dpf, days post fertilization; CYA, complete yolk absorption; ANOVA, analysis of variance. (11Anderson P.M. Casey C.A. J. Biol. Chem. 1984; 259: 456-462Abstract Full Text PDF PubMed Google Scholar). Griffith (12Griffith R.W. Env. Biol. Fishes. 1991; 32: 199-218Crossref Scopus (76) Google Scholar) suggested that urea synthesis may be important during protracted teleost embryogenesis, as ammonia excretion is restricted and the rate of protein catabolism is high. Dépêche et al. (13Dépêche J. Gilles R. Daufresne S. Chiapello H. Comp. Biochem. Physiol. 1979; 63A: 51-56Crossref Scopus (61) Google Scholar) demonstrated significant urea production in rainbow trout embryos from the incorporation of NaH14CO3, the carbon substrate for the urea cycle. As well, exposure to elevated water ammonia levels results in a significant increase in tissue urea-nitrogen concentrations in trout embryos (14Steele S.L. Chadwick T.D. Wright P.A. J. Exp. Biol. 2001; 204: 2145-2154Crossref PubMed Google Scholar). Glutamine synthetase is induced along with the key OUC enzyme, carbamoyl-phosphate synthetase III, and other OUC enzymes during early life stages in rainbow trout (5Wright P.A. Felskie A. Anderson P.M. J. Exp. Biol. 1995; 198: 127-135Crossref PubMed Google Scholar, 14Steele S.L. Chadwick T.D. Wright P.A. J. Exp. Biol. 2001; 204: 2145-2154Crossref PubMed Google Scholar, 15Rice S.D. Stokes R.M. Blaxter J. H.S. The Early Life History of Fish. Springer-Verlag, New York1974: 325-337Crossref Google Scholar, 16Korte J.J. Salo W.L. Cabrera V.M. Wright P.A. Felskie A.K. Anderson P.M. J. Biol. Chem. 1997; 272: 6270-6277Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar) and several other teleost species (17Chadwick T. Wright P.A. J. Exp. Biol. 1999; 202: 2653-2662Crossref PubMed Google Scholar, 18Terjesen B.F. Rønnestad I. Norberg B. Anderson P.M. Comp. Biochem. Physiol. 2000; 126: 521-535Crossref Scopus (33) Google Scholar, 19Terjesen B.F. Chadwick T.D. Verreth J.A. Rønnestad I. Wright P.A. J. Exp. Biol. 2001; 204: 2155-2165Crossref PubMed Google Scholar, 20Barimo J.F. Steele S.L. Wright P.A. Walsh P.J. J. Exp. Biol. 2004; 207: 2011-2020Crossref PubMed Scopus (41) Google Scholar). Indeed, the levels of glutamine synthetase and OUC enzyme activities are high in early stages of trout development relative to adult liver levels (5Wright P.A. Felskie A. Anderson P.M. J. Exp. Biol. 1995; 198: 127-135Crossref PubMed Google Scholar, 16Korte J.J. Salo W.L. Cabrera V.M. Wright P.A. Felskie A.K. Anderson P.M. J. Biol. Chem. 1997; 272: 6270-6277Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). The functional glutamine synthetase enzyme consists of eight identical subunits, with some microheterogeneity between subunits (21Smirnov A.V. Tumani H. Henne S. Barchfeld S. Olgemoller U. Wiltfang J. Lange P. Mader M. Nau R. Clin. Chim. Acta. 2000; 292: 1-12Crossref PubMed Scopus (5) Google Scholar). Developmental expression of glutamine synthetase has been studied in several species. In rat brain, a single glutamine synthetase gene is expressed in 14-day embryos, well before enzyme activity can be detected (22Mearow K.M. Mill J.F. Vitkovic L. Mol. Brain Res. 1989; 6: 223-232Crossref PubMed Scopus (63) Google Scholar). A study of the ontogeny of one glutamine synthetase gene in sea urchin embryos revealed mRNA expression in the unfertilized egg (i.e. of maternal origin), as well as in several embryonic stages (23Fucci L. Piscopo A. Aniello F. Branno M. Di Gregorio A. Calogero R. Geraci G. Gene. 1995; 152: 205-208Crossref PubMed Scopus (11) Google Scholar). There are two glutamine synthetase isoforms in Drosophila with some quantitative variation in the developmental pattern of expression (24Caggese C. Barsanti P. Viggiano L. Bozzetti M.P. Caizzi R. Genetica. 1994; 94: 275-281Crossref PubMed Scopus (23) Google Scholar). It has been estimated that transcriptional activation of the embryonic genome in rainbow trout occurs at about 3 dpf (25Nagler J.J. Fish Physiol. Biochem. 2000; 22: 61-66Crossref Scopus (12) Google Scholar). Glutamine synthetase activity was detected in “eyed up” embryos when the yolk sac was dissected away from the embryonic body (14Steele S.L. Chadwick T.D. Wright P.A. J. Exp. Biol. 2001; 204: 2145-2154Crossref PubMed Google Scholar). Hence, transcription of glutamine synthetase should occur sometime after 3 dpf but well before hatching in rainbow trout. Gene sequences for glutamine synthetase have been reported in several fish species (26Walsh P.J. Handel-Fernandez M.E. Vincek V. Comp. Biochem. Physiol. 1999; 124B: 251-259Crossref Scopus (20) Google Scholar, 27Walsh P.J. Meyer G.D. Medina M. Bernstein M.L. Barimo J.F. Mommsen T.P. J. Exp. Biol. 2003; 206: 1523-1533Crossref PubMed Scopus (42) Google Scholar, 28Mommsen T.P. Busby E.R. von Schalburg K.R. Evans J.C. Osachoff H.L. Elliot M.E. J. Comp. Physiol. B. 2003; 173: 419-427Crossref PubMed Scopus (30) Google Scholar, 29Murray B.W. Busby E.R. Mommsen T.P. Wright P.A. J. Exp. Biol. 2003; 206: 1511-1521Crossref PubMed Scopus (44) Google Scholar, 30Laud P.R. Campbell J.W. J. Mol. Evol. 1994; 39: 93-100Crossref PubMed Scopus (25) Google Scholar). Recently, four glutamine synthetase isoforms were isolated from adult trout tissues, Onmy-GS01–GS04 (29Murray B.W. Busby E.R. Mommsen T.P. Wright P.A. J. Exp. Biol. 2003; 206: 1511-1521Crossref PubMed Scopus (44) Google Scholar). In addition, Onmy-GS01, -GS02, and -GS04 were assigned to three different linkage groups of the rainbow trout map (31Sakamoto T. Danzmann R.G. Gharbi K. Howard P. Ozaki A. Sokkean K. Woram R.A. Okamoto N. Ferguson M.M. Holm L.-E. Guyomard R. Hoyheim B. Genetics. 2000; 155: 1331-1345Crossref PubMed Google Scholar) based on polymorphic sites in the 3′-untranslated region. 2K. Gharbi, R. Danzmann, and M. Ferguson, unpublished observations. Overall, these findings, along with sequence analysis (29Murray B.W. Busby E.R. Mommsen T.P. Wright P.A. J. Exp. Biol. 2003; 206: 1511-1521Crossref PubMed Scopus (44) Google Scholar), support the hypothesis that Onmy-GS01, -GS02, -GS03, and -GS04 are separate loci. Preliminary evidence suggests that mRNA expression of Onmy-GS01–GS04 varies between different adult tissues (29Murray B.W. Busby E.R. Mommsen T.P. Wright P.A. J. Exp. Biol. 2003; 206: 1511-1521Crossref PubMed Scopus (44) Google Scholar), but the functional significance of the four isoforms is not understood. Due to the importance of ammonia detoxification during early development, we decided to first investigate whether one or more of the glutamine synthetase genes are critical in trout embryogenesis. Thus, the aim of this study was to determine the developmental expression of glutamine synthetase and relate these changes to major developmental landmarks (e.g. hatching) and nitrogen excretion. We measured developmental changes in the level of mRNA expression of Onmy-GS01, -GS02, -GS03, and -GS04 from 14 to 80 dpf, as well as in adult liver and skeletal muscle tissue. Glutamine synthetase activities, ammonia and urea-nitrogen excretion rates, and ammonia and urea-nitrogen content were also measured between 3 and 80 dpf. Rainbow trout (O. mykiss Walbaum) embryos were purchased on the day of fertilization from Rainbow Springs Trout Farm (Thamesford, Ontario, Canada) and held in continuous-flow, mesh-bottom incubation trays supplied with local well water (10 °C, pH 8; water hardness 411 mg/liter as CaCO3; Ca2+, 5.24 mEq/liter; Cl–, 1.47 mEq/liter; Mg2+, 2.98 mEq/liter; K+, 0.06 mEq/liter; Na+, 1.05 mEq/liter) at the Hagen Aqualab, University of Guelph, Guelph, Ontario, Canada. Embryos in the incubation trays were shielded from light. The pigmented eye was clearly visible (eyed-up stage) at 14 dpf. After 100% hatching (25–30 days), yolk sac larvae were transferred to mesh-sided, well aerated, floating baskets within a 2-meter circular tank of continuous flow water. Five days after 100% hatching, feeding was administered (1.3–5.0% body weight, Martin Mills Inc., Elmira, Ontario, Canada) via a conveyer belt system. CYA occurred at 50 dpf (juveniles). Adult rainbow trout (donated by the Alma Aquaculture Research Station, Alma, Ontario, Canada) were kept in circular tanks in recirculating, freshwater (10 °C, pH 8) in the Hagen Aqualab, University of Guelph, Guelph, Ontario, Canada. Fish were fed trout pellets (Martin Mills Inc.) daily ad libitum. Nitrogen excretion rates were measured as previously described (5Wright P.A. Felskie A. Anderson P.M. J. Exp. Biol. 1995; 198: 127-135Crossref PubMed Google Scholar). For analysis of total RNA, enzyme activities, and concentrations of ammonia and urea-nitrogen, fish were collected at appropriate stages, quickly blotted dry, immediately frozen in liquid nitrogen, and stored at –80 °C until later analysis (1–3 months). For measurements in adult tissues, fish were killed by a sharp cranial blow, and tissues were immediately removed and frozen in liquid nitrogen, followed by storage at –80 °C until later analysis (1–3 months). Ammonia and Urea-nitrogen Concentration—Water samples were analyzed for ammonia concentration using the indophenol blue method (32Verdouw N.E. van Echted C.J.A. Dekkers E.M.J. Water Res. 1978; 12: 399-402Crossref Scopus (946) Google Scholar). Urea-nitrogen content was measured using a colorimetric assay as described by Rahmatullah and Boyde (33Rahmatullah M. Boyde T.R.C. Clin. Chim. Acta. 1980; 107: 3-9Crossref PubMed Scopus (479) Google Scholar). Ammonia and urea-nitrogen excretion rates were expressed per gram of whole wet embryo (micromoles/g/h). Urea-nitrogen was calculated by accounting for the two nitrogens per urea molecule. Percent urea-nitrogen excretion was calculated as urea-nitrogen excretion rate/(urea-nitrogen excretion rate + ammonia excretion rate) × 100. Whole embryo, tissue, and yolk ammonia and urea-nitrogen concentrations were measured as described by Wright et al. (5Wright P.A. Felskie A. Anderson P.M. J. Exp. Biol. 1995; 198: 127-135Crossref PubMed Google Scholar). The final supernatant was analyzed for ammonia concentration using a Sigma diagnostic kit (171 UV, Sigma-Aldrich Inc., Oakville, Ontario, Canada). Urea-nitrogen concentration was measured using the method described by Rahmatullah and Boyde (32Verdouw N.E. van Echted C.J.A. Dekkers E.M.J. Water Res. 1978; 12: 399-402Crossref Scopus (946) Google Scholar). Ammonia and urea-nitrogen content were expressed as micromoles/g. The turnover time is the amount of time required for an organism to clear the total content of a substance from its system, where turnover time (h) = ammonia or urea-nitrogen tissue content (micromoles/g)/ammonia or urea-nitrogen excretion rate (micromoles/g/h). RNA Extraction and cDNA Synthesis—Total RNA was extracted from 14- and 21-dpf embryos, 31-dpf yolk sac larvae, 60- and 80-dpf juveniles, and adult liver and muscle samples using TRIzol reagent (Invitrogen). An extra phenol:chloroform:isoamyl alcohol (25:24:1) step was added to samples that contained large amounts of yolk (14, 21, and 31 dpf). RNA was stored at –80 °C for up to 6 months. To eliminate possible genomic DNA, total RNA (3 μg) was treated with deoxyribonuclease I, amplification grade (Invitrogen). The DNase-treated total RNA samples were reverse transcribed using the enzyme SuperScript II Reverse Transcriptase (Invitrogen) and primer, Poly-T. Non-reverse transcribed controls were synthesized using the same reaction but substituting diethyl pyrocarbonate-treated water for the SuperScript enzyme. Real-time PCR—mRNA expression of Onmy-GS01–GS04 was quantified from the above cDNA products using the ABI Prism 7000 sequence detection system (Applied Biosystems, Foster City, CA). Primers and dual-labeled probes (Table I) were designed for each gene using PrimerExpress software (version 2.0.0, Applied Biosystems). All probes were dual-labeled with 6-carboxyfluorescein fluorescent reporter at the 3′-end and 6-carboxytetramethylrhodamine quencher at the 5′-end. Each PCR reaction contained a 5-μl template, 12.5 μl of Taqman Universal PCR Master Mix (no AmpErase UNG, Applied Biosystems), and 2.5 μl of forward and reverse primers (9 μm) and probe (2.5 μm). The following conditions were used; 10 min at 95 °C followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. To correct for variability in amplification efficiency between different cDNAs, a standard curve was performed (34Giulietti A. Overbergh L. Valckx D. Decallonne B. Bouillon R. Mathieu C. Methods. 2001; 25: 386-401Crossref PubMed Scopus (1106) Google Scholar) for each glutamine synthetase gene using serial dilutions of cDNA samples from trout brain tissue, known to have high glutamine synthetase activity. The relative dilution of a given sample was extrapolated by linear regression using the threshold cycle of each unknown. To account for differences in cDNA loading and RNA reverse transcriptase efficiency, each sample was normalized to the expression level of the control gene β-actin. Two control genes were tested for consistency of expression between developmental stages; β-actin and 18 S rRNA. The expression of both genes varied over developmental time. When expressed as a ratio with glutamine synthetase mRNA, the ontogenic changes were very similar between glutamine synthetase mRNA:β-actin and glutamine synthetase mRNA:18 S rRNA. Thus, β-actin was used as the control gene. To account for differences in β-actin expression between early stages and adult liver and muscle, the level of expression of β-actin within each group of samples was normalized to a randomly selected “control” group (60 dpf) according to Billiau et al. (35Biliau A.D. Sefrioui H. Overbergh L. Rutgeerts O. Goebels J. Mathieu C. Waer M. Transplantation. 2001; 71: 292-299Crossref PubMed Scopus (31) Google Scholar) as follows: individual value within a group/(mean value within a group/mean value of control group).Table IPrimer and probe sequences for detection of glutamine synthetase gene (Onmy GS01–GS04) expression in rainbow trout embryos using real-time PCRForward primer 5′ → 3′Reverse primer 5′ → 3′Probe 5′ → 3′Length of ampliconbpOnmy-GS01aGenBank™ accession numbers: Onmy-GS01 (AF390021), Onmy-GS02 (AF390022), Onmy-GS03 (AF390023), Onmy-GS04 (AF390024), and β-actin (AJ438158).CTGCAGTCTGTGTTCAGGGTAGACATCTGTCTGGAATTGTTAAGTCCATATACCTTTTGATCACTGCCAACATTGCCC101Onmy-GS02GGCAGTGTCTTTAAATGGCAACAACGCTACAATTGGCAAGACTGACTGTCTCCAGATTTGACACATTCCTGGATCAT136Onmy-GS03GTGTATCAATTTGCTACTCATGTTTAACATAAAATGGGTTCTTGATACAACTTCTACTAAAAGGATCCAAGGTGCATCTGTGTTTTTATACATG191Onmy-GS04TTAATGAAAGATGGTGGCTGACACTGCAGGAAACGCGAGATCCATTGTCTTCCCCTTTTGAGTCTTCTAGTGGG105β-ActinGACCCAGATCATGTTTGAGACCTTCGTAGCCCTCGTAGATGGGTACTACTCCGGTGACGGCGTGACCC152a GenBank™ accession numbers: Onmy-GS01 (AF390021), Onmy-GS02 (AF390022), Onmy-GS03 (AF390023), Onmy-GS04 (AF390024), and β-actin (AJ438158). Open table in a new tab Samples were assayed in triplicate with only one target gene assayed per well. One PCR reaction from each primer set was purified using a QIAquick PCR purification kit (Qiagen) and sequenced to ensure that each primer set was only amplifying the target sequence. Non-reverse transcribed RNA and water-only controls were run to ensure that no genomic DNA was being amplified and that reagents were not contaminated. Glutamine Synthetase Activity—Enzyme activity was measured in early stages (3, 10, 21, 31, 60, and 80 dpf) and adult tissue homogenates, prepared as previously described (5Wright P.A. Felskie A. Anderson P.M. J. Exp. Biol. 1995; 198: 127-135Crossref PubMed Google Scholar). Glutamine synthetase activities were calculated from the amount of product (γ-glutamyl hydroxamate) formed via the γ-glutamyl transferase reaction (36Shankar R.A. Anderson P.M. Arch. Biochem. Biophys. 1985; 239: 248-259Crossref PubMed Scopus (89) Google Scholar) from 0 to 30 min at 26 °C. Activity was expressed as the number of micromoles of product formed per gram of wet weight tissue per minute (μmol/g/min). Statistical Analyses—Changes in variables during development were analyzed using least squares linear regression. If inspection suggested a non-linear approach would be more appropriate, this was tested with an F-test. GraphPad Prism (version 3.00, GraphPad Software, San Diego, CA) was used to calculate linear and non-linear fits and to compare fits. Levels in the yolk were compared with those in the embryo using a paired t test. The t tests were used to test if low values were significantly different from zero. If there was no obvious linear or non-linear relation of a variable with dpf, then ANOVA and the Tukey's test were used to test for differences during development. Statistical analysis for glutamine synthetase mRNA expression was performed using SigmaStat software version 3.00 (SPSS Inc., Chicago, IL). Expression of Onmy-GS01–GS04 was compared using one-way ANOVA and a Dunn's post-hoc test. All values are presented as means ± S.E., and significant differences were detected at p < 0.05. Nitrogen Excretion and Ammonia and Urea-nitrogen Content—The rate of ammonia excretion increased in a linear manner during early life stages (r2 = 0.94; Fig. 1A). Urea-nitrogen excretion was not detectable at 3 dpf (t test, t = 1.89, p = 0.12); then it increased in a sigmoidal manner (a sigmoidal fit significantly better than a linear fit, F2,32 = 6.748, p = 0.0036; Fig. 1B). The percentage of nitrogen excreted as urea was much less than ammonia but increased over time (ANOVA, F4,28 = 26.53, p = 0.000; Fig. 1C). About 8% of nitrogen was excreted as urea up to day 31 and about 22% at 60 and 80 dpf (Tukey, p < 0.001); it was not different between days 10 and 31 (Tukey, p > 0.3) or between days 60 and 80 (Tukey, p > 0.8). Ammonia concentration in the whole embryo was increased in a linear fashion during early development (Fig. 2A). Ammonia concentration in the yolk was more than twice that of the larvae at 31 dpf (paired t test, t = 8.15, p = 0.000; Fig. 2A). Urea-nitrogen concentration was low before hatching, increased during hatching, and then decreased after hatching (non-linear fit better than linear fit, F1,33 = 158.6, p < 0.001; Fig. 2B). Urea-nitrogen concentration was ∼10% greater in the larvae than in the yolk at 31 dpf (paired t test, t = 2.97, p = 0.031; Fig. 2B). The ammonia turnover time (time required to clear the embryo of its ammonia content) was initially very long at 3 dpf, but then rapidly decreased by 10 dpf (non-linear sigmoidal fit better than a linear fit, F2,32 = 149.2, p < 0.001; Fig. 2C). At 10 dpf ammonia turnover was ∼1 day, at 21 dpf it was about one-half day, and at 60 and 80 dpf total ammonia content was turning over every 3 h. Urea-nitrogen turnover was high before hatching and decreased after hatching; it could not be calculated at 3 dpf, because urea-nitrogen excretion was not detectable (Fig. 2C). Urea-nitrogen turnover times at 10 and 21 dpf were ∼1 week and significantly greater than those at 31–80 dpf (ANOVA, Tukey, p < 0.004). Urea-nitrogen turnover times at 10 and 21 dpf were not different (Tukey, p > 0.4) and also did not differ between 31, 60, and 80 dpf (Tukey, p > 0.2). Similar to ammonia turnover times, urea-nitrogen was turning over about every 3 h at 60 and 80 dpf. Glutamine Synthetase mRNA Expression and Enzyme Activity—All four glutamine synthetase genes were expressed during early development (Fig. 3). At 14 dpf, the level of expression of Onmy-GS01–GS04 was relatively low, but -GS01 and -GS03 were clearly the first genes expressed. By 21 dpf, Onmy-GS01 and -GS03 mRNA levels were significantly higher than at 14 dpf (11- and 18-fold, respectively) and the level of Onmy-GS02 and -GS04 mRNA remained low (ANOVA, Dunn's, p < 0.05; Table II, Fig. 3). By 31 dpf, just after hatch, all four glutamine synthetase genes were expressed, with Onmy-GS03 significantly higher than Onmy-GS01, -GS02, and -GS04. At several developmental stages, glutamine synthetase mRNA levels were higher relative to expression in adult liver and muscle tissue (Table II). For example, Onmy-GS01 mRNA levels were ∼10-fold higher at 21 and 80 dpf relative to adult muscle tissue. Onmy-GS03 expression was 71- and 107-fold higher at 21 dpf relative to levels in muscle and liver, respectively. Onmy-GS02 and -GS04 expression were relatively low throughout early development.Table IIStatistical comparisons in relative mRNA expression of glutamine synthetase genes (Onmy GS01–GS04) between early developmental and adult tissues of rainbow troutdpf14 GS04EmbryoLiverSkeletal muscle21316080GS01GS02GS03GS04GS02GS03GS04GS02GS04GS01GS02GS04GS03GS04GS01GS02GS03GS0414GS01—aSignificantly different from a different gene at the same developmental stage (p < 0.05).—bSignificantly different from the same gene at a different developmental stage (p < 0.05).—bSignificantly different from the same gene at a different developmental stage (p < 0.05).GS02—bSignificantly different from the same gene at a different developmental stage (p < 0.05).—bSignificantly different from the same gene at a different developmental stage (p < 0.05).GS03—aSignificantly different from a different gene at the same developmental stage (p < 0.05).—bSignificantly different from the same gene at a different developmental stage (p < 0.05).GS04—bSignificantly different from the same gene at a different developmental stage (p < 0.05).21GS01—aSignificantly different from a different gene at the same developmental stage (p < 0.05).—bSignificantly different from the same gene at a different developmental stage (p < 0.05).GS03—aSignificantly different from a different gene at the same developmental stage (p < 0.05).—aSignificantly different from a different gene at the same developmental stage (p < 0.05).—bSignificantly different from the same gene at a different developmental stage (p < 0.05).—bSignificantly different from the same gene at a different developmental stage (p < 0.05).31GS01—aSignificantly different from a different gene at the same developmental stage (p < 0.05).GS02—aSignificantly different from a different gene at the same developmental stage (p < 0.05).—bSignificantly different from the same gene at a different developmental stage (p < 0.05).GS03—aSignificantly different from a different gene at the same developmental stage (p < 0.05).—bSignificantly different from the same gene at a different developmental stage (p < 0.05).60GS01—aSignificantly different from a different gene at the same developmental stage (p < 0.05).—aSignificantly different from a different gene at the same developmental stage (p < 0.05).GS04—bSignificantly different from the same gene at a different developmental stage (p < 0.05).80GS01—aSignificantly different from a different gene at the same developmental stage (p < 0.05).—bSignificantly different from the same gene at a different developmental stage (p < 0.05).GS02—bSignificantly different from the same gene at a different developmental stage (p < 0.05).GS04—bSignificantly different from the same gene at a different developmental stage (p < 0.05).—bSignificantly different from the same gene at a different developmental stage (p < 0.05).a Significantly different from a different gene at the same developmental stage (p < 0.05).b Significantly different from the same gene at a different developmental stage (p < 0.05). Open table in a new tab Glutamine synthetase activity in the whole embryo increased in a linear fashion during early life stages (r2 = 0.98; Fig. 4). Glutamine synthetase activity was relatively low in all adult tissues examined, except brain, where activity was observed to be ∼200-fold greater than that found in the next highest tissue (liver) (Tukey, p < 0.05; Fig. 5).Fig. 5Activity of glutamine synthetase in six tissues of adult rainbow trout. Values are means ± S.E. (n = 6). An asterisk denotes a significant difference in glutamine synthetase activity relative to other tissues. B, brain; Sp, spleen; M, white muscle; I, large intestine; Sk, skin; L, liver.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Four glutamine synthetase loci are found in rainbow trout. Two distinct evolutionary lineages, Onmy-GS01/03 and Onmy-GS02/04, were identified (29Murray B.W. Busby E.R. Mommsen T.P. Wright P.A. J. Exp. Biol. 2003; 206: 1511-1521Crossref PubMed Scopus (44) Google Scholar) indicating at least two rounds of gene duplications. The gene pairs in each lineage most likely represent the results of the ancestral salmonid tetraploidization event estimated to have occurred 25–100 million years ago (37Allendorf F.W. Thorgaard G.H. Turner B.J. Evolutionary Genetics of Fishes. Plenum Press, New York1984: 1-46Crossref Google Scholar). The coding sequences of these isoforms are very similar, whereas the 3′-untranslated regions are more diverged. The nucleotide sequences of the 3′-untranslated region for Onmy-GS01 and -GS03 were 81% homologous, whereas Onmy-GS02 and -GS04 were 79% homologous. The low level of variation in the coding sequence of the isoforms made probe and primer design for mRNA analysis rather tricky. The approach we selected was real-time PCR using a gene-specific probe and set of primers that matched unique 3′-untranslated region sequences in each isoform. In preliminary trials, a subsample of each reaction was sequenced, and we confirmed that only one glutamine synthetase isoform was amplified for each set of primers. The results of this study support our previous evidence (29Murray B.W. Busby E.R. Mommsen T.P. Wright P.A. J. Exp. Biol. 2003; 206: 1511-1521Crossref PubMed Scopus (44) Google Scholar) that the four isoforms of glutamine synthetase in trout (Onmy-GS01–GS04) are derived from separate genes. First, all four glutamine synthetase isoforms were expressed during early development and second, the relative mRNA levels varied between isoforms depending on the developmental age or tissue type. The pattern of mRNA expression observed suggests that Onmy-GS01 and -GS03 play a more important role during very early embryonic stages (14–31 dpf) compared with Onmy-GS02 and -GS04. In other words, we presume that the functional octomeric enzyme would have a proportionally higher ratio of Onmy-GS01 and -GS03 subunits relative to Onmy-GS02 and -GS04 at these early stages. Interestingly, these gene pairings correspond to the two distinct evolutionary lineages identified above. It may be that the duplicated genes (e.g. Onmy-GS01 and -GS03) have developed specialized regulatory subfunctions within the embryo. For example, at the time when we observed a large induction of Onmy-GS01 and -GS03 (14–21 dpf), the cerebral hemispheres thicken and become prominent (38Ballard W.W. J. Exp. Zool. 1973; 184: 7-26Crossref Scopus (152) Google Scholar). Further studies are necessary to determine if Onmy-GS01 and -GS03 mRNA in embryos levels are higher in brain tissue relative to other tissues and if these isoforms play a role in neural development. The timing of the induction of glutamine synthetase during early life stages may have particular significance for ammonia detoxification. As stated in the Introduction, the encapsulated salmonid embryo catabolizes endogenous yolk proteins and amino acids resulting in ammonia generation at a time when ammonia elimination is not efficient. Indeed, ammonia concentrations rose by about 2-fold between 3 and 31 dpf, despite a steep linear increase in the rate of ammonia excretion. It should be noted that the higher yolk ammonia content relative to the embryonic body at 31 dpf probably is related to pH differences between these compartments (8Rahaman-Noronha E. O'Donnell M.J. Pilley C.M. Wright P.A. J. Exp. Biol. 1996; 199: 2713-2723Crossref PubMed Google Scholar). The elevation of ammonia in the embryo, however, may have been contained by the induction of glutamine synthetase. In fact, glutamine synthetase activity in young trout (e.g. 21 dpf) was comparable to activities in adult liver and other tissues. This is surprising given that the glutamine synthetase assay was performed on whole embryos (i.e. yolk plus embryonic body: 3, 10, and 21 dpf) where the presence of the relatively large yolk mass would dilute the embryonic tissue enzyme activity. Glutamine synthetase activities in the current study are consistent with those reported for adult trout (16Korte J.J. Salo W.L. Cabrera V.M. Wright P.A. Felskie A.K. Anderson P.M. J. Biol. Chem. 1997; 272: 6270-6277Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 39Todgham A. Anderson P.M. Wright P.A. Comp. Biochem. Physiol. A. 2001; 129: 527-539Crossref PubMed Scopus (27) Google Scholar) and embryos (14Steele S.L. Chadwick T.D. Wright P.A. J. Exp. Biol. 2001; 204: 2145-2154Crossref PubMed Google Scholar). Our embryo data suggest that the early induction of Onmy-GS01 and -GS03 is preparatory for the increased capacity of the embryo to synthesize glutamine from excess ammonia before and just after hatching. Glutamine produced via the glutamine synthetase reaction during embryogenesis may be stored or shuttled to other pathways, such as the OUC (5Wright P.A. Felskie A. Anderson P.M. J. Exp. Biol. 1995; 198: 127-135Crossref PubMed Google Scholar, 13Dépêche J. Gilles R. Daufresne S. Chiapello H. Comp. Biochem. Physiol. 1979; 63A: 51-56Crossref Scopus (61) Google Scholar, 14Steele S.L. Chadwick T.D. Wright P.A. J. Exp. Biol. 2001; 204: 2145-2154Crossref PubMed Google Scholar, 16Korte J.J. Salo W.L. Cabrera V.M. Wright P.A. Felskie A.K. Anderson P.M. J. Biol. Chem. 1997; 272: 6270-6277Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). In the present study, urea was clearly synthesized before hatch. There was an increase in urea-nitrogen concentration when the rate of urea-nitrogen excretion remained very low. The key OUC enzyme, carbamoyl-phosphate synthetase III, along with other OUC enzymes is induced before hatching in rainbow trout (5Wright P.A. Felskie A. Anderson P.M. J. Exp. Biol. 1995; 198: 127-135Crossref PubMed Google Scholar, 14Steele S.L. Chadwick T.D. Wright P.A. J. Exp. Biol. 2001; 204: 2145-2154Crossref PubMed Google Scholar, 16Korte J.J. Salo W.L. Cabrera V.M. Wright P.A. Felskie A.K. Anderson P.M. J. Biol. Chem. 1997; 272: 6270-6277Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Indeed, carbamoyl-phosphate synthetase III mRNA was detected as early as 3 dpf but peaked at 10–14 dpf in trout embryos raised under similar conditions to the present study (16Korte J.J. Salo W.L. Cabrera V.M. Wright P.A. Felskie A.K. Anderson P.M. J. Biol. Chem. 1997; 272: 6270-6277Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Thus, part of the glutamine synthesized in the embryo is undoubtedly converted to urea via the OUC. Urea excretion in young trout constitutes a relatively small component of total nitrogen excretion (8–22%), similar to adult trout (reviewed in Ref. 40Wood C.M. Evans D.H. The Physiology of Fishes. CRC Press, Boca Raton1993: 379-425Google Scholar). The rate of urea elimination was initially slow and urea accumulated in the embryo prior to hatching, resulting in relatively long turnover times (∼1 week) compared with ammonia (0.5–1 day). The observed differences in turnover time may relate to the lower permeability of urea relative to ammonia (adult rainbow trout gill: urea 2.6 × 10–6 cm/s (41Pärt P. Wright P.A. Wood C.M. Comp. Biochem. Physiol. 1998; 119A: 117-123Crossref Scopus (87) Google Scholar) versus NH3, 1.5 × 10–4 cm/s – 2.3 × 10–3 cm/s (42Kelly S. Wood C. J. Exp. Biol. 2001; 204: 4115-4124Crossref PubMed Google Scholar)). Urea excretion is dependent, in part, on a phloretin-sensitive, saturable (Km = 2 mm) urea transporter in rainbow trout embryos (43Pilley C.M. Wright P.A. J. Exp. Biol. 2000; 203: 3199-3207Crossref PubMed Google Scholar), as has been documented in other teleost tissues (44Walsh P.J. Heitz M. Campbell C.E. Cooper G.J. Medina M. Wang Y.S. Goss G.G. Vincek V. Wood C.M. Smith C.P. J. Exp. Biol. 2000; 203: 2357-2364Crossref PubMed Google Scholar, 45Walsh P.J. Grosell M. Goss G.G. Bergman H.L. Bergman A.N. Wilson P. Laurent P. Alper S.L. Smith C.P. Kamunde C. Wood C.M. J. Exp. Biol. 2001; 204: 509-520Crossref PubMed Google Scholar, 46Mistry A.C. Honda S. Hirata T. Kato A. Hirose S. Am. J. Physiol. 2001; 281: R1594-R1604Crossref PubMed Google Scholar). If the full expression of this transporter does not occur until after the gills are completely functional (at hatch gills account for only ∼4% of the potential respiratory surface area (9Rombough P.J. Moroz B.M. J. Exp. Biol. 1990; 154: 1-12Crossref Google Scholar)), then this might explain the longer urea turnover times. The developmental timing of the rainbow trout urea transporter is unknown, but warrants further study. We compared Onmy-GS01–GS04 mRNA levels in young trout with two adult tissues, liver and skeletal muscle. Overall, expression of the four glutamine synthetase isoforms in these two adult tissues was very low, with only trace levels of Onmy-GS04. The lack of Onmy-GS04 expression in liver and muscle tissue agrees with Northern analysis of trout tissues (29Murray B.W. Busby E.R. Mommsen T.P. Wright P.A. J. Exp. Biol. 2003; 206: 1511-1521Crossref PubMed Scopus (44) Google Scholar). Taken together, one might suspect that Onmy-GS01, -GS02, -GS03, and -GS04 are not co-expressed in adult tissues, but this is not the case. In a separate study, we have detected significant levels of mRNA for all four glutamine synthetase isoforms in three regions of the rainbow trout brain. 3P. Wright, S. Steele, A. Huitema, and N. Bernier, unpublished observations. The glutamine synthetase activity in the brain is three orders of magnitude higher compared with other adult tissues. Brain glutamine synthetase has an important role in regulating neurotransmitter metabolism, as well as detoxifying ammonia (47Cooper A.J.L. Plum F. Physiol. Rev. 1987; 67: 440-519Crossref PubMed Scopus (695) Google Scholar). Hence, there is differential expression of Onmy-GS01–GS04 in adult trout tissues, and the pattern of expression in adult tissue does not follow the Onmy-GS01/03 and -GS02/04 pairings observed during early life stages. We thank Marcie Ninness, Jason Bystriansky, Tammy Rodela, and Jake Robinson for collecting tissues." @default.
• W2025448306 created "2016-06-24" @default.
• W2025448306 creator A5010128596 @default.
• W2025448306 creator A5011549864 @default.
• W2025448306 creator A5016504168 @default.
• W2025448306 creator A5026113930 @default.
• W2025448306 creator A5040132153 @default.
• W2025448306 creator A5065836106 @default.
• W2025448306 date "2005-05-01" @default.
• W2025448306 modified "2023-10-01" @default.
• W2025448306 title "Expression of Four Glutamine Synthetase Genes in the Early Stages of Development of Rainbow Trout (Oncorhynchus mykiss) in Relationship to Nitrogen Excretion" @default.
• W2025448306 cites W1505700963 @default.
• W2025448306 cites W1510651465 @default.
• W2025448306 cites W1534304595 @default.
• W2025448306 cites W1892151460 @default.
• W2025448306 cites W1895834193 @default.
• W2025448306 cites W1942398216 @default.
• W2025448306 cites W1990725516 @default.
• W2025448306 cites W1998368066 @default.
• W2025448306 cites W2008481607 @default.
• W2025448306 cites W2012264720 @default.
• W2025448306 cites W2017002459 @default.
• W2025448306 cites W2019215245 @default.
• W2025448306 cites W2025835879 @default.
• W2025448306 cites W2035799547 @default.
• W2025448306 cites W2036697630 @default.
• W2025448306 cites W2053867282 @default.
• W2025448306 cites W2056296836 @default.
• W2025448306 cites W2060979602 @default.
• W2025448306 cites W2061731183 @default.
• W2025448306 cites W2061976040 @default.
• W2025448306 cites W2068622596 @default.
• W2025448306 cites W2077996833 @default.
• W2025448306 cites W2078409703 @default.
• W2025448306 cites W2096809135 @default.
• W2025448306 cites W2104060958 @default.
• W2025448306 cites W2107965399 @default.
• W2025448306 cites W2119408585 @default.
• W2025448306 cites W2128088040 @default.
• W2025448306 cites W2128240055 @default.
• W2025448306 cites W2131558469 @default.
• W2025448306 cites W2133127716 @default.
• W2025448306 cites W2134066007 @default.
• W2025448306 cites W2137370690 @default.
• W2025448306 cites W2138983501 @default.
• W2025448306 cites W2146160301 @default.
• W2025448306 cites W2160417894 @default.
• W2025448306 cites W2182300265 @default.
• W2025448306 cites W2183427423 @default.
• W2025448306 cites W2285252922 @default.
• W2025448306 cites W2372821928 @default.
• W2025448306 cites W4235878783 @default.
• W2025448306 doi "https://doi.org/10.1074/jbc.m412338200" @default.
• W2025448306 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15781468" @default.
• W2025448306 hasPublicationYear "2005" @default.
• W2025448306 type Work @default.
• W2025448306 sameAs 2025448306 @default.
• W2025448306 citedByCount "75" @default.
• W2025448306 countsByYear W20254483062012 @default.
• W2025448306 countsByYear W20254483062013 @default.
• W2025448306 countsByYear W20254483062014 @default.
• W2025448306 countsByYear W20254483062015 @default.
• W2025448306 countsByYear W20254483062016 @default.
• W2025448306 countsByYear W20254483062017 @default.
• W2025448306 countsByYear W20254483062018 @default.
• W2025448306 countsByYear W20254483062019 @default.
• W2025448306 countsByYear W20254483062020 @default.
• W2025448306 countsByYear W20254483062021 @default.
• W2025448306 countsByYear W20254483062022 @default.
• W2025448306 countsByYear W20254483062023 @default.
• W2025448306 crossrefType "journal-article" @default.
• W2025448306 hasAuthorship W2025448306A5010128596 @default.
• W2025448306 hasAuthorship W2025448306A5011549864 @default.
• W2025448306 hasAuthorship W2025448306A5016504168 @default.
• W2025448306 hasAuthorship W2025448306A5026113930 @default.
• W2025448306 hasAuthorship W2025448306A5040132153 @default.
• W2025448306 hasAuthorship W2025448306A5065836106 @default.
• W2025448306 hasBestOaLocation W20254483061 @default.
• W2025448306 hasConcept C10146269 @default.
• W2025448306 hasConcept C104317684 @default.
• W2025448306 hasConcept C185592680 @default.
• W2025448306 hasConcept C2779289688 @default.
• W2025448306 hasConcept C2779349466 @default.
• W2025448306 hasConcept C2909208804 @default.
• W2025448306 hasConcept C2994167347 @default.
• W2025448306 hasConcept C505870484 @default.
• W2025448306 hasConcept C515207424 @default.
• W2025448306 hasConcept C55493867 @default.
• W2025448306 hasConcept C86803240 @default.
• W2025448306 hasConcept C90856448 @default.
• W2025448306 hasConceptScore W2025448306C10146269 @default.
• W2025448306 hasConceptScore W2025448306C104317684 @default.
• W2025448306 hasConceptScore W2025448306C185592680 @default.
• W2025448306 hasConceptScore W2025448306C2779289688 @default.
• W2025448306 hasConceptScore W2025448306C2779349466 @default.
• W2025448306 hasConceptScore W2025448306C2909208804 @default.
• W2025448306 hasConceptScore W2025448306C2994167347 @default.
• W2025448306 hasConceptScore W2025448306C505870484 @default.

• next