FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2026050056> ?p ?o ?g. }

• W2026050056 endingPage "19753" @default.
• W2026050056 startingPage "19744" @default.
• W2026050056 abstract "The Na/H exchanger 3 (NHE3) and the Cl/HCO3 exchanger down-regulated in adenoma (DRA) together facilitate intestinal electroneutral NaCl absorption. Elevated Ca2+i inhibits NHE3 through mechanisms involving the PDZ domain proteins NHE3 kinase A regulatory protein (E3KARP) or PDZ kidney 1 (PDZK1). DRA also possesses a PDZ-binding motif, but the roles of interactions with E3KARP or PDZK1 and Ca2+i in DRA regulation are unknown. Wild type DRA and a mutant lacking the PDZ interaction motif (DRA-ETKFminus) were expressed constitutively in human embryonic kidney (HEK) and inducibly in Caco-2/BBE cells. DRA-mediated Cl/HCO3 exchange was measured as intracellular pH changes. Ca2+i was assessed fluorometrically. DRA was induced 8–16-fold and was delivered to the apical surface of polarized Caco-2 cells. Putative anion transporter 1 and cystic fibrosis transmembrane regulator did not contribute to Cl/HCO3 exchange in transfected Caco-2 cells. The calcium ionophore 4Br-A23187 inhibited DRA and DRA-ETKFminus in HEK cells, but only full-length DRA was inhibited in Caco-2 cells. In contrast, 100 μm UTP, which increased Ca2+i, inhibited full-length DRA but not DRA-ETKFminus in Caco-2 and HEK cells. In HEK cells, which express little PDZK1, additional transfection of PDZK1 was required for UTP to inhibit DRA. As HEK cells do not express cystic fibrosis transmembrane regulator or NHE3, the data indicate that Ca2+i-dependent DRA inhibition is not because of modulation of other transport activities. In polarized epithelium, this inhibition requires interaction of DRA with PDZK1. Together with data from PDZK1−/− mice, these data underscore the prominent role of PDZK1 in Ca2+i-mediated inhibition of colonic NaCl absorption. The Na/H exchanger 3 (NHE3) and the Cl/HCO3 exchanger down-regulated in adenoma (DRA) together facilitate intestinal electroneutral NaCl absorption. Elevated Ca2+i inhibits NHE3 through mechanisms involving the PDZ domain proteins NHE3 kinase A regulatory protein (E3KARP) or PDZ kidney 1 (PDZK1). DRA also possesses a PDZ-binding motif, but the roles of interactions with E3KARP or PDZK1 and Ca2+i in DRA regulation are unknown. Wild type DRA and a mutant lacking the PDZ interaction motif (DRA-ETKFminus) were expressed constitutively in human embryonic kidney (HEK) and inducibly in Caco-2/BBE cells. DRA-mediated Cl/HCO3 exchange was measured as intracellular pH changes. Ca2+i was assessed fluorometrically. DRA was induced 8–16-fold and was delivered to the apical surface of polarized Caco-2 cells. Putative anion transporter 1 and cystic fibrosis transmembrane regulator did not contribute to Cl/HCO3 exchange in transfected Caco-2 cells. The calcium ionophore 4Br-A23187 inhibited DRA and DRA-ETKFminus in HEK cells, but only full-length DRA was inhibited in Caco-2 cells. In contrast, 100 μm UTP, which increased Ca2+i, inhibited full-length DRA but not DRA-ETKFminus in Caco-2 and HEK cells. In HEK cells, which express little PDZK1, additional transfection of PDZK1 was required for UTP to inhibit DRA. As HEK cells do not express cystic fibrosis transmembrane regulator or NHE3, the data indicate that Ca2+i-dependent DRA inhibition is not because of modulation of other transport activities. In polarized epithelium, this inhibition requires interaction of DRA with PDZK1. Together with data from PDZK1−/− mice, these data underscore the prominent role of PDZK1 in Ca2+i-mediated inhibition of colonic NaCl absorption. In the gastrointestinal tract electroneutral NaCl absorption occurs in the distal ileum and proximal colon by parallel Na/H exchange and Cl/HCO3 exchange. Studies in knock-out mice have confirmed that NHE3 2The abbreviations used are: NHE3Na/H exchanger isoform 3CFTRcystic fibrosis transmembrane regulatorDRAdown-regulated in adenoma (SLC26A3)PAT1putative anion transporter 1 (SLC26A6)NHERFNHE3 regulatory factorE3KARPNHE3 kinase A regulatory proteinPDZK1PDZ domain protein kidney 1IKEPPintestinal and kidney enriched PDZ proteinPKCprotein kinase CPMAphorbol myristate acetateEGFPenhanced green fluorescent proteinRTreverse transcriptionPBSphosphate-buffered salineHEKhuman embryonic kidneypHiintracellular pHDIDS4,4′-diisothiocyanostilbene-2,2′-disulfonic acid. (Na/H exchanger, isoform 3; SLC9A3) and DRA (down-regulated in adenoma; SLC26A3) are the primary transporters responsible for these events (1.Schweinfest C.W. Spyropoulos D.D. Henderson K.W. Kim J.H. Chapman J.M. Barone S. Worrell R.T. Wang Z. Soleimani M. J. Biol. Chem. 2006; 281: 37962-37971Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar, 2.Schultheis P.J. Clarke L.L. Meneton P. Miller M.L. Soleimani M. Gawenis L.R. Riddle T.M. Duffy J.J. Doetschman T. Wang T. Giebisch G. Aronson P.S. Lorenz J.N. Shull G.E. Nat. Genet. 1998; 19: 282-285Crossref PubMed Scopus (710) Google Scholar). The importance of the latter is emphasized by the human genetic disorder congenital chloride diarrhea (3.Moseley R.H. Höglund P. Wu G.D. Silberg D.G. Haila S. de la Chapelle A. Holmberg C. Kere J. Am. J. Physiol. 1999; 276: G185-G192PubMed Google Scholar), in which a nonfunctional DRA leads to life-threatening diarrhea. DRA is also expressed in the duodenum (in the lower villus) and in the pancreas (4.Walker N.M. Simpson J.E. Brazill J.M. Gill R.K. Dudeja P.K. Schweinfest C.W. Clarke L.L. Gastroenterology. 2009; 136: 893-901Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 5.Jacob P. Rossmann H. Lamprecht G. Kretz A. Neff C. Lin-Wu E. Gregor M. Groneberg D.A. Kere J. Seidler U. Gastroenterology. 2002; 122: 709-724Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar, 6.Ko S.B. Shcheynikov N. Choi J.Y. Luo X. Ishibashi K. Thomas P.J. Kim J.Y. Kim K.H. Lee M.G. Naruse S. Muallem S. EMBO J. 2002; 21: 5662-5672Crossref PubMed Scopus (285) Google Scholar), where it is involved in chloride and bicarbonate secretion together with CFTR (4.Walker N.M. Simpson J.E. Brazill J.M. Gill R.K. Dudeja P.K. Schweinfest C.W. Clarke L.L. Gastroenterology. 2009; 136: 893-901Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 5.Jacob P. Rossmann H. Lamprecht G. Kretz A. Neff C. Lin-Wu E. Gregor M. Groneberg D.A. Kere J. Seidler U. Gastroenterology. 2002; 122: 709-724Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar, 6.Ko S.B. Shcheynikov N. Choi J.Y. Luo X. Ishibashi K. Thomas P.J. Kim J.Y. Kim K.H. Lee M.G. Naruse S. Muallem S. EMBO J. 2002; 21: 5662-5672Crossref PubMed Scopus (285) Google Scholar, 7.Ko S.B. Zeng W. Dorwart M.R. Luo X. Kim K.H. Millen L. Goto H. Naruse S. Soyombo A. Thomas P.J. Muallem S. Nat. Cell Biol. 2004; 6: 343-350Crossref PubMed Scopus (367) Google Scholar). All three transport proteins, NHE3, DRA, and CFTR, have PDZ interaction motifs that facilitate binding to several members of the NHERF class of PDZ adapter proteins (8.Lamprecht G. Seidler U. Am. J. Physiol. Gastrointest. Liver Physiol. 2006; 291: G766-777Crossref PubMed Scopus (121) Google Scholar, 9.Donowitz M. Milgram S. Murer H. Kurachi Y. Yun C. Weinman E. J. Physiol. 2005; 567: 1Crossref Scopus (9) Google Scholar). Na/H exchanger isoform 3 cystic fibrosis transmembrane regulator down-regulated in adenoma (SLC26A3) putative anion transporter 1 (SLC26A6) NHE3 regulatory factor NHE3 kinase A regulatory protein PDZ domain protein kidney 1 intestinal and kidney enriched PDZ protein protein kinase C phorbol myristate acetate enhanced green fluorescent protein reverse transcription phosphate-buffered saline human embryonic kidney intracellular pH 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid. Electroneutral NaCl absorption is regulated largely in parallel but reciprocally with electrogenic chloride secretion (10.Field M. J. Clin. Invest. 2003; 111: 931-943Crossref PubMed Scopus (423) Google Scholar). In different systems NHE3 is acutely regulated by cAMP, cGMP, intracellular calcium, lysophosphatidic acid, and epidermal growth factor (11.Donowitz M. Li X. Physiol. Rev. 2007; 87: 825-872Crossref PubMed Scopus (158) Google Scholar) as well as by tumor necrosis factor-α (12.Clayburgh D.R. Musch M.W. Leitges M. Fu Y.X. Turner J.R. J. Clin. Invest. 2006; 116: 2682-2694Crossref PubMed Scopus (175) Google Scholar). Notably, some of these regulatory processes are mediated through the interaction of NHE3 with several members of the NHERF class of PDZ adapter proteins (8.Lamprecht G. Seidler U. Am. J. Physiol. Gastrointest. Liver Physiol. 2006; 291: G766-777Crossref PubMed Scopus (121) Google Scholar, 11.Donowitz M. Li X. Physiol. Rev. 2007; 87: 825-872Crossref PubMed Scopus (158) Google Scholar). Relatively little is known about the acute regulation of DRA. In the context of chloride and bicarbonate secretion, DRA is activated by cAMP, if it is expressed in a complex with CFTR and PDZ adapter proteins (PDZK1, also known as CAP70, and/or NHERF) (6.Ko S.B. Shcheynikov N. Choi J.Y. Luo X. Ishibashi K. Thomas P.J. Kim J.Y. Kim K.H. Lee M.G. Naruse S. Muallem S. EMBO J. 2002; 21: 5662-5672Crossref PubMed Scopus (285) Google Scholar, 7.Ko S.B. Zeng W. Dorwart M.R. Luo X. Kim K.H. Millen L. Goto H. Naruse S. Soyombo A. Thomas P.J. Muallem S. Nat. Cell Biol. 2004; 6: 343-350Crossref PubMed Scopus (367) Google Scholar, 13.Chernova M.N. Jiang L. Shmukler B.E. Schweinfest C.W. Blanco P. Freedman S.D. Stewart A.K. Alper S.L. J. Physiol. 2003; 549: 3-19Crossref PubMed Scopus (143) Google Scholar). It is expected that DRA is inhibited in vivo in parallel with NHE3 during NaCl absorption, and in Caco-2/BBE cells transfected with NHE3 and DRA, this coupled inhibition has recently been shown (14.Musch M.W. Arvans D.L. Wu G.D. Chang E.B. Am. J. Physiol. Gastrointest. Liver Physiol. 2009; 296: G202-210Crossref PubMed Scopus (60) Google Scholar). In Xenopus oocytes DRA is refractory to regulation by the calmodulin antagonist calmidazolium (10 μm), the PP2A inhibitor calyculin A (100 nm), or actin-modifying agents (13.Chernova M.N. Jiang L. Shmukler B.E. Schweinfest C.W. Blanco P. Freedman S.D. Stewart A.K. Alper S.L. J. Physiol. 2003; 549: 3-19Crossref PubMed Scopus (143) Google Scholar). Other data suggest that direct phosphorylation may regulate DRA, as mutation of tyrosine 756 (Y756F) increases DRA activity, although no signaling pathway has been suggested (13.Chernova M.N. Jiang L. Shmukler B.E. Schweinfest C.W. Blanco P. Freedman S.D. Stewart A.K. Alper S.L. J. Physiol. 2003; 549: 3-19Crossref PubMed Scopus (143) Google Scholar). Thus the regulation of DRA remains poorly understood. Moreover, no data address whether DRA regulation can occur independently or is always dependent on regulation of partner transporters, i.e. CFTR or NHE3, to which it is functionally and structurally coupled. Here we show that DRA activity is inhibited by elevations of Ca2+i, that this regulation is independent of CFTR and NHE3, and that regulation requires interactions between DRA and the PDZ adapter protein PDZK1. Trypsin, doxycycline, hygromycin, G418, and Zeocin were from Invitrogen. 4Br-A23187 and PMA were from Biomol. Sulfo-NHS-SS-biotin and NeutrAvidin were from Pierce. Alexa594-conjugated phalloidin, 2′,7′-bis(carboxyethyl)-5,6-carboxyfluorescein-acetoxymethyl ester, and FURA-2-AM were from Molecular Probes. Nigericin and all other chemicals were from Sigma. In our previous study we have used a mixed population of HEK cells stably transfected with EGFP-tagged wild type DRA (15.Lamprecht G. Baisch S. Schoenleber E. Gregor M. Pflugers Arch. 2005; 449: 479-490Crossref PubMed Scopus (55) Google Scholar). A full-length EGFP-tagged DRA construct lacking the PDZ interaction domain (i.e. lacking the C-terminal four amino acids ETKF) was cloned into pEGFP-C1 (Clontech). HEK cells were transfected with pEGFP/DRA (wild type) and pEGFP/DRA-ETKFminus, as described previously (15.Lamprecht G. Baisch S. Schoenleber E. Gregor M. Pflugers Arch. 2005; 449: 479-490Crossref PubMed Scopus (55) Google Scholar), and clonal cell lines were established by serial dilution. Two randomly chosen clones with comparable Cl/HCO3 exchange activity were used for further studies. EGFP-DRA and EGFP-DRA-ETKFminus fusion constructs were subcloned into pTRE2[hygro]. Caco-2/BBE cells stably transfected with the Tet-Off system (16.Shen L. Black E.D. Witkowski E.D. Lencer W.I. Guerriero V. Schneeberger E.E. Turner J.R. J. Cell Sci. 2006; 119: 2095-2106Crossref PubMed Scopus (361) Google Scholar) were transfected in suspension while passaging the cells and grown for 24 h in the absence of antibiotics. Cells were then passaged again and diluted onto 100-mm dishes. The parental cell line is already G418- and Zeocin-resistant, and transfected cells were thus selected using 250 μg/ml G418, 50 μl/ml Zeocin, and 200 μg/ml hygromycin in Dulbecco's modified Eagle's medium plus 10% fetal calf serum and 0.5% penicillin/streptomycin. Clones appeared after 14–21 days, and those that showed green fluorescence were recovered using cloning rings (Sigma). Two randomly chosen clones with comparable Cl/HCO3 exchange activity were used for further studies. Cells were used between passages 5 and 12 after transfection. They were grown and split in the presence of 20 ng/ml doxycycline, and only cells used for functional studies were kept in the absence of doxycycline immediately after passaging the cells. PDZK1 was cloned by RT-PCR from a human ileal biopsy (sense primer, CTC TTG GAT CCC CAG AAA TGA CCT CCA CC, and antisense primer, AAG CTT TTA CTT GTT TTC ATC ACA TCT CTG). The sequence was verified in pCR-II-blunt, and the insert was subcloned into pEGFP resulting in pEGFP/PDZK1. HEK/EGFP-DRA cells were transfected with EGFP-PDZK1 as described previously (15.Lamprecht G. Baisch S. Schoenleber E. Gregor M. Pflugers Arch. 2005; 449: 479-490Crossref PubMed Scopus (55) Google Scholar), and clonal cell lines were established by serial dilution. Cells were washed with PBS, fixed for 10 min in 3.7% formaldehyde in PBS, and washed again in PBS. They were then permeabilized for 5 min using 1% Triton X-100 in PBS, washed, and blocked for 20 min using 1% bovine serum albumin in PBS. The actin cytoskeleton was stained using Alexa594/phalloidin (1:200 in PBS). The samples were washed again three times in PBS and mounted using SlowFade (Molecular Probes). The slides were visualized using a confocal microscope (LSM510, Zeiss). DRA activity was assessed as changes in the intracellular pH (pHi) after removing chloride from the extracellular buffer. In transfected HEK cells, pHi was measured exactly as described previously (15.Lamprecht G. Baisch S. Schoenleber E. Gregor M. Pflugers Arch. 2005; 449: 479-490Crossref PubMed Scopus (55) Google Scholar). In transfected Caco-2/BBE cells, pHi was measured as described previously (15.Lamprecht G. Baisch S. Schoenleber E. Gregor M. Pflugers Arch. 2005; 449: 479-490Crossref PubMed Scopus (55) Google Scholar) with minor modifications. Because of the slow calibration of confluent Caco-2/BBE cells, a one-point calibration at pH 7.0 was performed in some experiments as described by Boyarsky et al. (17.Boyarsky G. Ganz M.B. Sterzel R.B. Boron W.F. Am. J. Physiol. 1988; 255: C844-856Crossref PubMed Google Scholar) after validating this approach using the conventional calibration at pH 7.0, 7.5, and 7.8. The base-line pHi of the transfected Caco-2/BBE cells varied from day to day. To analyze experiments from several days, data for these cells are expressed as ΔpHi compared with base line. The pHi traces from the transfected HEK cells were analyzed as described previously (18.Lamprecht G. Schaefer J. Dietz K. Gregor M. Pflugers Arch. 2006; 452: 307-315Crossref PubMed Scopus (24) Google Scholar). This nonlinear curve-fitting algorithm allows the estimation of the initial slope after the change of the buffer solutions as well as the estimation of the maximal pHi change from base line after removal of extracellular chloride. For the transfected Caco-2/BBE cells, ΔpHi values were used in this algorithm instead of absolute pHi values. For calcium measurements, cells were loaded with 1 μm FURA-2-AM for 60 min. The sample was excited alternating at 340 and 380 nm (slit width 2.5 nm), and emission was collected at 510 nm (slit width 2.5–3.5 nm). Data were recorded every 2.9 s. Intracellular calcium concentration was expressed as the F380/F340 ratio. RNA was prepared using the RNAqueous kit (Ambion) according to the recommendations of the manufacturer from 10-day confluent Caco-2/BBE cells, in which expression of EGFP-DRA or EGFP-DRA-ETKFminus was either repressed by the presence of doxycycline or induced by its absence. cDNA was synthesized using Superscript reverse transcriptase (Invitrogen). PCR was carried out with 50 ng of cDNA template in an ABI Prism 7000 system using the SYBR green method. DRA (endogenous DRA and induced EGFP-DRA), EGFP (induced EGFP-DRA), PAT1, CFTR, NHE3, PDZK1, and E3KARP as well as histone 3.3A were amplified using the following primers that were optimized for amplification efficiency: histone 3.3A, TTCCAGAGCGCAGCTATCG (300 nm) and TCTTCAAAAAGGCCAACCAGAT (300 nm); DRA, GTGTCCTTTCTTGATGTTTCTTCAGT (200 nm) and CGGTTAAGCTTCTCAATGAAGTCA (200 nm); EGFP, CAAGCAGAAGAACGGCATCAC (300 nm) and GGACTGGGTGCTCAGGTAGGC (300 nm); PAT1, GGGTGCCCTCTCCTTTGTG (300 nm) and CCAGATGGGTCCACACTGAAG (300 nm); CFTR, GGAAAAGGCCAGCGTTGTC (250 nm) and CCAGGCGCTGTCTGTATCCT (250 nm); NHE3, CTGTCCCTCTACGGCGTCTT (100 nm) and GCTGCCAAACAGGAGGAAGTC (300 nm), PDZK1, TGGAGGTGTGCAAACTTGGA (200 nm) and ACACCCCCTTTTTACCTTGGA (200 nm); and E3KARP, GTCACCCGTCACCAATGGA (300 nm) and CAGTGTCCTTGTCGGAACCA (200 nm). The data were analyzed by the ΔΔCt method (ΔΔCt = (Ctsample − Ctreference)doxycycline − (Ctsample − Ctreference)no−doxycycline). Cell surface expression was assayed by biotinylation similar to that described in Ref. 19.Kim J.H. Lee-Kwon W. Park J.B. Ryu S.H. Yun C.H. Donowitz M. J. Biol. Chem. 2002; 277: 23714-23724Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar. 10-Day confluent Caco-2/BBE cells expressing EGFP-DRA were washed three times with PBS (plus calcium and magnesium). The cells were then incubated twice for 30 min with 1 mg/ml sulfo-NHS-SS-biotin (Pierce) in PBS (plus calcium and magnesium). After removal of the buffer, unbound biotin was quenched with 5 mg/ml iodoacetamide in PBS (plus calcium and magnesium) plus 1% bovine serum albumin for 5 min. The cells were then scraped and lysed in 1 ml of 60 mm HEPES, 154 mm NaCl, 3 mm KCl, 5 mm NaEDTA, 3 mm NaEGTA, 1% Triton X-100, and 125 μl/ml complete protease inhibitor mixture (Roche Applied Science) by passing them 15 times through a 22-gauge needle. The lysates were cleared by spinning for 10 min at 10,000 × g and were then incubated with 100 μl of NeutrAvidin-agarose beads overnight. Beads were separated by centrifugation for 1 min at 2500 × g, and bound proteins were eluted by boiling in 2× Laemmli sample buffer for 3 min. 30 μl of the lysate and 60 μl of the eluate from the beads were separated on 8.5% SDS-PAGE, blotted onto nitrocellulose (Schleicher & Schüll), and probed with monoclonal anti-EGFP antibody (1:500; Clontech) and anti-mouse (1:5000) secondary antibody (Jackson ImmunoResearch) using standard conditions. Bands were quantified using ImageMaster 1D, version 3.0 software (Amersham Biosciences), with manual background subtraction. Relative changes of DRA surface expression were analyzed by normalization of the band intensity of biotinylated EGFP-DRA to the band intensity of total EGFP-DRA in the lysate. NHERF and E3KARP were detected using antibodies described previously (20.Yun C.H. Lamprecht G. Forster D.V. Sidor A. J. Biol. Chem. 1998; 273: 25856-25863Abstract Full Text Full Text PDF PubMed Scopus (250) Google Scholar, 21.Liedtke C.M. Yun C.H. Kyle N. Wang D. J. Biol. Chem. 2002; 277: 22925-22933Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar) at a dilution of 1:3000 each. PDZK1 and IKEPP were detected using commercially available antibodies (catalogue numbers PA3-16818 and PA3-16819ABR, Golden, CO) at a dilution of 1:1000 each. Anti-rabbit secondary antibody (Jackson ImmunoResearch) was used 1:5000. All statistical calculations were done using Jump 5.1 (SAS Institute, Cary, NC). All data are presented as means ± S.D. analysis of variance and t tests were applied when appropriate. Calcium-dependent short term regulation of NHE3 has been studied in transfected PS120 cells (19.Kim J.H. Lee-Kwon W. Park J.B. Ryu S.H. Yun C.H. Donowitz M. J. Biol. Chem. 2002; 277: 23714-23724Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar, 22.Lee-Kwon W. Kim J.H. Choi J.W. Kawano K. Cha B. Dartt D.A. Zoukhri D. Donowitz M. Am. J. Physiol. Cell Physiol. 2003; 285: C1527-1536Crossref PubMed Scopus (87) Google Scholar). Thus we followed this approach and used our previously established HEK cells stably expressing EGFP-DRA (15.Lamprecht G. Baisch S. Schoenleber E. Gregor M. Pflugers Arch. 2005; 449: 479-490Crossref PubMed Scopus (55) Google Scholar). In these cells Cl/HCO3 exchange is about eight times higher than in nontransfected cells. DRA activity was measured as intracellular alkalinization upon removal of chloride and intracellular re-acidification upon re-addition of chloride. Intracellular calcium was increased by 10 μm 4Br-A23187, which was applied 100 s before measuring DRA activity. Fig. 1A shows that 4Br-A23187 inhibited DRA activity both by a reduced pHi change after removal of chloride (ΔpHi, 0.58 ± 0.09 versus 0.36 ± 0.09, −39%, p < 0.05) as well as by a reduced initial slope (0.73 ± 0.22 pH/min versus 0.40 ± 0.17, −45%, p < 0.05). The limited background Cl/HCO3 exchange in untransfected cells was not inhibited by 4Br-A23187, indicating that the effect is specific for DRA (data not shown). Taken together these data demonstrate that DRA is inhibited by intracellular calcium. To address a role of PDZ adapter proteins in mediating the calcium effect, the experiment was repeated in two clonal cell lines, one expressing wild type EGFP-DRA and one lacking the PDZ interaction motif (EGFP-DRA-ETKFminus) (Fig. 1, B and C). In EGFP-DRA (wild type) expressing HEK cells, the maximal pHi change after removal of chloride was reduced by 28% (ΔpHi, 0.58 ± 0.08 versus 0.42 ± 0.07, p < 0.05), and the initial slope was reduced by 33% (0.60 ± 0.14 pH/min versus 0.40 ± 0.13, p < 0.05). In EGFP-DRA-ETKFminus-expressing HEK cells, the respective values were −49% (ΔpHi, 0.60 ± 0.07 versus 0.30 ± 0.15, p < 0.05) and −80% (0.94 ± 0.16 pH/min versus 0.19 ± 0.11, p < 0.05). Thus calcium-mediated DRA inhibition induced by 4Br-A23187 was independent of the PDZ interaction motif arguing against a role of PDZ adapter proteins in transfected HEK cells. Cholinergic stimulation elicits a calcium signal that activates protein kinase C (PKC) by translocation to the apical plasma membrane and thus inhibits brush border NHE3 in the ileum (23.Cohen M.E. Wesolek J. McCullen J. Rys-Sikora K. Pandol S. Rood R.P. Sharp G.W. Donowitz M. J. Clin. Invest. 1991; 88: 855-863Crossref PubMed Scopus (46) Google Scholar). Furthermore, stimulation of PKC by phorbol ester has been shown to inhibit NHE3 in PS120 cells (24.Levine S.A. Nath S.K. Yun C.H. Yip J.W. Montrose M. Donowitz M. Tse C.M. J. Biol. Chem. 1995; 270: 13716-13725Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar) and in Caco-2 cells (25.Janecki A.J. Montrose M.H. Zimniak P. Zweibaum A. Tse C.M. Khurana S. Donowitz M. J. Biol. Chem. 1998; 273: 8790-8798Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar). Given the parallel action of NHE3 and DRA, it appeared possible that the inhibition of DRA by calcium involved the activation of PKC. To test such an involvement, PKC was activated by 100 nm PMA for 5 min. Fig. 2 shows that DRA activity was unchanged after activation of PKC. Because DRA regulatory pathways may not be present in poorly differentiated HEK cells, we expressed DRA and the ETKFminus mutant in the differentiated intestinal epithelial Caco-2/BBE cell line, which is a standard model of absorptive enterocytes. Our previous attempts to transgenically express DRA in Caco-2 cells have failed, perhaps because DRA expression retards growth in several transfected cell lines, with the notable exception of HEK cells (26.Chapman J.M. Knoepp S.M. Byeon M.K. Henderson K.W. Schweinfest C.W. Cancer Res. 2002; 62: 5083-5088PubMed Google Scholar). To circumvent this problem, Caco-2/BBE cells expressing the Tet-Off system (16.Shen L. Black E.D. Witkowski E.D. Lencer W.I. Guerriero V. Schneeberger E.E. Turner J.R. J. Cell Sci. 2006; 119: 2095-2106Crossref PubMed Scopus (361) Google Scholar) were transfected with EGFP-DRA and EGFP-DRA-ETKFminus in the Tet-responsive pTRE2[hygro] vector, and stable clones were selected by hygromycin in the presence of 20 ng/ml doxycycline, which suppresses the expression of the gene of interest. Clones were then tested for the expression of EGFP-DRA in the absence of doxycycline. Established clones were kept in culture in the continued presence of doxycycline except for those cells that were used for functional studies. The effect of removal of doxycycline on the mRNA expression of EGF-DRA or EGFP-DRA-ETKFminus, PAT1 (SLC26A6), CFTR, and NHE3 as well as PDZK1 and E3KARP was assessed by semiquantitative RT-PCR (Fig. 3). Removal of doxycycline induced mRNA expression of DRA and DRA-ETKFminus as well as EGFP by a factor of 8–16-fold (23 to 24). Induction of EGFP was minimally (and statistically not significant) greater than induction of DRA indicating relatively little endogenous DRA expression compared with the induced expression of EGFP-DRA. mRNA expressions of PAT1, CFTR, NHE3, PDZK1, and E3KARP were all not significantly influenced by the induction of EGFP-DRA or EGFP-DRA-ETKFminus, and there were no differences between EGFP-DRA- and EGFP-DRA-ETKFminus-expressing cells. Of note, mRNA of NHE3 was difficult to amplify even with several other primer pairs (Ct values >33) suggesting little endogenous NHE3 expression in these cells. Expression of EGFP-DRA and EGFP-DRA-ETKFminus was confirmed by fluorescence microscopy for EGFP (Fig. 4A). EGFP-DRA and EGFP-DRA-ETKFminus are distributed at the apical surface in a punctate manner, suggestive of localization on microvilli. To further substantiate this, the actin cytoskeleton was counterstained. Fig. 4B shows that EGFP-DRA colocalizes with actin cores of apical microvilli. Similar images were obtained with EGFP-DRA-ETKFminus. mRNA of both PAT1 (SLC26A6) and CFTR was detected by RT-PCR in our cells (Fig. 3). PAT1 catalyzes Cl/HCO3 exchange, and CFTR enhances PAT1 and DRA activity in several models (6.Ko S.B. Shcheynikov N. Choi J.Y. Luo X. Ishibashi K. Thomas P.J. Kim J.Y. Kim K.H. Lee M.G. Naruse S. Muallem S. EMBO J. 2002; 21: 5662-5672Crossref PubMed Scopus (285) Google Scholar, 7.Ko S.B. Zeng W. Dorwart M.R. Luo X. Kim K.H. Millen L. Goto H. Naruse S. Soyombo A. Thomas P.J. Muallem S. Nat. Cell Biol. 2004; 6: 343-350Crossref PubMed Scopus (367) Google Scholar). Therefore, it was necessary to examine the influence of PAT1 and CFTR on the Cl/HCO3 exchange activity in the EGFP-DRA-expressing Caco-2/BBE cells, i.e. after induction by doxycycline removal. Fig. 5 shows that Cl/HCO3 exchange was not affected by 100 μm DIDS, a concentration that predominantly inhibits PAT1 but not DRA (27.Mount D.B. Romero M.F. Pflugers Arch. 2004; 447: 710-721Crossref PubMed Scopus (445) Google Scholar) (maximal ΔpHi, 0.44 ± 0.12 versus 0.45 ± 0.18, 2% stimulation, p > 0.05; and initial slope 0.37 ± 0.08 pH/min versus 0.37 ± 0.10, 0% change, p > 0.05). Furthermore, inhibition of CFTR by 10 μm CFTRinh-172 (28.Ma T. Thiagarajah J.R. Yang H. Sonawane N.D. Folli C. Galietta L.J. Verkman A.S. J. Clin. Invest. 2002; 110: 1651-1658Crossref PubMed Scopus (591) Google Scholar) also had no effect on Cl/HCO3 exchange activity (maximal ΔpHi 0.50 ± 0.13 versus 0.50 ± 0.11, 0% change, p > 0.05; and initial slope 0.42 ± 0.07 pH/min versus 0.42 ± 0.13, 0% change, p > 0.05) arguing against a functional interplay between CFTR and DRA in these cells. Taken together the data presented in FIGURE 3, FIGURE 4, FIGURE 5 suggest that EGFP-DRA- and EGFP-DRA-ETKFminus-transfected Caco-2/BBE cells are a useful model to study DRA and the potential role of its interaction with PDZ adapter proteins. The effect of 4Br-A23187 on Cl/HCO3 exchange mediated by DRA was then tested in the transfected Caco-2/BBE cells. In wild type EGFP-DRA-transfected cells, 4Br-A23187 inhibited the maximal increase of pHi after chloride removal significantly by 26% (ΔpHi, 0.59 ± 0.19 versus 0.44 ± 0.11, p < 0.05), and the initial slope nonsignificantly by 30% (0.61 ± 0.34 pH/min versus 0.42 ± 0.16, p > 0.05). In the mutant lacking the PDZ interaction motif (EGFP-DRA-ETKFminus) neither the maximal pHi increase (ΔpHi, 0.54 ± 0.07, −12%, p > 0.05) nor the initial slope (0.66 ± 0.40 pH/min versus 0.63 ± 0.24, −8%, p > 0.05) was significantly reduced (Fig. 6). This suggests that calcium-mediated inhibition of DRA involves the interaction of DRA with PDZ adapter proteins in Caco-2/BBE cells and, by extension, in enterocytes. Because 4Br-A23187 as an ionophore leads to a nonphysiologic elevation of intracellular calcium, the calcium effect needed to be verified by a physiological agonist. Therefore, we tested UTP because it acts via stimulation of P2Y receptors and is independent of protein kinase C (29.Bucheimer R.E. Linden J. J. Physiol. 2004; 555: 311-321Crossref PubMed Scopus (110) Google Scholar). Furthermore, postconfluent Caco-2 cells express P2Y receptors that can be stimulated by UTP resulting in an increase of intracellular calcium (30.Inoue C.N. Woo J.S. Schwiebert E.M. Morita T. Hanaoka K. Guggino S.E. Guggino W.B. Am. J. Physiol. 1997; 272: C1862-1870Crossref PubMed Google Scholar). This effect was confirmed in our EGFP-DRA-expressing cells by comparing the magnitude of the calcium tra" @default.
• W2026050056 created "2016-06-24" @default.
• W2026050056 creator A5009552954 @default.
• W2026050056 creator A5010710160 @default.
• W2026050056 creator A5012351880 @default.
• W2026050056 creator A5019281288 @default.
• W2026050056 creator A5023056626 @default.
• W2026050056 creator A5043714557 @default.
• W2026050056 creator A5044763904 @default.
• W2026050056 creator A5047651613 @default.
• W2026050056 creator A5080210254 @default.
• W2026050056 date "2009-07-01" @default.
• W2026050056 modified "2023-10-15" @default.
• W2026050056 title "Intestinal Anion Exchanger Down-regulated in Adenoma (DRA) Is Inhibited by Intracellular Calcium" @default.
• W2026050056 cites W1511903352 @default.
• W2026050056 cites W1589657989 @default.
• W2026050056 cites W1606161617 @default.
• W2026050056 cites W1968067703 @default.
• W2026050056 cites W1978714719 @default.
• W2026050056 cites W1985650893 @default.
• W2026050056 cites W1992463466 @default.
• W2026050056 cites W1998626317 @default.
• W2026050056 cites W2000272692 @default.
• W2026050056 cites W2001258594 @default.
• W2026050056 cites W2004295712 @default.
• W2026050056 cites W2008979188 @default.
• W2026050056 cites W2009086426 @default.
• W2026050056 cites W2013369484 @default.
• W2026050056 cites W2039172663 @default.
• W2026050056 cites W2044612296 @default.
• W2026050056 cites W2050271023 @default.
• W2026050056 cites W2051318454 @default.
• W2026050056 cites W2051439628 @default.
• W2026050056 cites W2052532027 @default.
• W2026050056 cites W2055144172 @default.
• W2026050056 cites W2058260460 @default.
• W2026050056 cites W2058839243 @default.
• W2026050056 cites W2088020457 @default.
• W2026050056 cites W2091962928 @default.
• W2026050056 cites W2092843405 @default.
• W2026050056 cites W2108988197 @default.
• W2026050056 cites W2117712813 @default.
• W2026050056 cites W2118252780 @default.
• W2026050056 cites W2119575920 @default.
• W2026050056 cites W2126445987 @default.
• W2026050056 cites W2128684716 @default.
• W2026050056 cites W2130449935 @default.
• W2026050056 cites W2140561149 @default.
• W2026050056 cites W2146615272 @default.
• W2026050056 cites W2158074043 @default.
• W2026050056 cites W2163742326 @default.
• W2026050056 cites W2169500993 @default.
• W2026050056 cites W2187511581 @default.
• W2026050056 cites W2409622650 @default.
• W2026050056 cites W4233502188 @default.
• W2026050056 cites W4247870281 @default.
• W2026050056 doi "https://doi.org/10.1074/jbc.m109.004127" @default.
• W2026050056 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2740598" @default.
• W2026050056 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19447883" @default.
• W2026050056 hasPublicationYear "2009" @default.
• W2026050056 type Work @default.
• W2026050056 sameAs 2026050056 @default.
• W2026050056 citedByCount "32" @default.
• W2026050056 countsByYear W20260500562012 @default.
• W2026050056 countsByYear W20260500562013 @default.
• W2026050056 countsByYear W20260500562014 @default.
• W2026050056 countsByYear W20260500562015 @default.
• W2026050056 countsByYear W20260500562016 @default.
• W2026050056 countsByYear W20260500562018 @default.
• W2026050056 countsByYear W20260500562019 @default.
• W2026050056 countsByYear W20260500562020 @default.
• W2026050056 countsByYear W20260500562023 @default.
• W2026050056 crossrefType "journal-article" @default.
• W2026050056 hasAuthorship W2026050056A5009552954 @default.
• W2026050056 hasAuthorship W2026050056A5010710160 @default.
• W2026050056 hasAuthorship W2026050056A5012351880 @default.
• W2026050056 hasAuthorship W2026050056A5019281288 @default.
• W2026050056 hasAuthorship W2026050056A5023056626 @default.
• W2026050056 hasAuthorship W2026050056A5043714557 @default.
• W2026050056 hasAuthorship W2026050056A5044763904 @default.
• W2026050056 hasAuthorship W2026050056A5047651613 @default.
• W2026050056 hasAuthorship W2026050056A5080210254 @default.
• W2026050056 hasBestOaLocation W20260500561 @default.
• W2026050056 hasConcept C117760992 @default.
• W2026050056 hasConcept C145148216 @default.
• W2026050056 hasConcept C178790620 @default.
• W2026050056 hasConcept C181080969 @default.
• W2026050056 hasConcept C185592680 @default.
• W2026050056 hasConcept C2994325034 @default.
• W2026050056 hasConcept C519063684 @default.
• W2026050056 hasConcept C55493867 @default.
• W2026050056 hasConcept C79879829 @default.
• W2026050056 hasConcept C86803240 @default.
• W2026050056 hasConcept C87975464 @default.
• W2026050056 hasConcept C95444343 @default.
• W2026050056 hasConceptScore W2026050056C117760992 @default.
• W2026050056 hasConceptScore W2026050056C145148216 @default.
• W2026050056 hasConceptScore W2026050056C178790620 @default.

• next