FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2025811990> ?p ?o ?g. }

• W2025811990 endingPage "26476" @default.
• W2025811990 startingPage "26468" @default.
• W2025811990 abstract "Embryonic stem (ES) cells are pluripotent-undifferentiated cells that have a great interest for the investigation of developmental biology. Murine ES cells maintain their pluripotency by the supplementation of the leukemia inhibitory factor (LIF). LIF is reported to act as a matrix-anchored form, and immobilized cytokines are useful to sustain their signaling on target cells. In this study, we used the immobilizable fusion protein composed of LIF and IgG-Fc region, which was used as a model of the matrix-anchored form of LIF to establish a novel system for ES cell culture and to investigate the effect of immobilized LIF on maintenance of ES cell pluripotency. Mouse ES cells maintained their undifferentiated state on the surface coated with LIF-Fc. Furthermore, when cultured on the co-immobilized surface with LIF-Fc and E-cadherin-Fc, mouse ES cells showed characteristic scattering morphologies without colony formation, and they could maintain their undifferentiated state and pluripotency without additional LIF supplementation. The activation of LIF signaling was sustained on the co-immobilized surface. These results indicate that immobilized LIF and E-cadherin can maintain mouse ES cells efficiently and that the immobilizable LIF-Fc fusion protein is useful for the investigation of signaling pathways of an immobilized form of LIF in the maintenance of ES cell pluripotency. Embryonic stem (ES) cells are pluripotent-undifferentiated cells that have a great interest for the investigation of developmental biology. Murine ES cells maintain their pluripotency by the supplementation of the leukemia inhibitory factor (LIF). LIF is reported to act as a matrix-anchored form, and immobilized cytokines are useful to sustain their signaling on target cells. In this study, we used the immobilizable fusion protein composed of LIF and IgG-Fc region, which was used as a model of the matrix-anchored form of LIF to establish a novel system for ES cell culture and to investigate the effect of immobilized LIF on maintenance of ES cell pluripotency. Mouse ES cells maintained their undifferentiated state on the surface coated with LIF-Fc. Furthermore, when cultured on the co-immobilized surface with LIF-Fc and E-cadherin-Fc, mouse ES cells showed characteristic scattering morphologies without colony formation, and they could maintain their undifferentiated state and pluripotency without additional LIF supplementation. The activation of LIF signaling was sustained on the co-immobilized surface. These results indicate that immobilized LIF and E-cadherin can maintain mouse ES cells efficiently and that the immobilizable LIF-Fc fusion protein is useful for the investigation of signaling pathways of an immobilized form of LIF in the maintenance of ES cell pluripotency. ES 3The abbreviations used are: ESembryonic stemLIFleukemia inhibitory factorFBSfetal bovine serumPBSphosphate-buffered salineBSAbovine serum albuminMAPKmitogen-activated protein kinaseELISAenzyme-linked immunosorbent assayRTreverse transcriptionE-cadE-cadherinALPalkaline phosphatase. cells are pluripotent-undifferentiated cells derived from the inner cell mass of a blastocyst, and they retain the potentiality of multilineage differentiation in vitro and self-renewal activity (1Evans M.J. Kaufman M. Nature. 1981; 292: 154-156Crossref PubMed Scopus (6534) Google Scholar, 2Martin G.R. Proc. Natl. Acad. Sci. U. S. A. 1981; 78: 7634-7638Crossref PubMed Scopus (4355) Google Scholar). For the maintenance of pluripotency, mouse ES cells are cultured on a feeder layer of mouse embryonic fibroblasts (MEF) or incubated with LIF that is produced by MEF. LIF is a pleiotropic cytokine, which induces the differentiation of leukemia cell lines into macrophages (3Gearing D.P. Gough N.M. King J.A. Hilton D.J. Nicola N.A. Simpson R.J. Nice E.C. Kelso A. Metcalf D. EMBO J. 1987; 6: 3995-4002Crossref PubMed Scopus (457) Google Scholar) and the expression of acute phase proteins in hepatocytes (4Baumann H. Wong G.G. J. Immunol. 1989; 143: 1163-1167PubMed Google Scholar), as well as inhibits proliferation of endothelial cells (5Ferrara N. Winer J. Henzel W.J. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 698-702Crossref PubMed Scopus (117) Google Scholar). embryonic stem leukemia inhibitory factor fetal bovine serum phosphate-buffered saline bovine serum albumin mitogen-activated protein kinase enzyme-linked immunosorbent assay reverse transcription E-cadherin alkaline phosphatase. Several studies suggest that the biological signals of growth factors and cytokines are mediated by two different forms, the secreted form and the cell membrane- or matrix-anchored forms, which stimulate different signal transduction cascades (6Grell M. Douni E. Wajant H. Lohden M. Clauss M. Maxeiner B. Georgopoulos S. Lesslauer W. Kollias G. Pfizenmaier K. Scheurich P. Cell. 1995; 83: 793-802Abstract Full Text PDF PubMed Scopus (1172) Google Scholar, 7Singh A.B. Tsukada T. Zent R. Harris R.C. J. Cell Sci. 2004; 117: 1365-1379Crossref PubMed Scopus (41) Google Scholar, 8Tanaka Y. Kimata K. Adams D.H. Eto S. Proc. Assoc. Am. Physicians. 1998; 110: 118-125PubMed Google Scholar). It is reported that the LIF signal is mediated by either a soluble form or by a form bound to extracellular matrices, both of which induce different effects on cells (9Rathjen P.D. Toth S. Willis A. Heath J.K. Smith A.G. Cell. 1990; 62: 1105-1114Abstract Full Text PDF PubMed Scopus (223) Google Scholar, 10Mereau A. Grey L. Piquet-Pellorce C. Heath J.K. J. Cell Biol. 1993; 122: 713-719Crossref PubMed Scopus (55) Google Scholar). Recently, we reported the application of immobilizable fusion proteins for the analysis of cell function, and we also reported the establishment of a culture system for stem cells (11Nagaoka M. Koshimizu U. Yuasa S. Hattori F. Chen H. Tanaka T. Okabe M. Fukuda K. Akaike T. PLoS ONE. 2006; 1: e15Crossref PubMed Scopus (117) Google Scholar, 12Nagaoka M. Ise H. Harada I. Koshimizu U. Maruyama A. Akaike T. J. Cell. Biochem. 2008; 103: 296-310Crossref PubMed Scopus (27) Google Scholar, 13Ogiwara K. Nagaoka M. Cho C.S. Akaike T. Biochem. Biophys. Res. Commun. 2006; 345: 255-259Crossref PubMed Scopus (29) Google Scholar). When cells were cultured on the fusion protein of E-cadherin and IgG Fc domain (E-cad-Fc), they showed scattering behavior and high proliferative ability (11Nagaoka M. Koshimizu U. Yuasa S. Hattori F. Chen H. Tanaka T. Okabe M. Fukuda K. Akaike T. PLoS ONE. 2006; 1: e15Crossref PubMed Scopus (117) Google Scholar). We also reported the novel method of immobilizing epidermal growth factor as a juxtacrine model, and we applied this system to the analysis of the function of immobilized epidermal growth factor on hepatocytes (13Ogiwara K. Nagaoka M. Cho C.S. Akaike T. Biochem. Biophys. Res. Commun. 2006; 345: 255-259Crossref PubMed Scopus (29) Google Scholar). In this study, we focused on the effect of the immobilized form of LIF on the maintenance of ES cell features, and we used LIF and IgG-Fc region to design the immobilizable fusion protein (LIF-Fc). By using this model protein, we investigated the effect of immobilized LIF on maintenance of ES cell pluripotency. Furthermore, to establish an effective culture system of mouse ES cells, we applied the co-immobilized surface of E-cad-Fc and LIF-Fc. Cell Culture—We used the following mouse ES cell lines: two feeder-dependent ES cell lines, Jxl1 cells (established from 129/SvJ x 129/SvImJ mice) and R1 cells (14Nagy A. Rossant J. Nagy R. Abramow-Newerly W. Roder J.C. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8424-8428Crossref PubMed Scopus (1992) Google Scholar); and feeder-free EB3 cells (15Niwa H. Masui S. Chambers I. Smith A.G. Miyazaki J. Mol. Cell. Biol. 2002; 22: 1526-1536Crossref PubMed Scopus (249) Google Scholar). Jxl1 and R1 cells were maintained on mouse embryonic fibroblasts in Dulbecco's modified Eagle's medium (Chemicon), supplemented with 1% nonessential amino acids (Chemicon), 0.1 mm β-mercaptoethanol (Sigma), 15% (v/v) fetal bovine serum (FBS), and 1,000 units/ml LIF. For several experiments, Jxl1 and R1 cells were adapted to the feeder-free culture condition. Cells were seeded in the media containing 15% knock-out serum replacement (Invitrogen) and 5,000 units/ml LIF. EB3 cells were maintained on 0.1% gelatin-coated surfaces in knock-out/Dulbecco's modified Eagle's medium (Invitrogen), supplemented with 1 mm l-glutamine, 1% nonessential amino acids (Invitrogen), 0.1 mm β-mercaptoethanol (Sigma), 20% (v/v) FBS, and 2,000 units/ml ESGRO (Chemicon). Cells were passaged every 2 or 3 days with 0.25% trypsin, 1.0 mm EDTA solution (Invitrogen). M1 (D+) cells (provided by Cell Resource Center for Biomedical Research, Tohoku University) were cultured in RPMI 1640 medium (Invitrogen) supplemented with 10% (v/v) FBS. All media contained 50 μg/ml penicillin, 50 μg/ml streptomycin, and 100 μg/ml neomycin. Construction and Purification of Fusion Proteins—Expression and purification of E-cad-Fc fusion proteins were described previously (16Nagaoka M. Akaike T. Protein Eng. 2003; 16: 243-245Crossref PubMed Scopus (29) Google Scholar). In brief, the E-cadherin extracellular domain cDNA, which was generated from mouse E-cadherin full-length cDNA provided by the RIKEN BRC DNA Bank (code 1184), and mutated mouse IgG1-Fc domain cDNA (T252M/T254S), which have high affinity to protein A, were ligated with pRC/CMV (Invitrogen) fragment to generate the expression vector “pRC-ECFC.” Using Lipofectamine reagent (Invitrogen) according to the manufacturer's directions, CHO-K1 cells were transfected with pRC-ECFC. After selection of a highly expressing clone (4G7) with 400 μg/ml G418 (Invitrogen), conditioned media were collected. To construct LIF-Fc, the cDNA that encodes mouse LIF was amplified with KOD plus DNA polymerase (TOYOBO) from the cDNA of mouse embryonic fibroblasts. The specific primer pair for mouse LIF was used for amplification: 5′-AAG CTT CAT AAT GAA GGT CTT GGC CG-3′ and 5′-GCG GCC GCT GAA GGC CTG GAC CAC CAC AC-3′; the underlining represents the HindIII and NotI recognition sites, respectively. To generate pRC-LIF-Fc vector, pGEM-T easy vector (Pro-mega) containing mouse LIF cDNA was digested by HindIII and NotI and subcloned into pRC/CMV vector containing mutated mouse Fc fragment cDNA (16Nagaoka M. Akaike T. Protein Eng. 2003; 16: 243-245Crossref PubMed Scopus (29) Google Scholar). CHO-K1 cells were transfected with pRC-LIF-Fc vector, and a highly expressing clone was selected as mentioned above. The fusion proteins were loaded onto a rProtein A FF column (GE Healthcare). The column was washed with 20 mm phosphate buffer (pH 7.0), and the bound proteins were eluted using 0.1 m sodium citrate (pH 2.7) followed by neutralization with a 1/5 volume of 1.0 m Tris-HCl (pH 9.0). Eluates were dialyzed for 3 days in PBS containing 0.9 mm CaCl2 and 0.9 mm MgCl2. To prepare the coated surface with E-cad-Fc and/or LIF-Fc, purified E-cad-Fc and LIF-Fc solution was directly added to nontreated polystyrene plates at the indicated concentration. After 2 h of incubation at 37 °C, plates were washed with PBS once, and then cells were seeded. Western Blot Analysis—The total cellular protein was extracted with lysis buffer (20 mm Tris-HCl (pH 7.4), 150 mm NaCl, 1% Nonidet P40, 1% Triton X-100, 1 mm Na3VO4, 1 mm NaF, and proteinase inhibitors), and cell lysates were centrifuged at 17,860 × g for 15 min. Protein concentration of the supernatant was measured using a DC protein assay kit (Bio-Rad), and samples were separated by electrophoresis on 7.5% polyacrylamide gels and electrophoretically transferred to a polyvinylidene difluoride membrane (Immobilon-P; Millipore). Blots were probed with anti-murine LIF antibody (Chemicon), anti-STAT3 antibody (BD Biosciences), anti-phospho-STAT3 (Tyr-705) antibody (Cell Signaling Technology), anti-p44/42 MAPK antibody (Cell Signaling Technology), anti-LIF receptor antibody (Santa Cruz Biotechnology), anti-gp130 antibody (Santa Cruz Biotechnology), or anti-phospho-p44/42 MAPK (Thr-202/Tyr-204) antibody (Cell Signaling Technology), followed by horseradish peroxidase-conjugated secondary antibodies, and developed by ECL reagent (GE Healthcare) or Immobilon Western Chemiluminescent horseradish peroxidase substrate (Millipore). Definition of LIF-Fc Activity—To determine the specific activity of purified LIF-Fc, we analyzed the ability to induce the differentiation of M1 cells (17Metcalf D. Hilton D.J. Nicola N.A. Leukemia (Basingstoke). 1988; 2: 216-221PubMed Google Scholar). M1 cells were suspended in Dulbecco's modified Eagle's medium with a final concentration of 20% FBS, 0.3% agar (Dojindo Molecular Technologies) and LIF samples, and then they were seeded into 24-well plates at the concentration of 75 cells/well. ESGRO (Chemicon) was used as a control to determine LIF activity. Cultures were incubated for 10 days in a fully humidified atmosphere at 5% CO2. Cultures were scored using a microscope at ×40 magnification, scoring as differentiated any colonies with a corona of dispersed cells or composed wholly of dispersed cells. A standard of 50 units was defined as the concentration that induces the differentiation of 50% of M1 colonies. Characterization of Immobilized Proteins—Following the manufacturer's instructions, purified LIF-Fc was labeled with HiLyte Fluor™ 555 labeling kit-NH2 (excitation, 555 nm; emission, 570 nm; Dojindo). Labeled LIF-Fc (555-LIF-Fc) solution was diluted 1:10 with native LIF-Fc solution when the concentration of total LIF-Fc was greater than 1.0 μg/ml, so that the fluorescence intensity is a linear function of labeled protein concentration. 555-LIF-Fc, native LIF-Fc, and E-cad-Fc were diluted with PBS to the designated concentration, and then 50 μl of mixtures were added to 96-well polystyrene plates. After 2 h of incubation at 37 °C, the fluorescence intensity of nonadsorbed fraction was measured with microplate reader (excitation, 535 nm; emission, 595 nm). The amount of immobilized LIF-Fc was estimated from a calibration curve prepared with 555-LIF-Fc and native LIF-Fc. Adhesion and Growth Assays—Cells were seeded at a density of 3.0 × 104 cells/well into 96-well plates precoated with the indicated substrate. After 4 h of culture, medium and nonadherent cells were removed, and cells were washed with the culture medium. Adherent cells were stained with Alamar Blue reagent (BIOSOURCE), and absorbance at 570 nm was measured using a microplate reader. For the cell growth assay, cells were seeded at a density of 500 cells/well into a 96-well plate coated with the indicated substrate. The cell number was evaluated at 5 days after seeding. ELISA—The amount of remaining LIF-Fc after the cultivation of ES cells was analyzed by ELISA method. ES cells were seeded onto the surface coated with E-cad-Fc and LIF-Fc and cultured for 3 days. To remove the adhered ES cells, we incubated them in a 2 mm EDTA/PBS solution for 30 min at 37 °C. After washing three times with PBS, plates were incubated for 16 h with 1.0% bovine serum albumin (BSA)/PBS solution to block unspecific interaction. The remaining LIF-Fc was detected after incubation with an anti-murine LIF antibody for 2 h, followed by peroxidase-conjugated secondary antibody for 1 h. We used 3,3′,5,5′-tetramethylbenzidine (TMB) as a substrate for peroxidase, and we measured the absorbance at 450 nm. The amount of adsorbed LIF-Fc onto the gelatinized or E-cad-Fc-coated surface was also analyzed by ELISA. The media containing 1,000 units/ml LIF or LIF-Fc were added to the gelatinized or E-cad-Fc-coated surface. After 3 days of incubation at 37 °C, the amount of nonadsorbed LIF or LIF-Fc in the supernatant was analyzed by Quatikine Mouse LIF immunoassay kit (R & D Systems). The amount of adsorbed LIF or LIF-Fc was measured by the same method as mentioned above. ALP Staining and Immunofluorescence—Alkaline phosphatase activity was determined using a Sigma Diagnostics alkaline phosphatase (ALP) kit (Sigma). For immunofluorescence staining, cells were fixed with 8% formaldehyde solution (pH 7.0–7.5; Wako Pure Chemical) for 10 min and permeabilized with 0.2% Triton X-100 for 2 min at room temperature. Fixed cells were incubated with Image-iT FX signal enhancer (Invitrogen) for 30 min at room temperature. Oct-3/4 was stained with an anti-mouse Oct-3/4 polyclonal antibody (H-134; Santa Cruz Biotechnology) for 2 h followed by an Alexa Fluor 546-conjugated secondary antibody (Invitrogen) for 1 h. Nuclei were counterstained with 0.5 μg/ml 4′,6-diamidino-2-phenylindole (DAPI). Samples were observed by fluorescence microscopy. The ratio of Oct-3/4-positive cells was calculated by ImageJ software. RT-PCR Analysis—Total RNA was isolated with TRIzol reagent (Invitrogen). The first strand cDNA was synthesized using Moloney murine leukemia virus reverse transcriptase (Invitrogen), and PCR was carried out with rTaq polymerase (TOYOBO) in the reaction buffer containing 1.5 mm MgCl2. Primers used are listed in Table 1. PCR products were analyzed by 2% agarose gel electrophoresis.TABLE 1PCR primers used in this studyGene (Unigene symbol)5′ primer (5′ to 3′)3′ primer (5′ to 3′)Product lengthAnnealing temperatureCycle no.bp°COct-3/4 (Mm.17031)GAAGTTGGAAAGGTGGAACCGCCTCATACCTTCTCCGTTGG5286020TCTTTCCACAGGCCCCCGGCTCTGCGGGCGGCATGGGGAGATCC2246020Zfp42/Rex-1 (Mm.285848)AAAGTGAGATAGCCCCGAGTCCCATCCCTTCAATAGCA9306020ACGAGTGGCGTTTCTTCTTGGGATATGACTCATTCCAGGGGGCACT2876020Nanog (Mm.6047)GAGGAAGCACGAATTCTGGAAGTTATGGGCGGAGCAGC7106020GCGGCTCACTCCTTCTGACTTGACCAGGAAACCCACACTCAT1636020Wnt3 (Mm.159091)TAGAGCTAGCTCCGGGCGATGATTGCCTTAACAAGACCACGAAA2976220Actcl (Mm.686)CCAGATCATTTTGAGACCTTCAAGAACATTATAGTTACACCATCGC1245930Nkx2.5 (Mm.41974)GAGCCTACGTGACCCTGACCCAGTGACCTGCGGGACGTGAGCTTCA2646030Gata4 (Mm.247669)CTGGAGGCGGATGGGACGGGACACTACCCGCAGGCATACATACAGGCTCACC2076224α-Fetoprotein (Mm.358570)TCGTATTCCACAGGAGGAGGCTTTTGTTCACCAG1735530Bmp2 (Mm.103205)GGGACCCGCGTCTTCTAGTGTTGCTGAGTGCCTCGGTACAGATCTAGCA2496030Polr2a (Mm.16533)CTGATGCGGTGCTGAGTGAGAAGGGCGGTTGACCCATGACGAGTG2376024Gapdh (Mm.333399)CTCATGACCCAGTCCATGCCTCTTGCTCGTGTCCTTGC5326020 Open table in a new tab Tetraploid Aggregation—Embryos were generated from ES cells by aggregating them with four-cell stage tetraploid CD-1 embryos generated by electrofusion as described previously (18Duncan S.A. Nagy A. Chan W. Development (Camb.). 1997; 124: 279-287Crossref PubMed Google Scholar, 19Nagy A. Gocza E. Diaz E.M. Prideaux V.R. Ivanyi E. Markkula M. Rossant J. Development (Camb.). 1990; 110: 815-821Crossref PubMed Google Scholar). ES cell:embryo aggregates were cultured overnight, and those that formed blastocysts were transferred to the uteri of pseudo-pregnant females surrogate mothers. Embryos were allowed to develop in utero before harvesting for analysis. The Animal Care Committee of the Medical College of Wisconsin approved all animal procedures used in this study. Construction, Purification, and Characterization of LIF-Fc—CHO-K1 cells were transfected with an expression vector for LIF-Fc (Fig. 1A), and G418-resistant clones were selected. A highly expressing clone was selected by ELISA (data not shown). LIF-Fc was purified from the conditioned media of the selected clone and analyzed by Western blotting. Under reduced conditions, the LIF-Fc was detected as an ∼75-kDa single band that was recognized by both anti-LIF antibody and anti-mouse IgG antibody (Fig. 1B). Under nonreduced conditions, LIF-Fc gave rise to an ∼150-kDa single band, indicating that LIF-Fc forms the homodimers (Fig. 1C). Analysis of LIF-Fc Activity—The activity of purified LIF-Fc was defined as an ability to induce differentiation of M1 cells (Fig. 2, A and B). LIF-Fc induced the differentiation of M1 cells in a dose-dependent manner, and the specific activity of LIF-Fc was estimated as described under “Experimental Procedures” (in this case 5,074 units/μg). The activity of LIF-Fc was also evaluated by the ability to activate the STAT3 and MAPK signaling pathways in mouse ES cells. As shown in Fig. 2C, LIF-Fc also activated these pathways, similar to the activation induced by recombinant LIF (ESGRO). ALP activity is a marker of the undifferentiated state of ES cells. The ability of LIF-Fc to maintain the undifferentiated state of mouse ES cells was analyzed by ALP activity. Mouse ES cells maintained ALP activity by LIF-Fc supplementation (Fig. 2D), indicating that LIF-Fc could retain the original activity of LIF, even though LIF is conjugated with the Fc domain of IgG and forms homodimers. Adsorption of LIF-Fc on Polystyrene Surface and Effect of an Immobilized LIF-Fc on ES Cells—First, the amount of LIF-Fc adsorption onto a polystyrene surface was estimated by measuring the fluorescence intensity of 555-LIF-Fc. Adsorption of LIF-Fc to the polystyrene surface increased in a dose-dependent manner, and the curve could be approximated to Langmuir's adsorption isotherm (Fig. 3, A and B). The amount of immobilized LIF-Fc onto polystyrene surface was estimated as about 67 ± 15% of initial amount. Next, we tested the effect of immobilized LIF-Fc on ES cell culture. EB3 cells adhered to the LIF-Fc-coated surface but not to the surface coated with mouse IgG (Fig. 3C), indicating that cell adhesion is mediated by immobilized LIF-Fc not by the Fc region. In addition, to clarify the effect of the Fc region on the stable adsorption of LIF-Fc protein, we directly coated native LIF to the polystyrene surface. ES cells did not adhere to the surface coated with native LIF; therefore, the Fc region is essential for the stable adsorption of LIF, and LIF-Fc could act as a substrate for adhesion of ES cells. On the LIF-Fc-coated surface, ES cells formed tightly aggregated colonies (Fig. 3F); similar morphology is observed on the conventional gelatin-coated surface. To ascertain whether ES cells maintain their undifferentiated phenotypes on immobilized LIF-Fc, we examined the activity of STAT3 and MAPK. STAT3 was activated on the LIF-Fc immobilized surface at the same level as on the gelatinized surface with LIF, and the activation of STAT3 was sustained to 24 h. The activation of MAPK on the LIF-Fc-coated surface was slightly higher than on a conventional gelatinized surface with LIF supplementation (Fig. 3D). When activated by soluble ligands, many cytokine receptors are usually incorporated into cells to control the strength and period of signals. The LIF receptor is also internalized and down-regulated (20Blanchard F. Duplomb L. Wang Y. Robledo O. Kinzie E. Pitard V. Godard A. Jacques Y. Baumann H. J. Biol. Chem. 2000; 275: 28793-287801Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Within 3 h after stimulation, the protein level of the LIF receptor was decreased by the stimulation of soluble LIF, although there were no differences on the level of gp130 as described previously (Fig. 3E) (20Blanchard F. Duplomb L. Wang Y. Robledo O. Kinzie E. Pitard V. Godard A. Jacques Y. Baumann H. J. Biol. Chem. 2000; 275: 28793-287801Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). On the other hand, immobilized LIF-Fc had no effect on the incorporation of the LIF receptor, indicating that immobilized LIF would not be incorporated into the cells. Furthermore, ES cells grown on the LIF-Fc-coated dishes formed aggregated colonies (Fig. 3F) and showed high ALP activity (Fig. 3G). These results indicate that ES cells could maintain their undifferentiated phenotypes on a LIF-Fc-coated surface. Maintenance of ES Cell Features on the Co-immobilized Surface of LIF-Fc and E-cad-Fc—We demonstrated that ES cells could maintain their undifferentiated phenotypes on a LIF-Fc-coated surface without additional LIF supplementation; however, they still form tight aggregated colonies. Furthermore, their adhesion to LIF-Fc was not strong; therefore, they could easily detach from the surface and form floating cell aggregates, like embryoid bodies (data not shown). Several reports suggested that aggregation would induce heterogeneous signals depending on the position of cells (21Cui L. Johkura K. Yue F. Ogiwara N. Okouchi Y. Asanuma K. Sasaki K. J. Histochem. Cytochem. 2004; 52: 1447-1457Crossref PubMed Scopus (80) Google Scholar, 22Davey R.E. Zandstra P.W. Stem Cells. 2006; 24: 2538-2548Crossref PubMed Scopus (51) Google Scholar, 23Singh A.M. Hamazaki T. Hankowski K.E. Terada N. Stem Cells. 2007; 25: 2534-2542Crossref PubMed Scopus (284) Google Scholar). To clear these problems, we used the co-immobilized surface coated with LIF-Fc and the fusion protein of E-cadherin and Fc fragment (E-cad-Fc) that could maintain ES cells without colony formation (11Nagaoka M. Koshimizu U. Yuasa S. Hattori F. Chen H. Tanaka T. Okabe M. Fukuda K. Akaike T. PLoS ONE. 2006; 1: e15Crossref PubMed Scopus (117) Google Scholar). First, as described under “Experimental Procedures,” the amount of LIF-Fc at the co-immobilizing condition was estimated. The amount of adsorbed LIF-Fc reached a plateau at the same concentration of E-cad-Fc (0.25 μg) and gradually increased at the higher concentration than the concentration of E-cad-Fc (Fig. 4, A and B). This indicated that LIF-Fc and E-cad-Fc competitively adsorb to a polystyrene surface. The optimal amount for coating was estimated from these data. Next, we checked the stability of the immobilized LIF-Fc during cell culture. After ES cells were cultured on LIF-Fc- and E-cad-Fc-coated surface for 3 days, the amount of remaining and detached LIF-Fc was analyzed by the ELISA. There were no significant decreases in the amount of immobilized LIF-Fc (Table 2), and LIF-Fc was not detected in the conditioned media of ES cells (data not shown), indicating that LIF-Fc is not incorporated by cells but stably immobilized on a polystyrene surface. Furthermore, there was no significant adsorption of LIF-Fc onto a gelatinized or E-cad-Fc-coated surface (Fig. 4C); therefore, we used a soluble LIF-Fc for the following experiments.TABLE 2The amount of remaining LIF-Fc after cultivation for 3 days with/without ES cellsAmount of LIF-Fc1.684.198.3812.616.81.68 ng/well% remaining LIF-Fc (without cells)137 ± 65121 ± 27104 ± 2093 ± 9.594 ± 7.7% remaining LIF-Fc (with cells)143 ± 56126 ± 25104 ± 24104 ± 17106 ± 10 Open table in a new tab The adhesion of ES cells onto the co-immobilized surface was not affected by the concentration of LIF-Fc (Fig. 4D), and the cells showed scattering morphology similar to those on the surface coated with E-cad-Fc (Fig. 4E). These results indicate that at the concentration indicated, ES cells stably adhere onto the co-immobilized surface by E-cadherin-mediated adhesion and that a homogeneous environment could be achieved by this system. Furthermore, depending on the concentration of immobilized LIF-Fc, the ES cells showed higher proliferation ability on a co-immobilized surface than on a gelatinized surface (Fig. 4F). The activation of LIF signaling was sustained on the co-immobilized surface even at the low amount of immobilized LIF-Fc (Fig. 4G, 5 units/well). These results also indicate that LIF-Fc is stably immobilized and possesses the ability to induce LIF signaling. We next examined the ability to maintain undifferentiated phenotypes on a co-immobilized surface. The expression of Oct-3/4 (24Niwa H. Miyazaki J. Smith A.G. Nat. Genet. 2000; 24: 372-376Crossref PubMed Scopus (2926) Google Scholar), Rex-1 (25Rogers M.B. Hosler B.A. Gudas L.J. Development (Camb.). 1991; 113: 815-824Crossref PubMed Google Scholar), and Nanog (26Mitsui K. Tokuzawa Y. Itoh H. Segawa K. Murakami M. Takahashi K. Maruyama M. Maeda M. Yamanaka S. Cell. 2003; 113: 631-642Abstract Full Text Full Text PDF PubMed Scopus (2604) Google Scholar, 27Chambers I. Colby D. Robertson M. Nichols J. Lee S. Tweedie S. Smith A. Cell. 2003; 113: 643-655Abstract Full Text Full Text PDF PubMed Scopus (2678) Google Scholar) genes was maintained in a dose-dependent manner of immobilized LIF-Fc without additional LIF supplementation, and the expression of the genes was retained for at least 15 days. The expression of these genes diminished upon LIF withdrawal (Fig. 5A). Immunostaining also showed that ES cells cultured on co-immobilized dishes with LIF-Fc and E-cad-Fc for 5 days expressed Oct-3/4 in the nucleus, whereas depletion of LIF led to a marked reduction in Oct-3/4 staining (Fig. 5B). These results indicate that a co-immobilized surface of E-cad-Fc and LIF-Fc did effectively maintain the undifferentiated phenotype of ES cells. Furthermore, we tried to apply our culture system to feeder-dependent ES cells. Jxl1 and R1 cells, which are cultured on feeder cells, were seeded on the gelatinized plate or on the co-immobilized surface of E-cad-Fc and LIF-Fc. After culturing for 5 days, the ratio of Oct-3/4-positive cells was calculated. Most of cells cultured on the co-immobilized surface retained the expression of Oct-3/4 (Fig. 5C). We also checked whether the multidifferentiating potency of ES cells is affected by culturing on a co-immobilized surface. To assess the potential of ES cells to differentiate into multiple cell lineages, embryoid bodies were generated from ES cells that had been cultured for 10 passages on the co-immobilized surface. These embryoid bodies were cultured for an additional 11 days without LIF to induce differentiation. The level of expression of lineage-specific marker genes was analyzed by RT-PCR. Similar to results using the conventional culture methods, embryoid bodies derived from co-immobilized surfaces developed into ectoderm (Wnt3), mesoderm (Actc1 and Nkx2.5), and endoderm (Gata4, α-Fetoprotein, and Bmp2) derivatives (Fig. 5D). Finally, we confirmed the pluripotent ability of ES cells cultured on co-immobilized surface with E-cad-Fc and LIF-Fc by tetraploid aggregation. ES cells were directly transferred to our system from culture on feeder cells. After 10 passages with one freeze/thaw cycle, ES cells were aggregated with four-cell stage CD-1 tetraploid embryos and transferred to pseudo-pregnant mice. ES cell-derived embryos were recovered at E9.5. These results demonstrate that without LIF supplementation, the coimmobilized surface with LIF-Fc and E-cad-Fc can maintain the undifferentiated state and pluripotency of ES cells, even though the quite different morphology was compared with the conventional culture systems. In this study, we applied two immobilizable model proteins, E-cad-Fc and LIF-Fc, to establish a new culture system of mouse ES cells, and we demonstrated that mouse ES cells can be effectively maintained on a co-immobilized surface with the model proteins. Furthermore, we found that LIF-Fc is not adsorbed onto the E-cad-Fc-coated surface (Fig. 4C) even though LIF-Fc has an Fc region. This result indicates that the surface would be occupied by the initial adsorption of E-cad-Fc, which would prevent the further adsorption of LIF-Fc. Therefore, the preparation of the mixed solution should be important for the co-immobilization of model proteins. When cultured on the surface coated only with LIF-Fc, mouse ES cells still form aggregated colonies, and the adhesion of cells is weak, even though the cells can maintain undifferentiated phenotypes (Fig. 3). When ES cells form colonies, the signaling from LIF is needed to reach the center of the colonies to maintain an undifferentiated state of ES cells. The soluble LIF might diffuse into the colonies; however, immobilized LIF cannot interact with the inside cells. To explain this issue, we suggest the following hypotheses. 1) LIF-Fc is detached from the surface, and 2) the factors secreted from ES cells by LIF stimulation contribute to maintain the undifferentiated state of ES cells. We analyzed the stability of immobilized LIF-Fc by ELISA and obtained the data that the amount of LIF-Fc did not change after cultivation of ES cells (Table 2). In addition, immobilized LIF-Fc prevented the incorporation of the LIF receptor (Fig. 3E). These results indicate that LIF-Fc was stably immobilized but not incorporated into cells. Furthermore, similar studies suggest that chemically immobilized LIF can be effective for maintenance of murine ES cells (28Makino H. Hasuda H. Ito Y. J. Biosci. Bioeng. 2004; 98: 374-379Crossref PubMed Scopus (31) Google Scholar, 29Cetinkaya G. Turkoglu H. Arat S. Odaman H. Onur M.A. Gumusderelioglu M. Tumer A. J. Biomed. Mater. Res. 2007; 81: 911-919Crossref Scopus (25) Google Scholar, 30Alberti K. Davey R.E. Onishi K. George S. Salchert K. Seib F.P. Bornhäuser M. Pompe T. Nagy A. Werner C. Zandstra P.W. Nat. Meth. 2008; 5: 645-650Crossref PubMed Scopus (171) Google Scholar), although the cells also formed aggregated colonies. Because covalent binding is more stable than hydrophobic interaction of LIF-Fc and cannot be digested by enzymatic activity of cells, the results also indicate the possibility of another pathway that transduces the LIF signals into the inside of the colonies. In addition, several studies suggest that colony formation induces the heterogeneous distribution of mouse ES cells (21Cui L. Johkura K. Yue F. Ogiwara N. Okouchi Y. Asanuma K. Sasaki K. J. Histochem. Cytochem. 2004; 52: 1447-1457Crossref PubMed Scopus (80) Google Scholar, 22Davey R.E. Zandstra P.W. Stem Cells. 2006; 24: 2538-2548Crossref PubMed Scopus (51) Google Scholar, 23Singh A.M. Hamazaki T. Hankowski K.E. Terada N. Stem Cells. 2007; 25: 2534-2542Crossref PubMed Scopus (284) Google Scholar) and also human ES cells (31Stewart M.H. Bosse M. Chadwick K. Menendez P. Bendall S.C. Bhatia M. Nat. Meth. 2006; 3: 807-815Crossref PubMed Scopus (144) Google Scholar, 32Bendall S.C. Stewart M.H. Menendez P. George D. Vijayaragavan K. Werbowetski-Ogilvie T. Ramos-Mejia V. Rouleau A. Yang J. Bosse M. Lajoie G. Bhatia M. Nature. 2007; 448: 1015-1021Crossref PubMed Scopus (508) Google Scholar). Singh et al. (23Singh A.M. Hamazaki T. Hankowski K.E. Terada N. Stem Cells. 2007; 25: 2534-2542Crossref PubMed Scopus (284) Google Scholar) reported that the heterogeneous expression of Nanog and SSEA-1 is induced when ES cells are maintained in the colony-forming condition, and that the cells expressing a low level of Nanog express primitive endodermal marker genes. Furthermore, Davey and Zandstra (22Davey R.E. Zandstra P.W. Stem Cells. 2006; 24: 2538-2548Crossref PubMed Scopus (51) Google Scholar) suggested that autocrine non-LIF ligands of gp130 transduce the signaling for maintenance of an undifferentiated state of mouse ES cells, and they also suggested the heterogeneity of autocrine signals. Recently, a number of new culture methods for human ES cells have been developed that do not require feeder cells or serum to reduce the risk of pathogens (33Xu C. Inokuma M.S. Denham J. Golds K. Kundu P. Gold J.D. Carpenter M.K. Nat. Biotechnol. 2001; 19: 971-974Crossref PubMed Scopus (1603) Google Scholar, 34Amit M. Shariki C. Margulets V. Itskovitz-Eldor J. Biol. Reprod. 2004; 70: 837-845Crossref PubMed Scopus (618) Google Scholar, 35Ying Q.L. Nichols J. Chambers I. Smith A. Cell. 2003; 115: 281-292Abstract Full Text Full Text PDF PubMed Scopus (1729) Google Scholar, 36Qi X. Li T.G. Hao J. Hu J. Wang J. Simmons H. Miura S. Mishina Y. Zhao G.Q. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 6027-6032Crossref PubMed Scopus (348) Google Scholar, 37Ogawa K. Matsui H. Ohtsuka S. Niwa H. Genes Cells. 2004; 9: 471-477Crossref PubMed Scopus (95) Google Scholar, 38Sato N. Meijer L. Skaltsounis L. Greengard P. Brivanlou A.H. Nat. Med. 2004; 10: 55-63Crossref PubMed Scopus (1749) Google Scholar, 39James D. Levine A.J. Besser D. Hemmati-Brivanlou A. Development (Camb.). 2005; 132: 1273-1282Crossref PubMed Scopus (745) Google Scholar, 40Beattie G.M. Lopez A. Bucay N. Hinton A. Firpo M.T. King C.C. Hayek A. Stem Cells. 2005; 23: 489-495Crossref PubMed Scopus (429) Google Scholar). In these culture methods, the undifferentiated human ES cells still form aggregates, and the aggregated colonies are reported to induce heterogeneity of cells (31Stewart M.H. Bosse M. Chadwick K. Menendez P. Bendall S.C. Bhatia M. Nat. Meth. 2006; 3: 807-815Crossref PubMed Scopus (144) Google Scholar, 32Bendall S.C. Stewart M.H. Menendez P. George D. Vijayaragavan K. Werbowetski-Ogilvie T. Ramos-Mejia V. Rouleau A. Yang J. Bosse M. Lajoie G. Bhatia M. Nature. 2007; 448: 1015-1021Crossref PubMed Scopus (508) Google Scholar). From these findings, we propose that the close contact between cells in these aggregates may lead to paracrine or autocrine interactions that could generate heterogeneity. Therefore, our system could improve the culture methods of mouse ES cells by maintaining them in homogeneous conditions. We also found that a reduced amount of LIF was required for maintenance of mouse ES cells on a LIF-immobilized surface. Although we did not compare the actual amount of LIF interacting with cells, our results indicate that the immobilization of LIF is more effective in maintaining ES cells than is possible using soluble forms. We previously reported that ES cells maintained as a single cell require less amounts of LIF (11Nagaoka M. Koshimizu U. Yuasa S. Hattori F. Chen H. Tanaka T. Okabe M. Fukuda K. Akaike T. PLoS ONE. 2006; 1: e15Crossref PubMed Scopus (117) Google Scholar). Therefore, a co-immobilized surface is an efficient system to maintain ES cell properties. In conclusion, we demonstrated that the culture surface coated with LIF-Fc can be useful to maintain the undifferentiated state of mouse ES cells, and that ES cells cultured without any additional LIF supplementation on the co-immobilized surface with E-cad-Fc and LIF-Fc could be maintained as single cells with complete ES cell features. Moreover, the new culture system can maintain ES cells in the homogeneous culture condition to eliminate the risk of unexpected differentiation, and this system is beneficial for single cell-based assay of signaling pathways and cell responses induced by immobilized growth factors. We thank Prof. Hitoshi Niwa of the RIKEN Center for Developmental Biology and Prof. Andras Nagy of the Samuel Lunenfeld Research Institute, Mount Sinai Hospital for their generous gift of EB3 cells (H.N.) and R1 cells (A.N.)." @default.
• W2025811990 created "2016-06-24" @default.
• W2025811990 creator A5001181025 @default.
• W2025811990 creator A5007922267 @default.
• W2025811990 creator A5008516742 @default.
• W2025811990 creator A5052717493 @default.
• W2025811990 creator A5057848583 @default.
• W2025811990 creator A5059626945 @default.
• W2025811990 creator A5064130864 @default.
• W2025811990 date "2008-09-01" @default.
• W2025811990 modified "2023-09-28" @default.
• W2025811990 title "Design of the Artificial Acellular Feeder Layer for the Efficient Propagation of Mouse Embryonic Stem Cells" @default.
• W2025811990 cites W1599568627 @default.
• W2025811990 cites W1608762409 @default.
• W2025811990 cites W1838662971 @default.
• W2025811990 cites W1856781683 @default.
• W2025811990 cites W1966697925 @default.
• W2025811990 cites W1975304932 @default.
• W2025811990 cites W1992949513 @default.
• W2025811990 cites W2011108752 @default.
• W2025811990 cites W2014880331 @default.
• W2025811990 cites W2017010450 @default.
• W2025811990 cites W2022480787 @default.
• W2025811990 cites W2023710119 @default.
• W2025811990 cites W2041255419 @default.
• W2025811990 cites W2045058933 @default.
• W2025811990 cites W2045899482 @default.
• W2025811990 cites W2049022471 @default.
• W2025811990 cites W2054003837 @default.
• W2025811990 cites W2057159461 @default.
• W2025811990 cites W2061268223 @default.
• W2025811990 cites W2073129487 @default.
• W2025811990 cites W2082292567 @default.
• W2025811990 cites W2082417305 @default.
• W2025811990 cites W2086255604 @default.
• W2025811990 cites W2089426706 @default.
• W2025811990 cites W2096857560 @default.
• W2025811990 cites W2099183815 @default.
• W2025811990 cites W2100583392 @default.
• W2025811990 cites W2111399322 @default.
• W2025811990 cites W2126851387 @default.
• W2025811990 cites W2150163104 @default.
• W2025811990 cites W2151487778 @default.
• W2025811990 cites W2152237832 @default.
• W2025811990 cites W2154712506 @default.
• W2025811990 cites W2156227047 @default.
• W2025811990 cites W2160266371 @default.
• W2025811990 cites W2161949020 @default.
• W2025811990 cites W2269271610 @default.
• W2025811990 doi "https://doi.org/10.1074/jbc.m805037200" @default.
• W2025811990 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3258920" @default.
• W2025811990 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18614540" @default.
• W2025811990 hasPublicationYear "2008" @default.
• W2025811990 type Work @default.
• W2025811990 sameAs 2025811990 @default.
• W2025811990 citedByCount "37" @default.
• W2025811990 countsByYear W20258119902012 @default.
• W2025811990 countsByYear W20258119902013 @default.
• W2025811990 countsByYear W20258119902014 @default.
• W2025811990 countsByYear W20258119902015 @default.
• W2025811990 countsByYear W20258119902016 @default.
• W2025811990 countsByYear W20258119902017 @default.
• W2025811990 countsByYear W20258119902020 @default.
• W2025811990 crossrefType "journal-article" @default.
• W2025811990 hasAuthorship W2025811990A5001181025 @default.
• W2025811990 hasAuthorship W2025811990A5007922267 @default.
• W2025811990 hasAuthorship W2025811990A5008516742 @default.
• W2025811990 hasAuthorship W2025811990A5052717493 @default.
• W2025811990 hasAuthorship W2025811990A5057848583 @default.
• W2025811990 hasAuthorship W2025811990A5059626945 @default.
• W2025811990 hasAuthorship W2025811990A5064130864 @default.
• W2025811990 hasBestOaLocation W20258119901 @default.
• W2025811990 hasConcept C104317684 @default.
• W2025811990 hasConcept C145103041 @default.
• W2025811990 hasConcept C185592680 @default.
• W2025811990 hasConcept C28328180 @default.
• W2025811990 hasConcept C55493867 @default.
• W2025811990 hasConcept C86803240 @default.
• W2025811990 hasConcept C95444343 @default.
• W2025811990 hasConceptScore W2025811990C104317684 @default.
• W2025811990 hasConceptScore W2025811990C145103041 @default.
• W2025811990 hasConceptScore W2025811990C185592680 @default.
• W2025811990 hasConceptScore W2025811990C28328180 @default.
• W2025811990 hasConceptScore W2025811990C55493867 @default.
• W2025811990 hasConceptScore W2025811990C86803240 @default.
• W2025811990 hasConceptScore W2025811990C95444343 @default.
• W2025811990 hasIssue "39" @default.
• W2025811990 hasLocation W20258119901 @default.
• W2025811990 hasLocation W20258119902 @default.
• W2025811990 hasLocation W20258119903 @default.
• W2025811990 hasLocation W20258119904 @default.
• W2025811990 hasOpenAccess W2025811990 @default.
• W2025811990 hasPrimaryLocation W20258119901 @default.
• W2025811990 hasRelatedWork W2009519731 @default.
• W2025811990 hasRelatedWork W2078337444 @default.
• W2025811990 hasRelatedWork W2790748761 @default.
• W2025811990 hasRelatedWork W2948692231 @default.
• W2025811990 hasRelatedWork W3015118083 @default.

• next