FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2026018207> ?p ?o ?g. }

• W2026018207 endingPage "74" @default.
• W2026018207 startingPage "64" @default.
• W2026018207 abstract "Myelofibrosis is characterized by excessive deposits of extracellular matrix proteins, which occur as a marrow microenvironment reactive response to cytokines released from the clonal malignant myeloproliferation. The observation that mice exposed to high systemic levels of thrombopoietin (TPO) invariably developing myelofibrosis has allowed demonstration of the crucial role of transforming growth factor (TGF)-β1 released by hematopoietic cells in the onset of myelofibrosis. The purpose of this study was to investigate whether TGF-β1 inhibition could directly inhibit fibrosis development in a curative approach of this mice model. An adenovirus encoding for TGF-β1 soluble receptor (TGF-β-RII-Fc) was injected either shortly after transplantation (preventive) or 30 days post-transplantation (curative). Mice were transplanted with syngenic bone marrow cells transduced with a retrovirus encoding for murine TPO. All mice developed a myeloproliferative syndrome. TGF-β-RII-Fc was detected in the blood of all treated mice, leading to a dramatic decrease in TGF-β1 level. Histological analysis show that the two approaches (curative or preventive) were successful enough to inhibit bone marrow and spleen fibrosis development in this model. However, lethality of TPO overexpression was not decreased after treatment, indicating that in this mice model, myeloproliferation rather than fibrosis was probably responsible for the lethality induced by the disorder. Myelofibrosis is characterized by excessive deposits of extracellular matrix proteins, which occur as a marrow microenvironment reactive response to cytokines released from the clonal malignant myeloproliferation. The observation that mice exposed to high systemic levels of thrombopoietin (TPO) invariably developing myelofibrosis has allowed demonstration of the crucial role of transforming growth factor (TGF)-β1 released by hematopoietic cells in the onset of myelofibrosis. The purpose of this study was to investigate whether TGF-β1 inhibition could directly inhibit fibrosis development in a curative approach of this mice model. An adenovirus encoding for TGF-β1 soluble receptor (TGF-β-RII-Fc) was injected either shortly after transplantation (preventive) or 30 days post-transplantation (curative). Mice were transplanted with syngenic bone marrow cells transduced with a retrovirus encoding for murine TPO. All mice developed a myeloproliferative syndrome. TGF-β-RII-Fc was detected in the blood of all treated mice, leading to a dramatic decrease in TGF-β1 level. Histological analysis show that the two approaches (curative or preventive) were successful enough to inhibit bone marrow and spleen fibrosis development in this model. However, lethality of TPO overexpression was not decreased after treatment, indicating that in this mice model, myeloproliferation rather than fibrosis was probably responsible for the lethality induced by the disorder. Fibrosis is a prominent clinical complication of several disorders that come from lung, kidney, heart, or liver. In hematopoietic disorders, fibrosis is less frequent. However, idiopathic myelofibrosis is recognized as a model of fibrosis-induced lethality [1Barosi G. Myelofibrosis with myeloid metaplasia: diagnostic definition and prognostic classification for clinical studies and treatment guidelines.J Clin Oncol. 1999; 17: 2954-2970PubMed Google Scholar]. Fibrosis occurs as a cytokine-mediated secondary response to a clonal malignant event originating in a multipotent hematopoietic stem cell [2Jacobson R.J. Salo A. Fialkow P.J. Agnogenic myeloid metaplasia: a clonal proliferation of hematopoietic stem cells with secondary myelofibrosis.Blood. 1978; 51: 189-194PubMed Google Scholar, 3Greenberg B.R. Woo L. Veomett I.C. Payne C.M. Ahmann F.R. Cytogenetics of bone marrow fibroblastic cells in idiopathic chronic myelofibrosis.Br J Haematol. 1987; 66: 487-490Crossref PubMed Scopus (42) Google Scholar], and is characterized by excessive deposits of extracellular matrix proteins [4Thiele J. Hoeppner B. Zankovich R. Fischer R. Histomorphometry of bone marrow biopsies in primary osteomyelofibrosis/-sclerosis (agnogenic myeloid metaplasia)—correlations between clinical and morphological features.Virchows Arch A Pathol Anat Histopathol. 1989; 415: 191-202Crossref PubMed Scopus (63) Google Scholar]. In vivo and in vitro studies have involved several cytokines, such as platelet-derived growth factor or the basic fibroblast growth factor [5Martyre M.C. TGF-beta and megakaryocytes in the pathogenesis of myelofibrosis in myeloproliferative disorders.Leuk Lymphoma. 1995; 20: 39-44Crossref PubMed Scopus (76) Google Scholar, 6Martyre M.C. Le Bousse-Kerdiles M.C. Romquin N. et al.Elevated levels of basic fibroblast growth factor in megakaryocytes and platelets from patients with idiopathic myelofibrosis.Br J Haematol. 1997; 97: 441-448Crossref PubMed Scopus (119) Google Scholar, 7Rameshwar P. Chang V.T. Thacker U.F. Gascon P. Systemic transforming growth factor-beta in patients with bone marrow fibrosis—pathophysiological implications.Am J Hematol. 1998; 59: 133-142Crossref PubMed Scopus (52) Google Scholar, 8Le Bousse-Kerdiles M.C. Martyre M.C. Dual implication of fibrogenic cytokines in the pathogenesis of fibrosis and myeloproliferation in myeloid metaplasia with myelofibrosis.Ann Hematol. 1999; 78: 437-444Crossref PubMed Scopus (94) Google Scholar]. However, the pleiotropic cytokine transforming growth factor (TGF)-β1 is particularly interesting because TGF-β1 potently stimulates fibroblasts to produce extracellular matrix, cell-adhesion proteins [9Roberts A.B. Sporn M.B. Assoian R.K. et al.Transforming growth factor type beta: rapid induction of fibrosis and angiogenesis in vivo and stimulation of collagen formation in vitro.Proc Natl Acad Sci U S A. 1986; 83: 4167-4171Crossref PubMed Scopus (2386) Google Scholar, 10Kimura A. Katoh O. Hyodo H. Kuramoto A. Transforming growth factor-beta regulates growth as well as collagen and fibronectin synthesis of human marrow fibroblasts.Br J Haematol. 1989; 72: 486-491Crossref PubMed Scopus (117) Google Scholar, 12Ignotz R.A. Endo T. Massague J. Regulation of fibronectin and type I collagen mRNA levels by transforming growth factor-beta.J Biol Chem. 1987; 262: 6443-6446Abstract Full Text PDF PubMed Google Scholar], and enhances expression of proteases that inhibit enzymes involved in degradation of the extracellular matrix [13Merwin J.R. Anderson J.M. Kocher O. Van Itallie C.M. Madri J.A. Transforming growth factor beta 1 modulates extracellular matrix organization and cell-cell junctional complex formation during in vitro angiogenesis.J Cell Physiol. 1990; 142: 117-128Crossref PubMed Scopus (151) Google Scholar]. TGF-β1 is secreted by numerous cell types, particularly monocytes [14Rameshwar P. Narayanan R. Qian J. Denny T.N. Colon C. Gascon P. NF-kappa B as a central mediator in the induction of TGF-beta in monocytes from patients with idiopathic myelofibrosis: an inflammatory response beyond the realm of homeostasis.J Immunol. 2000; 165: 2271-2277PubMed Google Scholar] and platelets [15Martyre M.C. Romquin N. Le Bousse-Kerdiles M.C. et al.Transforming growth factor-beta and megakaryocytes in the pathogenesis of idiopathic myelofibrosis.Br J Haematol. 1994; 88: 9-16Crossref PubMed Scopus (121) Google Scholar]. In the thrombopoietin (TPO)-overexpressing mouse models of myelofibrosis, we previously demonstrated a key role of megakaryocyte-derived TGF-β1 using mice genetically deficient in TGF-β1 expression, showing an absence of fibrosis development when TPO was overexpressed [16Chagraoui H. Komura E. Tulliez M. Giraudier S. Vainchenker W. Wendling F. Prominent role of TGF-beta 1 in thrombopoietin-induced myelofibrosis in mice.Blood. 2002; 100: 3495-3503Crossref PubMed Scopus (191) Google Scholar]. The role of the TGF-β1 expression in myelofibrosis development was also supported by studies performed on another myelofibrosis model using GATA-1low mice [17Vannucchi A.M. Bianchi L. Paoletti F. et al.A pathobiologic pathway linking thrombopoietin, GATA-1, and TGF-beta1 in the development of myelofibrosis.Blood. 2005; 105: 3493-3501Crossref PubMed Scopus (101) Google Scholar]. Other types of solid organ fibrosis have been described previously as TGF-β1–related disorders [18Sanderson N. Factor V. Nagy P. et al.Hepatic expression of mature transforming growth factor beta 1 in transgenic mice results in multiple tissue lesions.Proc Natl Acad Sci U S A. 1995; 92: 2572-2576Crossref PubMed Scopus (599) Google Scholar, 19Kopp J.B. Factor V.M. Mozes M. et al.Transgenic mice with increased plasma levels of TGF-beta 1 develop progressive renal disease.Lab Invest. 1996; 74: 991-1003PubMed Google Scholar, 20Broekelmann T.J. Limper A.H. Colby T.V. McDonald J.A. Transforming growth factor beta 1 is present at sites of extracellular matrix gene expression in human pulmonary fibrosis.Proc Natl Acad Sci U S A. 1991; 88: 6642-6646Crossref PubMed Scopus (675) Google Scholar]. In mice models, it has been shown that lung [21Liu M. Suga M. Maclean A.A. St George J.A. Souza D.W. Keshavjee S. Soluble transforming growth factor-beta type III receptor gene transfection inhibits fibrous airway obliteration in a rat model of Bronchiolitis obliterans.Am J Respir Crit Care Med. 2002; 165: 419-423Crossref PubMed Scopus (43) Google Scholar], kidney [22Haviv Y.S. Takayama K. Nagi P.A. et al.Modulation of renal glomerular disease using remote delivery of adenoviral-encoded soluble type II TGF-beta receptor fusion molecule.J Gene Med. 2003; 5: 839-851Crossref PubMed Scopus (23) Google Scholar], and liver [23Nakamura T. Sakata R. Ueno T. Sata M. Ueno H. Inhibition of transforming growth factor beta prevents progression of liver fibrosis and enhances hepatocyte regeneration in dimethylnitrosamine-treated rats.Hepatology. 2000; 32: 247-255Crossref PubMed Scopus (251) Google Scholar] fibrosis could be, at least in part, inhibited by a soluble receptor of TGF-β1. We then hypothesized that this approach could also be relevant in the mouse models of TPO-induced myelofibrosis. For all preclinical or clinical trials based on soluble cytokine receptor treatment, the inhibitory concentration of the receptor needed for a clinical benefit must be 1000-fold higher than the one of the ligand [21Liu M. Suga M. Maclean A.A. St George J.A. Souza D.W. Keshavjee S. Soluble transforming growth factor-beta type III receptor gene transfection inhibits fibrous airway obliteration in a rat model of Bronchiolitis obliterans.Am J Respir Crit Care Med. 2002; 165: 419-423Crossref PubMed Scopus (43) Google Scholar, 23Nakamura T. Sakata R. Ueno T. Sata M. Ueno H. Inhibition of transforming growth factor beta prevents progression of liver fibrosis and enhances hepatocyte regeneration in dimethylnitrosamine-treated rats.Hepatology. 2000; 32: 247-255Crossref PubMed Scopus (251) Google Scholar]. One way to obtain such levels in animal models is to use adenoviral-mediated delivery. However, such an approach in normal mice only leads to short-term treatment. Indeed, consecutive to adenovirus administration, an immune-mediated response leads to destruction of the infected cells and a decrease in the target protein concentration. In order to overcome this response and achieve a long-term treatment, we decided to develop our model in immunocompromised animals. Our data provide some new evidence that TGF-β1 inhibitors could be relevant to inhibit myelofibrosis development. However, interestingly, myelofibrosis reduction did not increase mice survival, indicating that fibrosis development is probably not a key factor in the lethality observed in mouse models. Severe combined immune-deficient (SCID) mice from Charles River (St-Germain sur l'Arbresle, France) were bred in our institute's animal facilities. Murine TGF-β-RII extracellular domain was derived from TGF-β-RII cDNA kindly provided by Dr X-F. Wang (Duke University Medical Center, Durham, NC, USA) and cloned upstream and in frame with the murine IgG1 constant region cDNA previously cloned into the pCEP4 vector (Invitrogen, Cergy-Pontoise, France) giving rise to TGF-β-RII-Fc cDNA. The expression cassette [CMV-TGF-β-RII-Fc-pA] was then cloned and introduced by homologous recombination into an E1 and E3 deleted adenovirus genome as reported previously [24Benihoud K. Yeh P. Perricaudet M. Adenovirus vectors for gene delivery.Curr Opin Biotechnol. 1999; 10: 440-447Crossref PubMed Scopus (300) Google Scholar], to generate AdTGF-β-RII-Fc by the mean of transfection in HEK 293 cells. All viral stocks were prepared with HEK 293 cell monolayers and purified on two successive CsCl gradients. Desalting was performed using G50 columns (Amersham Pharmacia Biotech, Orsay, France) and viruses were frozen in phosphate-buffered saline 7% glycerol at −80°C. Titers were calculated as plaque-forming units (pfu) on 911 cells. AdCO1, a recombinant adenovirus encoding no transgene, was used as a control [25Ilan Y. Droguett G. Chowdhury N.R. et al.Insertion of the adenoviral E3 region into a recombinant viral vector prevents antiviral humoral and cellular immune responses and permits long-term gene expression.Proc Natl Acad Sci U S A. 1997; 94: 2587-2592Crossref PubMed Scopus (171) Google Scholar]. Six- to 8-week-old SCID mice were used as bone marrow (BM) donors and recipients. One group of 12 animals were studied to analyze the fibrosis development kinetic and four groups of 20 animals each were studied to analyze the TGF-β-RII-Fc adenovirus clinical impact on mice. In each group, syngenic male donors hematopoietic cells were grafted into irradiated females from the same genetic background. Infection was performed as described previously [26Villeval J.L. Cohen-Solal K. Tulliez M. et al.High thrombopoietin production by hematopoietic cells induces a fatal myeloproliferative syndrome in mice.Blood. 1997; 90: 4369-4383Crossref PubMed Google Scholar]. Briefly, 4 days after 5-fluorouracil treatment (150 mg/kg administered intraperitoneally), femur and tibia marrow cells were cocultured with 1 × 106 MPZenTPO virus-producing GP-E-86 cells in Dulbecco's modified Eagle's medium (Sigma Aldrich, Saint Quentin Fallavier, France) containing 10% heat-inactivated fetal bovine serum (FBS; Gibco BRL, Paisley, UK), penicillin (100 U/mL), streptomycin (100 μg/mL), glutamine (2 mM), and supplemented with murine FLT3 ligand (20 ng/mL), murine interleukin 3 (muIL-3; 100 U/mL), muIL-6 (20 ng/mL), and murine stem cell factor (muSCF; 20 ng/mL). All cytokines were purchased from R&D Systems (Oxon, UK). After 4 days, nonadherent cells were harvested. An aliquot was used immediately in clonogenic progenitor assays to determine the percentage of transfection in colony-forming cells (CFCs). Remaining cells were inoculated intravenously via the retro-orbital sinus into sublethally irradiated hosts (2.5 Gy, x-ray apparatus, single dose) in a ratio of two male mice donor-derived cells for one female mouse recipient. At the end of each of the two experiments infection protocols, 2 × 104cells/mL were plated in standard methylcellulose culture (Methocult M3134; Stem Cell Technologies, Vancouver, BC, Canada) supplemented with 1 mM l-glutamine (Gibco BRL) and 10−4 M 2-β mercaptoethanol. The methylcellulose medium contained 20% FBS and a combination of recombinant growth factors, including muIL-3 (100 U/mL), pegylated human recombinant megakaryocyte growth and differentiation factor (10 ng/mL), muSCF (50 ng/mL), and human erythropoietin (2 U/mL). Cultures were carried out in triplicate and incubated at 37°C in a humidified incubator containing 5% CO2 in air. Seven days after initiation of culture, colonies (>50 cells) were scored under an inverted microscope and 34 and 72 of them, respectively, were picked randomly for polymerase chain reaction (PCR) analysis of the infection efficiency. Proviral sequence was detected using primer sets corresponding to the TPO cDNA were sense 5′-ACTTTAGCCTGGAGAATGGAAA-3' and antisense 5′-CCAGGAGTAATCTTGACTCTGA-3′ leading to the amplification of a 499-bp product. Actin was used as an internal control using these primers: sense 5′- GTACCACAGGCATTGTGATG-3′ and antisense 5′-GCAACATAGCACAGCTTCTC- 3′. PCR conditions were previously described [16Chagraoui H. Komura E. Tulliez M. Giraudier S. Vainchenker W. Wendling F. Prominent role of TGF-beta 1 in thrombopoietin-induced myelofibrosis in mice.Blood. 2002; 100: 3495-3503Crossref PubMed Scopus (191) Google Scholar]. Chimerism determination consisted in a PCR approach on the Y chromosome in myeloid BM colonies derived from sacrificed animals (donors were males, recipients were females). Briefly, the Y-chromosome sequence was detected by PCR analysis. Primer sets corresponding to the Y-chromosome were sense 5′- TGGGACTGGTGACAATTGTC -3′ and antisense 5′- GAGTCAGGTGTGCAGCTCTA -3′, leading to amplification of a 400-bp product. Actin was used as an internal control. PCR conditions were described previously [16Chagraoui H. Komura E. Tulliez M. Giraudier S. Vainchenker W. Wendling F. Prominent role of TGF-beta 1 in thrombopoietin-induced myelofibrosis in mice.Blood. 2002; 100: 3495-3503Crossref PubMed Scopus (191) Google Scholar]. In a first set of experiments, we tried to determine the adenoviral dose necessary to inhibit circulating TGF-β1 in 16 mice. Four mice in each group were injected with four escalating doses of adenovirus. Toxicity, TGF-β1, and TGF-β1-RII-Fc concentrations were evaluated on days 7, 15, 30, and 60 postinjection. The maximum tolerated dose was then used in a second set of experiments to evaluate the efficiency of the treatment. Adenoviral particles were inoculated at day 5 (experiment 1) or 7 (experiment 2), 30 and 60 posttransplantation (preventive injections), or at day 30 and 60 only (curative approach). Orbital plexus blood was collected in citrated tubes at monthly intervals from anesthetized mice. Nucleated blood cells, hematocrit level, and platelet counts were determined using an automated blood Coulter calibrated for mouse blood (MS9, Schloessing Melet, Cergy-Pontoise, France). Differential cell counts were performed after May-Grünwald-Giemsa staining. Platelet-poor plasma was prepared, stored at −20°C and used for determination of TPO, TGF-β1-RII-Fc, and TGF-β1 levels. Four mice were sacrificed at day 30, four at day 45, and the other four at day 60, in order to determine the kinetic of fibrosis development. Then, 8 and 11 weeks after transplantation, 12 mice of treated groups were humanely sacrificed under anesthesia (3 mice per group at week 8 and 3 mice per group at week 11). Bones were excised, cleaned of soft tissue, one femur and tibia were fixed in Glyo-Fixx fixative (CML, Nemours, France), decalcified, and paraffin embedded. Sections (4–5 μm) were stained with hematoxylin and eosin or Gomori stain for overall cytology and Gordon-Sweet for reticulin or stained with human anti-von Willebrand's factor (vWF; DAKO, France). The bounded anti-vWF antibody was revealed using DAB (DAKO). The second femur and tibia and half the spleens were used for cell count and myeloid progenitor cell analysis. Spleen, liver, and lung histology was also performed. Plasma TPO levels were determined with the murine TPO Quantikine Kits from R&D Systems, according to manufacturer's instructions. Sensitivity limits of the assays were 62.5 pg/mL. The human TGF-β1 immunoassay (R&D Systems), which detects only active forms of TGF-β1, was used to determination the TGF-β1 circulating or extracted from fluids (Quantikine Kit, R&D Systems). Samples were assayed before (spontaneously active TGF-β1) and after acidification (active and latent forms). For acidification, the protocol recommended by the manufacturer was followed without modification. Sensitivity of the assay was 31.2 pg/mL active TGF-β1. Briefly, the level of TGF-β1-RII-Fc was monitored by a sandwich enzyme-linked immunosorbent assay. Ninety-six–well microtiter plates (Maxisorp, Nunc, Roskilde, Denmark) were coated with a goat anti-human TGF-β1-RII antibody (AF-241-NA; R&D, Abingdon, UK), blocked with 5% nonfat dry milk (Regilait, Saint Martin Belle Roche, France), Tris-buffered saline 0.02% Tween 20 (Sigma-Aldrich, Lyon, France); then, dilutions of mouse sera or standard TGF-β1-RII-Fc were added. Standard TGF-β1-RII-FC was purified from supernatants of AdTGF-β1-RII-Fc–infected HeLa cells by ammonium sulfate precipitation (Sigma-Aldrich) followed by protein A purification (Hi-Trap affinity column, Amersham Pharmacia Biotech) and quantified using Bio-Rad Protein Assay (Bio-Rad, Hercules, CA, USA). Bounded TGF-β1-RII-Fc was revealed using an alkaline phosphatase-conjugated goat anti-mouse IgG1 antibody (1070-04, Southern Biotechnology, Birmingham, AL, USA). TGF-β1-RII-Fc was detected after 20-minute incubation with developing solution (Alkaline Phosphatase Substrate Kit; Bio-Rad). By using a microplate reader, we determined an optical density at 405 nm. Results are presented as mean ± standard deviation. Data were analyzed with two-tailed Student's t-test. In order to determine adenoviral concentration that could be used in murine SCID model without toxicity, we first performed intravenous injections with increasing adenovirus doses in different groups of four SCID mice: (0–6.5 × 106, 6.5 × 107, 6.5 × 108, and 6.5 × 109 pfu/mice). At day 30 and 60, hematological parameters were measured and two mice in each group were sacrificed for histological analysis. All but one of the mice that received 6.5 × 109 pfu/mice died before the end of the protocol (day 90) and no histological analysis was performed. However, in all the other subgroups, mice were alive and well. No major histological changes were found in BM histological analysis, but mice receiving 6.5 × 108 pfu developed a mild hepatitis as assessed by histological analysis (data not shown). In order to test the efficiency of the adenoviral treatment, TGF-β1 and TGF-β1–soluble receptor concentrations were determined on days 7, 15, 30, and 60 (Fig. 1A and B). We demonstrated that 15 days after injection, a significant decrease in TGF-β1 concentration was obtained with 6.5 × 107 pfu/mice (Fig. 1A). However, this inhibition was not complete. With a higher dose (6.5 × 109 pfu/mice), inhibition was total at days 7 and 15. We then hypothesized that 1 × 109 pfu/mice would be the lowest nontoxic dose able to inhibit TGF-β1 serum concentration 15 days after injection. We tested whether in vivo circulating TGF-β1–soluble receptor obtained in treated mice was able to inhibit exogenously added TGF-β1 in vitro. Briefly, serum from mice presenting a previously determined concentration of TGF-β1–soluble receptor was incubated for 2 hours in a humidified atmosphere at 37°C and was mixed in vitro with different concentrations of recombined human TGF-β1 (R&D systems). Free TGF-β1 concentration was then measured. We found a direct correlation between serum TGF-β1–soluble receptor concentration and free TGF-β1 concentration. It was then possible to calculate that a giving dose of 1 μg/mL soluble receptor was able to inhibit 1 ng/mL of TGF-β1. According to this result, the TGF-β1-RII-Fc concentration necessary to inhibit in vivo TGF-β1 found in TPO-overexpressing mice should be as high as 30 μg/mL. This could be obtained with a concentration of 6.5 × 108 pfu/mice injected every month. Therefore, we used 1 × 109 pfu/mice to fully inhibit in vivo TGF-β1 produced in our fibrosis model. In order to circumvent the immune response against adenovirus treatment and obtain long-term transfer, we develop our fibrosis model in SCID mice. To overcome the radiosensitivity of these immunodeficient mice, we used a sublethal irradiation dose (2.5 Gy) and grafted 2.5 × 106 (0.95–4 × 106) TPO-transduced bone marrow cells per irradiated animal. We then studied the TPO circulation level and transduction efficiency in murine progenitors after infection. In each group, 20 animals were grafted in two independent experiments. Progenitor transduction efficiency was similar in the two experiments when studied by PCR, which was performed on myeloid colonies (Table 1). All mice survived after bone marrow transplantation (BMT) for at least 3 weeks.Table 1Analysis of transduction efficiency in progenitor cells injectedBone marrow cellsTPO/actin% TransducedExperiment 123/3467Experiment 262/7287Severe combined immune-deficient (SCID) male pooled bone marrow cells were transduced and used to reconstitute SCID female mice. For each experiment, cells were plated at the end of the infection protocol and colony-forming cells-derived colonies were picked from methylcellulose. Samples were analyzed by polymerase chain reaction with specific primers for the viral TPO gene and with actin primers to ascertain the presence of material.TPO = thrombopoietin. Open table in a new tab Severe combined immune-deficient (SCID) male pooled bone marrow cells were transduced and used to reconstitute SCID female mice. For each experiment, cells were plated at the end of the infection protocol and colony-forming cells-derived colonies were picked from methylcellulose. Samples were analyzed by polymerase chain reaction with specific primers for the viral TPO gene and with actin primers to ascertain the presence of material. TPO = thrombopoietin. TPO concentration was followed over time. After 1 month, the plasma TPO concentration was 1000 to 10,000-fold higher than normal TPO plasma level in all studied animals (n = 46). The magnitude of the increase was similar in control and treated animals. This TPO concentration was at the same level 2 months postengraftment and was sustained over time (11 weeks) in all groups (Fig. 2A). The differential x-ray irradiation protocols used in the immunocompromised mice compared to normal C57/Bl6 can induce different chimerisms and subsequent different pathological development. Therefore, we analyzed the chimerism between donor and recipient cells in sex-mismatched transplantations using PCR analysis on Y chromosome (donors were males, recipients were females) from BM-derived myeloid colonies. Chimerisms (50–97%) in the two experiments, when studied on myeloid colonies, showed limited endogeneous hematopoietic reconstitution (Table 2).Table 2Analysis of chimerismMouse no.Chromosome Y/actin% ChimerismControl group119/3850Experiment 1216/2369Control group118/2475Experiment 2219/2382Mock group136/4678Experiment 2244/4793Preventive group119/3652Experiment 1219/3161Preventive group136/4678Experiment 2243/4693Curative group144/4793Experiment 2246/4797Values are representative of data from controls and mice in each group (two mice in each group in each experiment). Progenitor cells numbers (colony-forming cells [CFCs]) were calculated from the number of colonies obtained from 105 cells grown in semisolid medium. Irradiated hosts were engrafted with virus-infected marrow cells. CFC-derived colonies from marrow (30–50 per animal) were picked from methyl cellulose. Samples were analyzed by polymerase chain reaction with primers specific for the Y chromosome and with actin primers to ascertain the presence of material. Open table in a new tab Values are representative of data from controls and mice in each group (two mice in each group in each experiment). Progenitor cells numbers (colony-forming cells [CFCs]) were calculated from the number of colonies obtained from 105 cells grown in semisolid medium. Irradiated hosts were engrafted with virus-infected marrow cells. CFC-derived colonies from marrow (30–50 per animal) were picked from methyl cellulose. Samples were analyzed by polymerase chain reaction with primers specific for the Y chromosome and with actin primers to ascertain the presence of material. Platelet numbers in mice reconstituted with TPO-transduced SCID cells increased over 6 weeks, achieving values fourfold higher than normal controls, respectively, for the four groups [no adenovirus-treated mice (group C), “mock” adenovirus-treated mice (group M), preventive-treated mice (group P), and curative-treated mice (group Cure)] (Fig. 2B). Mononuclear blood cells were increased in all groups of mice (Fig. 2B) because of a striking increment in mature polymorphonuclear neutrophils in association with immature myeloid precursor cells as reported previously (data not shown). SCID mice present a very mild anemia as previously reported in this model (Fig. 2B). Progenitor cells were also studied at week 8 in all groups of mice. BM progenitor number was a three- to fivefold decrease in all groups of mice compared to controls. This decrease paralleled the total BM cell number that decreased in all groups of mice (Fig. 2C). All mice developed a splenomegaly when splenic size was measured (1.75 ± 0.77 cm, 1.7 ± 0.42 cm, 1.675 ± 0.39 cm vs 0.61 ± 0.12 for normal SCID mice). Probably because of myeloproliferative disorder, the spleen CFC increased, achieving values 31-fold higher than normal SCID mice. At last, blood circulating CFC was measured and found increased with a 27- to 43-fold increased in the blood CFC (data not shown). These data indicate that treatment with the recombinant adenovirus encoding TGF-β-RII-Fc did not modify the myeloproliferative disease induced by TPO overexpression in SCID mice. This was confirmed by histological examination. Mice were first sacrificed on day 15, 30, and 45 to study the kinetic of fibrosis development (four mice per date). Histological analysis demonstrate that as soon as 30 days post-BMT a major myeloproliferative syndrome was noticed in the BM and in the spleen, but no fibrosis was observed on day 30 (Fig. 3A and B). Fibrosis appeared on day 45 and was consistent on day 60 (Fig. 3C and D). Then, three mice in each group and in the two experiments (six mice per group) that received transplants were sacrificed at day 60 (week" @default.
• W2026018207 created "2016-06-24" @default.
• W2026018207 creator A5001653923 @default.
• W2026018207 creator A5013260560 @default.
• W2026018207 creator A5025039932 @default.
• W2026018207 creator A5026414259 @default.
• W2026018207 creator A5031789027 @default.
• W2026018207 creator A5032762124 @default.
• W2026018207 creator A5049243856 @default.
• W2026018207 creator A5052706868 @default.
• W2026018207 creator A5053957910 @default.
• W2026018207 creator A5065205435 @default.
• W2026018207 creator A5071702929 @default.
• W2026018207 creator A5083553066 @default.
• W2026018207 date "2007-01-01" @default.
• W2026018207 modified "2023-10-11" @default.
• W2026018207 title "Adenoviral-mediated TGF-β1 inhibition in a mouse model of myelofibrosis inhibit bone marrow fibrosis development" @default.
• W2026018207 cites W1595561754 @default.
• W2026018207 cites W1662539477 @default.
• W2026018207 cites W1829333924 @default.
• W2026018207 cites W1927178045 @default.
• W2026018207 cites W1966939472 @default.
• W2026018207 cites W1975710755 @default.
• W2026018207 cites W1995188840 @default.
• W2026018207 cites W2000708019 @default.
• W2026018207 cites W2015677589 @default.
• W2026018207 cites W2019921823 @default.
• W2026018207 cites W2021702158 @default.
• W2026018207 cites W2026851739 @default.
• W2026018207 cites W2036459972 @default.
• W2026018207 cites W2040583312 @default.
• W2026018207 cites W2041673115 @default.
• W2026018207 cites W2045006939 @default.
• W2026018207 cites W2063998127 @default.
• W2026018207 cites W2069811721 @default.
• W2026018207 cites W2070075266 @default.
• W2026018207 cites W2070647506 @default.
• W2026018207 cites W2079681891 @default.
• W2026018207 cites W2081484258 @default.
• W2026018207 cites W2082401103 @default.
• W2026018207 cites W2104830460 @default.
• W2026018207 cites W2126745693 @default.
• W2026018207 cites W2136819827 @default.
• W2026018207 cites W2139164852 @default.
• W2026018207 cites W2150656708 @default.
• W2026018207 cites W2151902657 @default.
• W2026018207 cites W2157988767 @default.
• W2026018207 cites W2168476587 @default.
• W2026018207 cites W2335187016 @default.
• W2026018207 cites W2404783736 @default.
• W2026018207 doi "https://doi.org/10.1016/j.exphem.2006.08.016" @default.
• W2026018207 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17198875" @default.
• W2026018207 hasPublicationYear "2007" @default.
• W2026018207 type Work @default.
• W2026018207 sameAs 2026018207 @default.
• W2026018207 citedByCount "26" @default.
• W2026018207 countsByYear W20260182072012 @default.
• W2026018207 countsByYear W20260182072013 @default.
• W2026018207 countsByYear W20260182072015 @default.
• W2026018207 countsByYear W20260182072016 @default.
• W2026018207 countsByYear W20260182072017 @default.
• W2026018207 countsByYear W20260182072019 @default.
• W2026018207 countsByYear W20260182072021 @default.
• W2026018207 countsByYear W20260182072022 @default.
• W2026018207 countsByYear W20260182072023 @default.
• W2026018207 crossrefType "journal-article" @default.
• W2026018207 hasAuthorship W2026018207A5001653923 @default.
• W2026018207 hasAuthorship W2026018207A5013260560 @default.
• W2026018207 hasAuthorship W2026018207A5025039932 @default.
• W2026018207 hasAuthorship W2026018207A5026414259 @default.
• W2026018207 hasAuthorship W2026018207A5031789027 @default.
• W2026018207 hasAuthorship W2026018207A5032762124 @default.
• W2026018207 hasAuthorship W2026018207A5049243856 @default.
• W2026018207 hasAuthorship W2026018207A5052706868 @default.
• W2026018207 hasAuthorship W2026018207A5053957910 @default.
• W2026018207 hasAuthorship W2026018207A5065205435 @default.
• W2026018207 hasAuthorship W2026018207A5071702929 @default.
• W2026018207 hasAuthorship W2026018207A5083553066 @default.
• W2026018207 hasBestOaLocation W20260182071 @default.
• W2026018207 hasConcept C118131993 @default.
• W2026018207 hasConcept C126322002 @default.
• W2026018207 hasConcept C142724271 @default.
• W2026018207 hasConcept C203014093 @default.
• W2026018207 hasConcept C2780007613 @default.
• W2026018207 hasConcept C2780076729 @default.
• W2026018207 hasConcept C2780559512 @default.
• W2026018207 hasConcept C502942594 @default.
• W2026018207 hasConcept C71924100 @default.
• W2026018207 hasConceptScore W2026018207C118131993 @default.
• W2026018207 hasConceptScore W2026018207C126322002 @default.
• W2026018207 hasConceptScore W2026018207C142724271 @default.
• W2026018207 hasConceptScore W2026018207C203014093 @default.
• W2026018207 hasConceptScore W2026018207C2780007613 @default.
• W2026018207 hasConceptScore W2026018207C2780076729 @default.
• W2026018207 hasConceptScore W2026018207C2780559512 @default.
• W2026018207 hasConceptScore W2026018207C502942594 @default.
• W2026018207 hasConceptScore W2026018207C71924100 @default.
• W2026018207 hasIssue "1" @default.

• next