FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2025963025> ?p ?o ?g. }

• W2025963025 endingPage "642" @default.
• W2025963025 startingPage "635" @default.
• W2025963025 abstract "Type XIII collagen is a short chain collagen which has recently been shown to be a transmembrane protein. The purpose of this study was to elucidate the presence and localization of type XIII collagen in normal human skin and cultured keratinocytes. Expression of type XIII collagen was demonstrated in normal human skin and epidermis at the RNA level using reverse transcription followed by polymerase chain reaction and at the protein level using western blotting and indirect immunofluorescence labeling. Immunolabeling of epidermis revealed type XIII collagen both in the cell–cell contact sites and in the dermal–epidermal junction. In cultured keratinocytes type XIII collagen epitopes were detected in focal contacts and in intercellular contacts. The results of this study show very little colocalization of type XIII collagen and desmosomal components at the light microscopic level. Thus, these results suggest that type XIII collagen is unlikely to be a component of desmosomes. Instead, the punctate labeling pattern of type XIII collagen at the cell–cell contact sites and high degree of colocalization with E-cadherin suggests that type XIII collagen is very likely to be closely associated with adherens type junctions, and may, in fact, be a component of these junctions. Type XIII collagen is a short chain collagen which has recently been shown to be a transmembrane protein. The purpose of this study was to elucidate the presence and localization of type XIII collagen in normal human skin and cultured keratinocytes. Expression of type XIII collagen was demonstrated in normal human skin and epidermis at the RNA level using reverse transcription followed by polymerase chain reaction and at the protein level using western blotting and indirect immunofluorescence labeling. Immunolabeling of epidermis revealed type XIII collagen both in the cell–cell contact sites and in the dermal–epidermal junction. In cultured keratinocytes type XIII collagen epitopes were detected in focal contacts and in intercellular contacts. The results of this study show very little colocalization of type XIII collagen and desmosomal components at the light microscopic level. Thus, these results suggest that type XIII collagen is unlikely to be a component of desmosomes. Instead, the punctate labeling pattern of type XIII collagen at the cell–cell contact sites and high degree of colocalization with E-cadherin suggests that type XIII collagen is very likely to be closely associated with adherens type junctions, and may, in fact, be a component of these junctions. confocal laser scanning microscopy indirect immunofluorescence Specific junctions of keratinocytes are essential for the integrity and the protective barrier function of the epidermis, and may also take part in signal transduction between cells (Garrod et al., 1996Garrod D. Chidgey M. North A. Desmosomes: differentiation, development, dynamics and disease.Curr Opin Cell Biol. 1996; 5: 670-678Crossref Scopus (124) Google Scholar). Desmosomes mediate cell–cell interactions between keratinocytes, and hemidesmosomes mediate cell–matrix interactions by forming adhesion sites between basal keratinocytes and the dermal–epidermal basement membrane (for reviews seeGarrod and Desmosomes and hemidesmosomes., 1993Garrod D.R. Desmosomes and hemidesmosomes. Curr Opin Cell Biol. 1993; 5: 30-40Crossref PubMed Scopus (253) Google Scholar;Burge, 1994Burge S. Cohesion in epidermis.Br J Dermatol. 1994; 131: 153-159Crossref PubMed Scopus (19) Google Scholar;Borradori and Sonnenberg, 1996Borradori L. Sonnenberg A. Hemidesmosomes: roles in adhesion, signaling and human diseases.Curr Opin Cell Biol. 1996; 8: 647-656Crossref PubMed Scopus (192) Google Scholar;Garrod et al., 1996Garrod D. Chidgey M. North A. Desmosomes: differentiation, development, dynamics and disease.Curr Opin Cell Biol. 1996; 5: 670-678Crossref Scopus (124) Google Scholar;Burgeson and Christiano, 1997Burgeson R.E. Christiano A.M. The dermal–epidermal junction.Curr Opin Cell Biol. 1997; 9: 651-658Crossref PubMed Scopus (219) Google Scholar). Both desmosomes and hemidesmosomes have electron-dense cell membrane-associated plaques which are linked intracellularly to cytokeratin-containing intermediate filaments and extracellularly to desmosomal transmembrane proteins on neighboring cell surface, or to the dermal–epidermal basement membrane. The molecular components of desmosomes and hemidesmosomes are quite different. For instance, desmosomes characteristically contain desmoplakins, desmogleins, and desmocollins whereas hemidesmosomes consist, e.g., BP230 (BPAG1), plectin α6β4 integrin and BP180 (BPAG2, type XVII collagen) (Garrod and Desmosomes and hemidesmosomes., 1993Garrod D.R. Desmosomes and hemidesmosomes. Curr Opin Cell Biol. 1993; 5: 30-40Crossref PubMed Scopus (253) Google Scholar;Borradori and Sonnenberg, 1996Borradori L. Sonnenberg A. Hemidesmosomes: roles in adhesion, signaling and human diseases.Curr Opin Cell Biol. 1996; 8: 647-656Crossref PubMed Scopus (192) Google Scholar;Green and Jones, 1996Green K.J. Jones J.C. Desmosomes and hemidesmosomes: structure and function of molecular components.FASEB J. 1996; 10: 871-881Crossref PubMed Scopus (289) Google Scholar). The adherens junctions represent another type of cell–cell contacts of the epidermis. These junctions are characterized with parallel arrangement of plasma membranes of adjacent keratinocytes, and an attachment plaque which is, however, markedly less electron dense than that of desmosomes (Haftek et al., 1996Haftek M. Hansen M.U. Kaiser H.W. Kreysel H.W. Schmitt D. Interkeratinocyte. adherens junctions: immunocytochemical visualization of cell–cell junctional structures, distinct from desmosomes, in human epidermis.J Invest Dermatol. 1996; 106: 498-504Crossref PubMed Scopus (43) Google Scholar). In contrast to desmosomes and hemidesmosomes, adherens junction-type contacts are linked to cytoskeletal actin microfilaments rather than to intermediate filaments (Green et al., 1987Green K.J. Geiger B. Jones J.C. Talian J.C. Goldman R.D. The relationship between intermediate filaments and microfilaments before and during the formation of desmosomes and adherens type junctions in mouse epidermal keratinocytes.J Cell Biol. 1987; 104: 1389-1402Crossref PubMed Scopus (130) Google Scholar;Geiger and Ginsberg, 1991Geiger B. Ginsberg D. The cytoplasmic domain of adherens-type junctions.Cell Motil Cytoskeleton. 1991; 20: 1-6Crossref PubMed Scopus (115) Google Scholar;Pavalko et al., 1991Pavalko F.M. Otey C.A. Simon K.O. Burridge K. α-actinin: a direct link between actin and integrins.Biochem Soc Trans. 1991; 19: 1065-1069Crossref PubMed Scopus (81) Google Scholar;Burge, 1994Burge S. Cohesion in epidermis.Br J Dermatol. 1994; 131: 153-159Crossref PubMed Scopus (19) Google Scholar). As the ultrastructural characteristics of adherens junctions are less prominent than those of desmosomes, they have been described in epidermis only recently (Kaiser et al., 1993aKaiser H.W. Ness W. Offers M. O’keefe E.J. Kreysel H.W. Talin: adherens junction protein is localized at the epidermal–dermal interface in skin.J Invest Dermatol. 1993; 101: 789-793Abstract Full Text PDF PubMed Google Scholar;Haftek et al., 1996Haftek M. Hansen M.U. Kaiser H.W. Kreysel H.W. Schmitt D. Interkeratinocyte. adherens junctions: immunocytochemical visualization of cell–cell junctional structures, distinct from desmosomes, in human epidermis.J Invest Dermatol. 1996; 106: 498-504Crossref PubMed Scopus (43) Google Scholar). Desmosomes and adherens junctions are closely located and their assembly is spatially and temporally co-ordinated in vitro (Green et al., 1987Green K.J. Geiger B. Jones J.C. Talian J.C. Goldman R.D. The relationship between intermediate filaments and microfilaments before and during the formation of desmosomes and adherens type junctions in mouse epidermal keratinocytes.J Cell Biol. 1987; 104: 1389-1402Crossref PubMed Scopus (130) Google Scholar). In fact, the formation of adherens junctions has been suggested to be a prerequisite for desmosome formation (Garrod et al., 1996Garrod D. Chidgey M. North A. Desmosomes: differentiation, development, dynamics and disease.Curr Opin Cell Biol. 1996; 5: 670-678Crossref Scopus (124) Google Scholar). The presence of adherens junctions connecting basal keratinocytes and the underlying basement membrane has been suggested on the basis of the detection of vinculin and talin in dermal–epidermal junction (Kaiser et al., 1993aKaiser H.W. Ness W. Offers M. O’keefe E.J. Kreysel H.W. Talin: adherens junction protein is localized at the epidermal–dermal interface in skin.J Invest Dermatol. 1993; 101: 789-793Abstract Full Text PDF PubMed Google Scholar,Kaiser et al., 1993bKaiser H.W. Ness W. Jungblut I. Briggman R.A. Kreysel H.W. O’keefe E.J. Adherens junctions: demonstration in human epidermis.J Invest Dermatol. 1993; 100: 180-185Abstract Full Text PDF PubMed Google Scholar). In cell cultures, these intracellular proteins are components of focal adhesions connecting, e.g., keratinocytes and fibroblasts to the culture substratum. Focal adhesions are suggested to represent an attachment device in cell cultures corresponding to cell–extracellular matrix adhesions in vivo (Burridge et al., 1988Burridge K. Fath K. Kelly T. Nuckolls G. Turner C. Focal adhesions: transmembrane junctions between the extracellular matrix and the cytoskeleton.Annu Rev Cell Biol. 1988; 4: 487-525Crossref PubMed Scopus (1654) Google Scholar;Burridge and Fath, 1989Burridge K. Fath K. Focal contacts: transmembrane links between the extracellular matrix and the cytoskeleton.Bioessays. 1989; 10: 104-108Crossref PubMed Scopus (167) Google Scholar;Jockusch et al., 1995Jockusch B.M. Bubeck P. Giehl K. et al.The molecular architecture of focal adhesions.Annu Rev Cell Dev Biol. 1995; 11: 379-416Crossref PubMed Scopus (422) Google Scholar). Junctions containing vinculin and talin have previously been detected in, e.g., dense plaques of smooth muscle cells and myotendinous junctions of skeletal muscle (Geiger et al., 1985Geiger B. Volk T. Volberg T. Molecular heterogeneity of adherens junctions.J Cell Biol. 1985; 101: 1523-1531Crossref PubMed Scopus (108) Google Scholar;Burridge et al., 1988Burridge K. Fath K. Kelly T. Nuckolls G. Turner C. Focal adhesions: transmembrane junctions between the extracellular matrix and the cytoskeleton.Annu Rev Cell Biol. 1988; 4: 487-525Crossref PubMed Scopus (1654) Google Scholar). Transmembrane components of adherens junctions include E-cadherin which participates in cell–cell junctions only (Wheelock and Jensen, 1992Wheelock M.J. Jensen P.J. Regulation of keratinocyte intercellular junction organization and epidermal morphogenesis by E-cadherin.J Cell Biol. 1992; 117: 415-425Crossref PubMed Scopus (201) Google Scholar;Haftek et al., 1996Haftek M. Hansen M.U. Kaiser H.W. Kreysel H.W. Schmitt D. Interkeratinocyte. adherens junctions: immunocytochemical visualization of cell–cell junctional structures, distinct from desmosomes, in human epidermis.J Invest Dermatol. 1996; 106: 498-504Crossref PubMed Scopus (43) Google Scholar), and β1 integrins which are expressed by the basal keratinocytes both in the cell–cell and the cell–matrix contacts (Peltonen et al., 1989Peltonen J. Larjava H. Jaakkola S. et al.Localization of integrin receptors for fibronectin, collagen and laminin in human skin: variable expression in basal and squamous cell carcinomas.J Clin Invest. 1989; 84: 1916-1923Crossref PubMed Scopus (199) Google Scholar;Larjava et al., 1990Larjava H. Peltonen J. Akiyama S.K. Yamada S.S. Gralnick H.R. Uitto J. Yamada K.M. Novel function for β1 integrins in keratinocyte cell–cell interactions.J Cell Biol. 1990; 110: 803-815Crossref PubMed Scopus (249) Google Scholar). Correspondingly, transmembrane components of hemidesmosomes include a member of integrin family, namely α6β4 integrin, and a collagenous transmembrane protein, BP180/BPAG2, or type XVII collagen (Ryynänen et al., 1991Ryynänen J. Jaakkola S. Engvall E. Peltonen J. Uitto J. Expression of β4 integrins in human skin: comparison of epidermal distribution with β1 integrin epitopes, and modulation by calcium and vitamin D3 in cultured keratinocytes.J Invest Dermatol. 1991; 97: 562-567Abstract Full Text PDF PubMed Google Scholar;Borradori and Sonnenberg, 1996Borradori L. Sonnenberg A. Hemidesmosomes: roles in adhesion, signaling and human diseases.Curr Opin Cell Biol. 1996; 8: 647-656Crossref PubMed Scopus (192) Google Scholar;Uitto and Pulkkinen, 1996Uitto J. Pulkkinen L. Molecular complexity of the cutaneous basement membrane zone.Mol Biol Rep. 1996; 23: 35-46Crossref PubMed Scopus (76) Google Scholar). Type XIII collagen is a ubiquitously expressed transmembrane protein which has three extracellular collagenous domains (COL1–COL3) separated by noncollagenous domains NC2 and NC3 (Pihlajaniemi et al., 1987Pihlajaniemi T. Myllylä R. Seyer J. Kurkinen M. Prockop D.J. Partial characterization of low molecular weight human collagen that undergoes alternative splicing.Proc Natl Acad Sci USA. 1987; 84: 940-944Crossref PubMed Scopus (33) Google Scholar;Pihlajaniemi and Tamminen, 1990Pihlajaniemi T. Tamminen M. The α1chain of type XIII collagen consists of three collagenous and four noncollagenous domains, and its primary transcript undergoes alternative splicing.J Biol Chem. 1990; 265: 16922-16928Abstract Full Text PDF PubMed Google Scholar). The extreme amino-terminal noncollagenous domain, NC1, consists of a 40 residue-long intracellular domain and a hydrophobic transmembrane sequence (Hägg et al., 1998Hägg P. Rehn M. Huhtala P. Väisänen T. Tamminen M. Pihlajaniemi T. Type XIII collagen is identified as a plasma membrane protein.J Biol Chem. 1998; 273: 15590-15597Crossref PubMed Scopus (82) Google Scholar). The C-terminal end is formed by the noncollagenous domain NC4. The total length of the α1(XIII) collagen chain is affected by complex alternative splicing of the α1(XIII) collagen RNA (Juvonen and Pihlajaniemi, 1992Juvonen M. Pihlajaniemi T. Characterization of the spectrum of alternative splicing of α1 (XIII) collagen transcripts in HT-1080 cells and calvarial tissue resulted in identification of two previously unidentified alternatively spliced sequences, one previously unidentified exon, and nine new mRNA variants.J Biol Chem. 1992; 267: 24693-24699Abstract Full Text PDF PubMed Google Scholar;Juvonen et al., 1992Juvonen M. Sandberg M. Pihlajaniemi T. Patterns of expression of the six alternatively spliced exons affecting the structures of the COL1 and NC2 domains of the α1 (XIII) collagen chain in human tissues and cell lines.J Biol Chem. 1992; 267: 24700-24707Abstract Full Text PDF PubMed Google Scholar). In humans, a total of 10 exons encoding both collagenous and noncollagenous sequences can be alternatively spliced. α1(XIII) collagen mRNA has been found by reverse transcription combined with polymerase chain reaction (PCR), or by in situ hybridization techniques in various tissues, such as skin, skeletal and heart muscles, tendon, kidney, liver, spleen, intestine, brain, peripheral nerve and placenta (Sandberg et al., 1989Sandberg M. Tamminen M. Hirvonen H. Vuorio E. Pihlajaniemi T. Expression of mRNAs coding for the α1 chain of type XIII collagen in human fetal tissues: comparison with expression of mRNAs for collagen types I, II and III.J Cell Biol. 1989; 109: 1371-1379Crossref PubMed Scopus (42) Google Scholar;Juvonen et al., 1993Juvonen M. Pihlajaniemi T. Autio-Harmainen H. Location and alternative splicing of type XIII collagen RNA in the early human placenta.Lab Invest. 1993; 69: 541-551PubMed Google Scholar;Peltonen et al., 1997Peltonen S. Rehn M. Pihlajaniemi T. Alternative splicing of mouse α1 (XIII) collagen RNAs results in at least 17 different transcripts, predicting α1 (XIII) collagen chains with length varying between 651 and 710 amino acid residues.DNA Cell Biol. 1997; 16: 227-234Crossref PubMed Scopus (26) Google Scholar). In developing skin, the expression of α1(XIII) collagen mRNA has been localized to epidermis by in situ hybridization (Sandberg et al., 1989Sandberg M. Tamminen M. Hirvonen H. Vuorio E. Pihlajaniemi T. Expression of mRNAs coding for the α1 chain of type XIII collagen in human fetal tissues: comparison with expression of mRNAs for collagen types I, II and III.J Cell Biol. 1989; 109: 1371-1379Crossref PubMed Scopus (42) Google Scholar). Studies at the protein level revealing cellular localization of type XIII collagen in these tissues have not been available until recently (Hägg, 1998Hägg P. Characterization of collagen types XIII and XV. University of Oulu, Oulu, Finland1998Google Scholar) and thus the function of type XIII collagen has been unknown. Recent studies at the protein level, however, have demonstrated type XIII collagen epitopes at the periphery of HT 1080 cells where it co-localized with β3 integrin epitopes (Hägg et al., 1998Hägg P. Rehn M. Huhtala P. Väisänen T. Tamminen M. Pihlajaniemi T. Type XIII collagen is identified as a plasma membrane protein.J Biol Chem. 1998; 273: 15590-15597Crossref PubMed Scopus (82) Google Scholar). In skin fibroblasts, the immunosignal is located peripherally and co-localized with vinculin and talin suggesting association with focal contacts (Hägg, 1998Hägg P. Characterization of collagen types XIII and XV. University of Oulu, Oulu, Finland1998Google Scholar). In this study, epidermis and cultured keratinocytes were investigated to elucidate the potential functions of type XIII collagen. Reverse transcription and PCR techniques and western blotting were utilized to study the expression of type XIII collagen in epidermis and in cultured keratinocytes. Double immunolabeling technique was used to localize type XIII collagen, vinculin, E-cadherin, α-catenin, desmoglein, and desmoplakin in normal epidermis and cultured keratinocytes. These studies localized type XIII collagen to cell–cell and cell–matrix contacts. Skin samples were obtained from plastic surgical operations carried out for cosmetic reasons from 10 healthy persons (aged 20–67 y) at the Turku University Hospital, Finland. These samples were used for keratinocyte cultures, indirect immunofluorescence (IIF), RNA isolation, and western blotting. Three samples of fetal skin, gestational weeks 15–17, were obtained from the Department of Obstetrics and Gynecology, University of Turku, Finland. Primary cultures of normal human keratinocytes were established from adult skin samples by a modification of the method ofBoyce and Ham, 1985Boyce S.T. Ham R.G. Cultivation, frozen storage, and clonal growth of normal human keratinocytes in serum free media.J Tissue Cult Methods. 1985; 9: 83-93Crossref Scopus (251) Google Scholar. Keratinocytes were maintained in serum-free low calcium keratinocyte growth medium (Clonetics, San Diego, CA). For experimentation, primary or first passage keratinocytes were passaged by trypsinization and grown until about 40% confluency in medium which contains low, 0.15 mM, calcium concentration. Two identical groups of culture flasks were seeded, and the medium was changed either to the low calcium medium or to the medium containing 1.4 mM Ca2+. Cells were harvested for western blotting after 0, 4, and 24 h incubation. In addition, 15 min, 30 min, and 24 h incubations were used for IIF. Frozen sections of normal skin were cut on silanated glass slides and keratinocytes were grown on glass coverslips. Samples were fixed with 100% methyl alcohol at –20°C for 10 min. To prevent nonspecific binding, the samples were preincubated in phosphate-buffered saline (PBS) supplemented with 1% bovine serum albumin (BSA) for 15 min. The primary antibodies were diluted in 1% BSA–PBS, and incubated on the samples at 4°C for 20 h. Following five 10 min washes in PBS, the slides were incubated with secondary antibodies (see below) at 20°C for 1 h. After the incubation the samples were washed five times in PBS and mounted with Glycergel (Dako, Glostrup, Denmark). Control immunoreactions included the following: (i) primary antibody was replaced with 1% BSA–PBS; (ii) primary antibody was replaced with preimmune rabbit sera diluted 1:50 in 1% BSA–PBS; or (iii) primary antibody was preabsorbed with 10 M excess of synthetic peptide, which was originally used for immunization. In addition, secondary and primary antibodies used in double labelings were tested for cross-reactions. In all controls described above, only a faint uniform background fluorescence was observed. This was carried out using Leica TCS SP Spectral Confocal Microscope (Heidelberg/Wetzlar, Germany) with an air-cooled argon/krypton ion-laser system (Omnichrome, Chino, CA), and Leica TCS NT software (Version 1.6.551 Heidelberg, Germany). The objective magnification used was 63 × (oil immersion, numeric aperture = 1.40), or 100 × (oil immersion, numeric aperture 1.40–0.7). Emission light was focused through a pinhole aperture having a diameter ratio of 50, and the optical sections averaged eight times in square image formats of 1024 × 1024 or 256 × 256 pixels. Final images were saved as tagged image file format and printed directly with a photo printer with a resolution of 300 d.p.i. When the separately acquired red and green channels of confocal images are merged together the overlapping red and green pixels are additively mixed and displayed in yellow. The colocalization of the signals was quantitated from the 24 bit real color images with an image analysis system MCID M4 (ver. 3.0, rev. 1.1, Imaging Research, St Catharines, Canada) by determining the percentile areas of red, green, and yellow pixels over the plasma membranes. The following antibodies were used: for type XIII collagen a rabbit polyclonal antibody against a synthetic peptide corresponding to the NC3 domain (Hägg et al., 1998Hägg P. Rehn M. Huhtala P. Väisänen T. Tamminen M. Pihlajaniemi T. Type XIII collagen is identified as a plasma membrane protein.J Biol Chem. 1998; 273: 15590-15597Crossref PubMed Scopus (82) Google Scholar), and a rabbit polyclonal antibody against a recombinant protein corresponding to intra- and extracellular parts of the NC1 domain (Hägg et al. manuscript); mouse monoclonal antibodies to human vinculin (MCA465S, Serotec, Kidlington, Oxford, U.K.); human E-cadherin (13–1700 Zymed, S. San Francisco, CA); human desmoplakin I and II (881 147, Boehringer Mannheim Biochemica, Mannheim, Germany); human α-catenin (C21620) and desmoglein 1, amino acids 705–1029, of intracellular domain (D28120), both from Transduction Laboratories (Lexington, KY). Swine anti-rabbit (R056) or rabbit anti-mouse (R270) IgG (both from Dako) were used as secondary antibodies. In double labelings, tetramethyl-rhodamine isothiocyanate conjugated swine anti-rabbit IgG was mixed with fluorescein isothiocyanate conjugated F(abc)2 fragment of goat anti-mouse immunoglobulins (F0479, Dako). RNA was isolated from cultured keratinocytes by acid guanidinium isothiocyanate–chloroform–phenol extraction (Chomczynski and Sacchi, 1987Chomczynski P. Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem. 1987; 162: 156-159Crossref PubMed Scopus (62258) Google Scholar), and from adult and fetal skin using RNAzol B kit (CS-105, TEL-Test, Friendswood, TX), according to the protocol provided by the manufacturer. To obtain RNA from epidermal keratinocytes, the epidermal aspect of fresh, 2 × 2 cm pieces of skin from three normal adults were gently scraped with a scalpel and RNA was isolated from detaching cells using RNAzol B kit. Prior to use in the reverse transcription reactions, the RNA preparations were evaluated by running on agarose gel, and were found to be intact. In reverse transcription reactions, 3 μg of the total RNA was transcribed into single-stranded DNA in a 20 μl reaction containing first-strand buffer (250 mM Tris–HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2), 10 mM dithiothreitol, 0.5 mM of each of the four deoxynucleotides, 100 pmol of Random Primer (Promega, Madison, WI) 20 U of rRNasin (Promega), and 100 U of MLV reverse transcriptase (GIBCO, Grand Island NY). The reaction was incubated for 60 min at 37°C. One microliter of the reverse transcription reaction product was used as a template in a 10 μl reaction containing 20 pmol of α1(XIII)-specific sense and anti-sense oligonucleotide primers (see below), 0.2 mM of each of the four deoxynucleotides and 1 U of Dynazyme (from Thermus brockianus, strain F 500, Finnzymes, Espoo, Finland) in a buffer with 10 mM Tris–HCl, pH 8.8, 50 mM KCl, 2.5 mM MgCl2 and 0.1% Triton X-100. Amplification was performed by incubating the mixture for 30 cycles of denaturation (60 s at 94°C), annealing (60 s at 65°C) and extension (60 s at 72°C). In the negative control samples the template was omitted and PCR was performed under the same conditions as elsewhere. The PCR products were analyzed electrophoretically on 4% agarose gels (3% low gelling agarose Sigma, St Louis, MO, and 1% SeaKem GTG agarose, FMC Bio Products, Rockland, ME). The following oligonucleotides with EcoRI or BamH1 restriction sites (underlined) were used as primers for the PCR reactions: A, 5′ AAGGATCCTGGACGAGAAATGGAAGCTCC 3′ (nt 158–179 inPihlajaniemi and Tamminen, 1990Pihlajaniemi T. Tamminen M. The α1chain of type XIII collagen consists of three collagenous and four noncollagenous domains, and its primary transcript undergoes alternative splicing.J Biol Chem. 1990; 265: 16922-16928Abstract Full Text PDF PubMed Google Scholar); B, 5′ TTGAATTCGTGTGGGTACTCTCCACACTGACC 3′ (nt 503–526); C, 5′ TTGGATCCGGTCAACCAGGCACTAGAGGTTTCC 3′ (nt 359–383), and D, 5′ TTGAATTCTTGGATGCTGGCCTGGCTCTGTTCG 3′ (nt 589–614). Western blotting Normal human keratinocytes were cultured in conditions described above. For western blotting the cells were washed with PBS and lysed in solution containing 62.5 mM Tris–HCl, pH 6,8; 2.3% sodium dodecyl sulfate, and 8% glycerol. The concentrations of the protein samples were measured with DC Protein Assay Kit provided by Bio-Rad (Richmond, CA). The culture media were centrifuged to remove detached cells and proteins were precipitated with 70% ethanol and centrifuged at 13 800× g for 20 min. The pellets were dried and diluted in sample buffer (15 mM Tris, pH 6.8; 2.5% glycerol, 0.5% sodium dodecyl sulfate, 0.003% bromophenol blue) and the samples were reduced with 2-mercaptoethanol at 100°C for 3 min. To separate epidermis from dermis a 2 × 2 cm piece of normal skin was heated at 56°C for 30 s in PBS and the epidermis was detached with forceps (Ohata et al., 1995Ohata Y. Hashimoto T. Nishikawa T. Comparative study of autoantigens for various bullous skin diseases by immunoblotting using different dermo-epidermal separation techniques.Clin Exp Dermatol. 1995; 20: 454-458Crossref PubMed Scopus (20) Google Scholar). The epidermis was homogenized in cell lysis solution (see above), centrifuged, and the supernatant was diluted in sample loading buffer and reduced. The protein samples were then applied to 4/10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis gels and electrophoresed at 200 V in a Bio-Rad minigel apparatus until the dye front reached the bottom of the gel. The proteins were electroblotted on to Immobilon P filters (Millipore, Bedford, MA). To evaluate the even transfer of all samples the filters were stained with heparin and toluidine. After destaining and washing with Tris-buffered saline (TBS), the filters were incubated in 3% BSA–TBS for 30 min. The primary antibody for the NC3 domain was then applied to the filters at a dilution of 1:100 in 3% BSA–TBS and incubated at 4°C overnight. The filters were washed in TBS three times for 5 min and incubated in horseradish-peroxidase-conjugated goat anti-rabbit secondary antibody (Bio-Rad) diluted 1:10,000 in 3% BSA–TBS at 4°C for 1 h. Finally, the filters were washed in TBS three times for 5 min. The bound peroxidase activity was detected using the enhanced chemiluminescence substrate as recommended by the manufacturer (Amersham International, Poole, U.K.), and Kodak-X-Omat film (Kodak, Rochester, NY). The spatial distribution of type XIII collagen in normal adult human skin was studied by indirect immunofluorescence. For immunolabeling, two antibodies were used: (i) polyclonal antibody raised against a synthetic peptide corresponding to the sequence of the extracellular NC3 domain, and (ii) polyclonal antibody against a recombinant protein covering sequences of both the cytoplasmic and extracellular parts of the NC1 domain. Both of these antibodies revealed a positive immunosignal for type XIII collagen in epidermis apparently in association with plasma membranes of keratinocytes (Figure 1). The lateral aspects of basal keratinocytes, however, were less intensely labeled compared with suprabasal layers within the same tissue sections (Figure 1a, b). Previous studies have demonstrated that selected adhesion molecules such as E-cadherin and catenins display variation in expression levels within the basal layer of human epidermis (Moles and Watt, 1997Moles J.P. Watt F.M. The epidermal stem cell compartment: variation in expression levels of E-cadherin and catenins within the basal layer of human epidermis.J Histochem Cytochem. 1997; 45: 867-874Crossref PubMed Scopus (76) Google Scholar). The immunoreaction with the antibody for the NC3 domain was particularly intense in the stratum granulosum (Figure 1a). High magnification revealed that the labeling for type XIII collagen was arranged in linear spots in the cell periphery (Figure 1c). This labeling pattern highly resembled that of E-cadherin in epidermis (Figure 1d). Both anti-type XIII collagen antibodies labeled the dermal–epidermal junction, the immunoreaction for the NC1 domain being particularly intense (Figure 1b). In addition to the positive immunoreaction in epidermis, type XII" @default.
• W2025963025 created "2016-06-24" @default.
• W2025963025 creator A5036252076 @default.
• W2025963025 creator A5041968723 @default.
• W2025963025 creator A5055156094 @default.
• W2025963025 creator A5057691882 @default.
• W2025963025 creator A5058661887 @default.
• W2025963025 creator A5062425573 @default.
• W2025963025 creator A5084435634 @default.
• W2025963025 creator A5087921553 @default.
• W2025963025 creator A5088412943 @default.
• W2025963025 date "1999-10-01" @default.
• W2025963025 modified "2023-10-18" @default.
• W2025963025 title "A Novel Component of Epidermal Cell–Matrix and Cell–Cell Contacts: Transmembrane Protein Type XIII Collagen" @default.
• W2025963025 cites W1533120728 @default.
• W2025963025 cites W1819034630 @default.
• W2025963025 cites W183468207 @default.
• W2025963025 cites W1969887412 @default.
• W2025963025 cites W1972139563 @default.
• W2025963025 cites W1982743272 @default.
• W2025963025 cites W1990878803 @default.
• W2025963025 cites W1992138200 @default.
• W2025963025 cites W1992480822 @default.
• W2025963025 cites W1998906348 @default.
• W2025963025 cites W2023559802 @default.
• W2025963025 cites W2027827956 @default.
• W2025963025 cites W2030635244 @default.
• W2025963025 cites W2033035792 @default.
• W2025963025 cites W2035849051 @default.
• W2025963025 cites W2035995912 @default.
• W2025963025 cites W2038739356 @default.
• W2025963025 cites W2043755298 @default.
• W2025963025 cites W2052104049 @default.
• W2025963025 cites W2058807219 @default.
• W2025963025 cites W2060055399 @default.
• W2025963025 cites W2074029723 @default.
• W2025963025 cites W2075285486 @default.
• W2025963025 cites W2082999868 @default.
• W2025963025 cites W2092558515 @default.
• W2025963025 cites W2112093320 @default.
• W2025963025 cites W2135415938 @default.
• W2025963025 cites W2140925807 @default.
• W2025963025 cites W2154784388 @default.
• W2025963025 cites W2156024234 @default.
• W2025963025 cites W2178627498 @default.
• W2025963025 cites W2254591137 @default.
• W2025963025 cites W4294216491 @default.
• W2025963025 doi "https://doi.org/10.1046/j.1523-1747.1999.00736.x" @default.
• W2025963025 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10504453" @default.
• W2025963025 hasPublicationYear "1999" @default.
• W2025963025 type Work @default.
• W2025963025 sameAs 2025963025 @default.
• W2025963025 citedByCount "58" @default.
• W2025963025 countsByYear W20259630252012 @default.
• W2025963025 countsByYear W20259630252013 @default.
• W2025963025 countsByYear W20259630252015 @default.
• W2025963025 countsByYear W20259630252016 @default.
• W2025963025 countsByYear W20259630252017 @default.
• W2025963025 countsByYear W20259630252018 @default.
• W2025963025 countsByYear W20259630252019 @default.
• W2025963025 countsByYear W20259630252020 @default.
• W2025963025 countsByYear W20259630252021 @default.
• W2025963025 countsByYear W20259630252022 @default.
• W2025963025 countsByYear W20259630252023 @default.
• W2025963025 crossrefType "journal-article" @default.
• W2025963025 hasAuthorship W2025963025A5036252076 @default.
• W2025963025 hasAuthorship W2025963025A5041968723 @default.
• W2025963025 hasAuthorship W2025963025A5055156094 @default.
• W2025963025 hasAuthorship W2025963025A5057691882 @default.
• W2025963025 hasAuthorship W2025963025A5058661887 @default.
• W2025963025 hasAuthorship W2025963025A5062425573 @default.
• W2025963025 hasAuthorship W2025963025A5084435634 @default.
• W2025963025 hasAuthorship W2025963025A5087921553 @default.
• W2025963025 hasAuthorship W2025963025A5088412943 @default.
• W2025963025 hasBestOaLocation W20259630251 @default.
• W2025963025 hasConcept C106487976 @default.
• W2025963025 hasConcept C1491633281 @default.
• W2025963025 hasConcept C170493617 @default.
• W2025963025 hasConcept C185592680 @default.
• W2025963025 hasConcept C189014844 @default.
• W2025963025 hasConcept C24530287 @default.
• W2025963025 hasConcept C43617362 @default.
• W2025963025 hasConcept C55493867 @default.
• W2025963025 hasConcept C86803240 @default.
• W2025963025 hasConcept C95444343 @default.
• W2025963025 hasConceptScore W2025963025C106487976 @default.
• W2025963025 hasConceptScore W2025963025C1491633281 @default.
• W2025963025 hasConceptScore W2025963025C170493617 @default.
• W2025963025 hasConceptScore W2025963025C185592680 @default.
• W2025963025 hasConceptScore W2025963025C189014844 @default.
• W2025963025 hasConceptScore W2025963025C24530287 @default.
• W2025963025 hasConceptScore W2025963025C43617362 @default.
• W2025963025 hasConceptScore W2025963025C55493867 @default.
• W2025963025 hasConceptScore W2025963025C86803240 @default.
• W2025963025 hasConceptScore W2025963025C95444343 @default.
• W2025963025 hasIssue "4" @default.
• W2025963025 hasLocation W20259630251 @default.
• W2025963025 hasLocation W20259630252 @default.

• next