FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2026547503> ?p ?o ?g. }

• W2026547503 endingPage "44246" @default.
• W2026547503 startingPage "44239" @default.
• W2026547503 abstract "The endoplasmic reticulum (ER) was investigated as the initial oligomerization site for the envelope glycoproteins H and F of measles virus (MV), a clinically relevant member of the Paramyxoviridae family, and consequences of this interaction for viral replication were studied. Both proteins were tagged at their cytosolic tails with RRR and KK XX motifs, respectively, resulting in their efficient retention in the ER. Co-transfection of the retained constructs with transport competent MV glycoproteins revealed a dominant negative effect on their biological activity indicating intracellular complex formation and thus retention. Pulse-chase analysis and co-immunoprecipitation experiments demonstrated that this effect is based on both homo- and hetero-oligomerization in the ER. Recombinant viruses additionally expressing ER-retained F showed an altered cytopathic phenotype accompanied by greatly reduced particle release. Similar mutant viruses additionally expressing ER-retained H could not be rescued indicating an even greater negative effect of this protein on virus viability. Our study suggests that both homo- and hetero-oligomerization of MV glycoproteins occur in the ER and that these events are of significance for early steps of particle assembly. The endoplasmic reticulum (ER) was investigated as the initial oligomerization site for the envelope glycoproteins H and F of measles virus (MV), a clinically relevant member of the Paramyxoviridae family, and consequences of this interaction for viral replication were studied. Both proteins were tagged at their cytosolic tails with RRR and KK XX motifs, respectively, resulting in their efficient retention in the ER. Co-transfection of the retained constructs with transport competent MV glycoproteins revealed a dominant negative effect on their biological activity indicating intracellular complex formation and thus retention. Pulse-chase analysis and co-immunoprecipitation experiments demonstrated that this effect is based on both homo- and hetero-oligomerization in the ER. Recombinant viruses additionally expressing ER-retained F showed an altered cytopathic phenotype accompanied by greatly reduced particle release. Similar mutant viruses additionally expressing ER-retained H could not be rescued indicating an even greater negative effect of this protein on virus viability. Our study suggests that both homo- and hetero-oligomerization of MV glycoproteins occur in the ER and that these events are of significance for early steps of particle assembly. measles virus MV-Edmonston strain hemagglutinin fusion hemagglutinin neuraminidase human parainfluenza virus endoplasmic reticulum multiplicity of infection plaque-forming units green fluorescent protein phosphate-buffered saline phenylmethylsulfonyl fluoride endoglycosidase H simian virus 5 Measles virus (MV)1 is a negative-stranded RNA virus of the Paramyxoviridae family. Despite the existence of an effective live attenuated vaccine based on the MV-Edmonston strain (MV-Edm), MV remains among the 10 most potent global pathogens, killing over 1 million children annually in countries where vaccination is not routine (1Murray C.J. Lopez A.D. Lancet. 1997; 349: 1269-1276Abstract Full Text Full Text PDF PubMed Scopus (3419) Google Scholar). The MV envelope consists of hemagglutinin (H) and fusion (F) glycoproteins. Whereas H binds to the MV receptors CD46 (2Naniche D. Varior-Krishnan G. Cervoni F. Wild T.F. Rossi B. Rabourdin-Combe C. Gerlier D. J. Virol. 1993; 67: 6025-6032Crossref PubMed Google Scholar, 3Dorig R.E. Marcil A. Chopra A. Richardson C.D. Cell. 1993; 75: 295-305Abstract Full Text PDF PubMed Scopus (874) Google Scholar) and signaling lymphocytic activation molecule (4Tatsuo H. Ono N. Tanaka K. Yanagi Y. Nature. 2000; 406: 893-897Crossref PubMed Scopus (859) Google Scholar, 5Hsu E.C. Iorio C. Sarangi F. Khine A.A. Richardson C.D. Virology. 2001; 279: 9-21Crossref PubMed Scopus (159) Google Scholar), F carries a hydrophobic fusion peptide that mediates membrane fusion upon receptor binding of H (6Richardson C. Hull D. Greer P. Hasel K. Berkovich A. Englund G. Bellini W. Rima B. Lazzarini R. Virology. 1986; 155: 508-523Crossref PubMed Scopus (121) Google Scholar). MV H is thought to exist at the viral surface as a tetramer consisting of a dimer of two covalently linked dimers (7Plemper R.K. Hammond A.L. Cattaneo R. J. Virol. 2000; 74: 6485-6493Crossref PubMed Scopus (57) Google Scholar), whereas F is considered to trimerize. Upon synthesis as an inactive precursor F0, the protein becomes proteolytically activated in the trans-Golgi network by furin yielding a large transmembrane F1 and a small F2 fragment. The mechanism of MV-induced membrane fusion may involve receptor-induced conformational changes in H and then F, pointing to a dynamic interaction between these proteins. This was first supported through studies showing that expression of H or hemagglutinin neuraminidase (HN) and F from the same paramyxovirus is necessary for efficient fusion, inferring their type-specific interaction (8Horvath C.M. Paterson R.G. Shaughnessy M.A. Wood R. Lamb R.A. J. Virol. 1992; 66: 4564-4569Crossref PubMed Google Scholar, 9Hu X.L. Ray R. Compans R.W. J. Virol. 1992; 66: 1528-1534Crossref PubMed Google Scholar, 10Tsurudome M. Kawano M. Yuasa T. Tabata N. Nishio M. Komada H. Ito Y. Virology. 1995; 213: 190-203Crossref PubMed Scopus (98) Google Scholar). Furthermore, specific mutations in HN lead to loss of fusion (10Tsurudome M. Kawano M. Yuasa T. Tabata N. Nishio M. Komada H. Ito Y. Virology. 1995; 213: 190-203Crossref PubMed Scopus (98) Google Scholar, 11Deng R. Wang Z. Mirza A.M. Iorio R.M. Virology. 1995; 209: 457-469Crossref PubMed Scopus (133) Google Scholar, 12Tanabayashi K. Compans R.W. J. Virol. 1996; 70: 6112-6118Crossref PubMed Google Scholar), and direct cell surface interactions between MV H and F (13Malvoisin E. Wild T.F. J. Gen. Virol. 1993; 74: 2365-2372Crossref PubMed Scopus (78) Google Scholar) and human parainfluenza virus 2 (HPIV-2) HN and F (14Yao Q. Hu X. Compans R.W. J. Virol. 1997; 71: 650-656Crossref PubMed Google Scholar) have been demonstrated by co-immunoprecipitation experiments. Although compelling evidence for an interaction between H/HN and F exists, it remains unclear at which stage of cellular processing this occurs. Upon synthesis, both proteins are integrated into the endoplasmic reticulum (ER) membrane. Because the ER possesses a high density of molecular chaperones (15Ellgaard L. Molinari M. Helenius A. Science. 1999; 286: 1882-1888Crossref PubMed Scopus (1064) Google Scholar), the virus might exploit these for the efficient formation of envelope glycoprotein complexes. Indeed, evidence for an ER association between HPIV-2 and -3 HN and F has been presented (16Tanaka Y. Heminway B.R. Galinski M.S. J. Virol. 1996; 70: 5005-5015Crossref PubMed Google Scholar, 17Tong S. Compans R.W. J. Gen. Virol. 1999; 80: 107-115Crossref PubMed Scopus (37) Google Scholar). However, in these studies soluble derivatives of the glycoproteins carrying KDEL sequences (18Munro S. Pelham H.R. Cell. 1987; 48: 899-907Abstract Full Text PDF PubMed Scopus (1578) Google Scholar) were used, which may show folding patterns distinct from the native transmembrane proteins. In contrast, another study demonstrated that full-length simian virus 5 (SV5) and HPIV-3 HN and F proteins retained in the ER did not affect transport of homotypic HN and F species (19Paterson R.G. Johnson M.L. Lamb R.A. Virology. 1997; 237: 1-9Crossref PubMed Scopus (33) Google Scholar). For these experiments, the authors added RRRRR (20Schutze M.P. Peterson P.A. Jackson M.R. EMBO J. 1994; 13: 1696-1705Crossref PubMed Scopus (268) Google Scholar) and KK XX motifs (21Jackson M.R. Nilsson T. Peterson P.A. EMBO J. 1990; 9: 3153-3162Crossref PubMed Scopus (727) Google Scholar) to the cytosolic tails of HN and F, respectively. In several studies theses retention motifs have proven to be valuable tools to study virus assembly (22Salzwedel K. West Jr., J.T. Mulligan M.J. Hunter E. J. Virol. 1998; 72: 7523-7531Crossref PubMed Google Scholar, 23Browne H. Bell S. Minson T. Wilson D.W. J. Virol. 1996; 70: 4311-4316Crossref PubMed Google Scholar) and the cell biology of secretory proteins (24Johannes L. Goud B. Trends Cell Biol. 1998; 8: 158-162Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar,25Maltese W.A. Wilson S. Tan Y. Suomensaari S. Sinha S. Barbour R. McConlogue L. J. Biol. Chem. 2001; 276: 20267-20279Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). All studies following the interaction of paramyxovirus glycoproteins retained in the ER so far were based on the fate of plasmid-encoded, transiently expressed glycoproteins. Therefore, the effect of intracellularly retained viral glycoproteins on productive complex assembly in the context of a viral infection is unclear. We show that the H and F glycoproteins of MV interact in the ER and that this interaction has consequences for viral replication. By examining the influence of transiently expressed ER-retained F and H on transport of their unmodified homologues, strong homotypic and heterotypic interactions of MV glycoproteins in the ER were identified, which significantly reduced their biological activity. During virus infection, these interactions were found to be important for MV release and cytopathicity, implicating the ER as a site of MV glycoprotein complex formation. Vero (African green monkey kidney), HT1080 (human bone fibrosarcoma), and PA317 (mouse hybridoma) cells were maintained in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, penicillin, and streptomycin at 37 °C and 5% CO2. Stably transfected HT1080 cells were grown in the presence of 2.5 μg/ml puromycin and 293-3-46 helper cells (26Radecke F. Spielhofer P. Schneider H. Kaelin K. Huber M. Dotsch C. Christiansen G. Billeter M.A. EMBO J. 1995; 14: 5773-5784Crossref PubMed Scopus (565) Google Scholar) in 1.2 μg/ml geneticin. For transient transfection LipofectAMINE (Life Technologies, Inc.) was used, and cells were analyzed 18–24 h post-transfection. To prepare virus stocks, Vero cells were infected at a multiplicity of infection (m.o.i.) of 0.1 plaque-forming units (pfu)/cell and incubated at 37 °C until particles were released by three freeze-thaw cycles. Titers were determined by 50% tissue culture infective dose (TCID50) titration on Vero cells according to the Spearman-Karber method (27Kado G. Dev. Biol. Stand. 1976; 37: 261-264PubMed Google Scholar). For virus growth kinetics, Vero cells (4 × 105 per time point) were infected with an m.o.i. of 0.03 pfu/cell and incubated at 37 °C. At the indicated time points, virus titers in cleared supernatants and freeze-thawed cell lysates were determined by TCID50 titration. Parental plasmids for mutagenesis and all experiments were pCG-HEdm and pCG-FEdmencoding MV-Edm H and F under the control of the cytomegalovirus promoter (28Cathomen T. Buchholz C.J. Spielhofer P. Cattaneo R. Virology. 1995; 214: 628-632Crossref PubMed Scopus (84) Google Scholar). Site-directed mutagenesis was performed using the quick change system (Stratagene) and mutant constructs confirmed by DNA sequencing and Western analysis. In all primer sequences altered or added nucleotides are underlined. Primers used to generate pCG-HEdm-ER were 5-CTTAGGGTGCAAGATCATCGATAATGCGACGTCGGCGCCGTTCACCACAACGAGACCGGATAAATGC and to generate pCG-FEdm-ER were 5-CCTATGTAAGGTCGCTCAAGAGTAAGACTCATTAATGATCCTCTACAACTCTTG. If indicated, the sequence encoding the FLAG epitope (DYKDDDDK) was inserted upstream of the MV-HEdm, MV-HEdm-ER, and MV-FEdm stop codon for detection purposes. Primers used were 5-CGGGAAGATGGAACCAATCGCAGAGACTACAAGGATGACGATGACAAGTAGGGCTGCTAGTGAACCAATCTC to generate MV-HEdm-CFLAG and MV-HEdm-ER CFLAG and 5-CATCAAAATCCTATGTAAGGTCGCTCGACTACAAGGATGACGATGACAAGTGATCCTCTACAACTCTTGAAACAC to generate MV-FEdm-CFLAG. Biological activity of all tagged proteins was unchanged when compared with the parental versions in transient transfection. To integrate HEdm-ER and FEdm-ER in a DNA copy of the measles genome, p(+)MV (26Radecke F. Spielhofer P. Schneider H. Kaelin K. Huber M. Dotsch C. Christiansen G. Billeter M.A. EMBO J. 1995; 14: 5773-5784Crossref PubMed Scopus (565) Google Scholar), MluI, and AatII restriction sites were introduced upstream and downstream of the open reading frames adhering to the reported “rule of six” requirement (29Calain P. Roux L. J. Virol. 1993; 67: 4822-4830Crossref PubMed Google Scholar). Primers used for pCG-HEdm-ER CFLAG were 5-CTTAGGGTGCAAGATCATCGATAACGCGTATGCGGCGTC GGCGCCGTTCACCACAAC to generate the MluI site and 5-GATGACAAGTAGGGCTGCTAGTGAACGACGTCACCAATCTCATGATGTCACCCAGAC to generate the AatII site. Primers used for pCG-FEdm-ER were 5-CAGAACCCAGACCCCGGCCCACACGCGTGCGCCCCCAACCCCCGACAACC to generate the MluI site and 5-CCCTCTGGCCGAACAATATCGGTAGACGTCAAAAG GATCCACTAGTTCTAGAGTCG to generate the AatII site. The MluI AatII fragments were ligated into MluI AatII digested p(+)MPeGFPV and p(+)MHeGFPV plasmids carrying GFP in post-P or post-H position (30Wang Z. Hangartner L. Cornu T.I. Martin L.R. Zuniga A. Billeter M.A. Naim H.Y. Vaccine. 2001; 19: 2329-2336Crossref PubMed Scopus (55) Google Scholar), thereby replacing GFP. This resulted in plasmids p(+)MV-(P)HEdm-ER and p(+)MV-(P)FEdm-ER and plasmids p(+)MV-(H)HEdm-ER and p(+)MV-(H)FEdm-ER. Measles genomes containing the GFP gene in pre-N position and the HEdm-ER-CFLAG or FEdm-ER open reading frame in post-H position were generated by cloning the GFP-containing SacII NotI fragment of p(+)MV-GFP (31Duprex W.P. McQuaid S. Hangartner L. Billeter M.A. Rima B.K. J. Virol. 1999; 73: 9568-9575Crossref PubMed Google Scholar) into SacII NotI-digested plasmids p(+)MV-(H)HEdm-ER and p(+)MV-(H)FEdm-ER, resulting in plasmids p(+)MV-GFP (H)HEdm-ER and p(+)MV-GFP (H)FEdm-ER. For Western analysis, 4 × 105 cells were transfected with 2.5 μg of plasmid DNA or infected with an m.o.i. of 0.03 pfu/cell and incubated at 37 °C. At the indicated times, cells were washed in phosphate-buffered saline (PBS) and lysed for 10 min at 4 °C in lysis buffer (50 mm Tris, pH 8.0; 62.5 mm EDTA; 0.4% deoxycholate; 1% Igepal (Sigma)) containing protease inhibitors (Complete mix (Roche Molecular Biochemicals)) and 1 mmphenylmethylsulfonyl fluoride (PMSF). Unless otherwise stated, 2.5 μg of total protein (determined using the DC Protein-Assay Kit (Bio-Rad)) was mixed with urea buffer (200 mm Tris, pH 6.8; 8m urea; 5% SDS; 0.1 mm EDTA; 0.03% bromphenol blue; 1.5% dithiothreitol) for 25 min at 50 °C. For nonreducing conditions, dithiothreitol was omitted. Samples were fractionated on SDS-polyacrylamide gels, blotted to polyvinylidene difluoride membranes (Millipore), probed with the indicated antibody, and analyzed by enhanced chemiluminescence (Amersham Pharmacia Biotech). For endoglycosidase H (Endo H) treatment, lysates were mixed with denaturing buffer (final concentration 0.5% SDS; 1% β-mercaptoethanol) for 25 min at 50 °C and then with deglycosylation buffer (final concentration 50 mm sodium citrate, pH 5.5) and 0.5 units of Endo H for 12 h at 37 °C. Urea buffer was added and samples subjected to Western analysis. Transfected Vero cells were incubated for 30 min in labeling medium lacking cysteine, methionine, and ammonium sulfate and then labeled with 100 μCi/ml [35S]methionine (Amersham Pharmacia Biotech) for 45 min at 37 °C. Subsequently, cells were incubated in chase medium containing 10% fetal calf serum at 37 °C for the indicated chase periods. For direct immunoprecipitation, cells were lysed in radioimmunoprecipitation assay buffer (10 mm Tris, pH 7.4; 1% deoxycholate; 1% Triton X-100; 0.1% SDS; 150 mmsodium chloride) containing protease inhibitors and 1 mmPMSF for 15 min at 4 °C and centrifuged for 25 min at 20,000 ×g and 4 °C. Lysates were incubated with antibodies directed against MV H (Chemicon) or the FLAG epitope (M2, Sigma) for 90 min at 4 °C and then immune complexes adsorbed to protein G-agarose (Life Technologies, Inc.) for 90 min at 4 °C. Precipitates were washed in lysis buffer, incubated in urea buffer for 25 min at 50 °C, and fractionated on SDS-polyacrylamide gels. Dried gels were exposed to Biomax films (Eastman Kodak Co.). Transfected Vero cells (5 × 103 cells in chamber slides (Chamber Slides; Lab Tec)) were fixed with methanol at −20 °C, washed with PBS, and permeabilized with PBS containing 1% Triton X-100. After blocking with nonspecific goat antiserum (Sigma), cells were incubated with antibodies specific for MV H or F tails (32Cathomen T. Naim H.Y. Cattaneo R. J. Virol. 1998; 72: 1224-1234Crossref PubMed Google Scholar) and subsequently with Texas Red-coupled anti-rabbit serum (Sigma). As ER marker, fluorescein isothiocyanate-coupled concanavalin A (Molecular Probes) was added to the secondary antibody. Cells were washed, fixed with ProLong Antifade Kit (Molecular Probes), and analyzed with a Zeiss LSM 510 confocal microscope. Transfected Vero cells (2 × 106) were scraped in resuspension buffer (10 mm Tris, pH 7.4; 10 mm sodium chloride; 1% Triton X-100; 0.5% sodium deoxycholate) containing protease inhibitors and 1 mm PMSF, and 600 μg of total protein was layered onto a 10–26% sucrose gradient prepared in resuspension buffer containing 0.1% Triton X-100. For control, proteins were treated with 0.5% SDS on ice prior to loading. Gradients were centrifuged in an SW41 rotor for 18 h at 38,000 rpm at 10 °C, and 10 equal fractions were collected. Proteins were precipitated with trichloroacetic acid, resuspended in urea buffer, and subjected to Western analysis. The location of marker proteins catalase (240,000 kDa), aldolase (158,000 kDa), and bovine serum albumin (68,000 kDa) (all Sigma) was determined by silver staining (Silver staining kit; Bio-Rad) of SDS-polyacrylamide gels. Unless otherwise stated, Vero cells were co-transfected in duplicate with 1.0 μg each of plasmid DNA encoding FEdm and HEdm or GFP for control, and 3.0 μg of FEdm-ER or HEdm-ER and incubated at 32 °C to prevent them from reaching over-confluency. The number of syncytia in 20 representative fields of view was determined at the indicated times. Cells were co-transfected with 2.5 μg each of plasmid DNA encoding FEdm and HEdm or the ER-retained versions. Cells were washed in PBS, scraped in co-immunoprecipitation buffer (10 mm Hepes, pH 7.4; 50 mm sodium pyrophosphate; 50 mm sodium fluoride; 50 mm sodium chloride; 5 mm EDTA; 5 mm EGTA; 100 μm sodium vanadate; 1% Triton X-100) containing protease inhibitors and 1 mm PMSF, and centrifuged for 25 min at 20,000 ×g and 4 °C. Protein complexes were immunoprecipitated from 300 μg of total protein using MV H-specific antibodies (Chemicon). As internal standard, 5 μg of total protein was directly mixed with urea buffer. After absorption of immune complexes to protein G-agarose (Life Technologies, Inc.), samples were washed in buffer 1 (100 mm Tris, pH 7.6; 500 mm lithium chloride; 0.1% Triton X-100; 1 mm dithiothreitol) and then in buffer 2 (20 mm Hepes, pH 7.2; 2 mm EGTA; 10 mm magnesium chloride; 0.% Triton X-100; 1 mmdithiothreitol), resuspended in urea buffer for 25 min at 50 °C, and subjected to Western analysis using antibodies specific for F tail. Recombinant MV particles were generated essentially as described (26Radecke F. Spielhofer P. Schneider H. Kaelin K. Huber M. Dotsch C. Christiansen G. Billeter M.A. EMBO J. 1995; 14: 5773-5784Crossref PubMed Scopus (565) Google Scholar). The helper cell line 293-3-46 stably expressing MV-N, MV-P, and T7-polymerase was co-transfected by calcium phosphate precipitation (ProFection; Promega) with plasmids encoding the MV genome and L polymerase. Helper cells were overlaid on Vero cells 76 h post-transfection and incubated until syncytia appeared or, for GFP-expressing viruses, fluorescence was detectable. Infectious centers were passaged on fresh Vero cells. The integrity of recombinant viruses was verified by reverse transcriptase-polymerase chain reaction and DNA sequencing. To generate ER-retained versions of full-length MV-Edm glycoproteins, a 5-amino acid RRRRR sequence was added to the cytosolic amino terminus of HEdm and a KSKTH sequence to the carboxyl terminus of FEdm (Fig.1 A). Expression and stability first of HEdm-ER was assessed by transient expression in Vero cells and pulse-chase analysis (Fig.1 B). Whereas the stability of HEdm-ER was similar to that observed for HEdm, HEdm-ER lacked the Golgi-specific conversion from core to complex N-linked oligosaccharide chains characterized by an ∼4 kDa increase in molecular mass over time (33Ogura H. Sato H. Kamiya S. Nakamura S. J. Gen. Virol. 1991; 72: 2679-2684Crossref PubMed Scopus (14) Google Scholar), suggesting its inhibited export from the ER. This was further assessed by treating the samples corresponding to 180-min chase time with endoglycosidase H (Endo H) prior to immunoblotting (Fig. 1 C). All of the HEdm-ER material was sensitive to Endo H treatment, supporting its efficient retention in the ER. Because most oligosaccharides on F0 are highly sensitive to Endo H (34Hu A. Cathomen T. Cattaneo R. Norrby E. J. Gen. Virol. 1995; 76: 705-710Crossref PubMed Scopus (36) Google Scholar), Endo H resistance cannot be used to monitor its ER export. Instead, processing of MV F from F0 to F1, mediated by furin in late Golgi compartments (35Bolt G. Pedersen I.R. Virology. 1998; 252: 387-398Crossref PubMed Scopus (51) Google Scholar), was assessed after transient transfection of Vero cells; most unmodified FEdmwas proteolytically activated, but no antigenic material corresponding to an F1 fraction could be detected for FEdm-ER supporting its ER localization (Fig. 1 D). To investigate further the ER retention of HEdm-ER and FEdm-ER, their co-localization with an ER-specific lectin, concanavalin (Con) A, was compared with that of the unmodified parental proteins by confocal microscopy (Fig. 1, E and F). Localization of HEdm-ER overlapped almost exclusively with ConA staining, confirming the ER retention of the HEdm-ER protein. In cells expressing HEdm, however, only some overlap with Con A staining was observed corresponding to the normal steady state level of HEdm in the ER. Slightly greater co-staining of FEdm with ConA was observed (Fig. 1 F), presumably reflecting a slightly higher steady state level of transport-competent FEdm than HEdm in the ER. In cells expressing FEdm-ER, however, almost complete co-localization with ConA was observed, confirming its ER retention. To analyze whether the presence of the ER retention signals influences native folding of HEdm-ER and FEdm-ER, their ability to homo-oligomerize was monitored. Covalently linked H-H homodimers were detected by separation of transiently expressed material under reducing and nonreducing conditions (Fig. 2 A). Both HEdm and HEdm-ER migrated exclusively as dimers under nonreducing conditions, whereas treatment of cell lysates with 1.5% dithiothreitol resulted in migration of both variants as monomers. Because MV F protein is thought to exist as a noncovalently linked trimer, sucrose gradient fractionation of FEdm-ER or FEdm proteins was employed to detect oligomeric versions (Fig. 2 B). The majority of unmodified F0 was found in fraction 5 corresponding to the molecular weight of an F trimer as determined by comparison with molecular weight marker proteins. Cleavage of F0 into F1 seemed to reduce the stability of the trimers because an increasing amount of F1 material was found in earlier fractions of the gradient corresponding to monomeric F protein. FEdm-ER was not proteolytically processed, and its F0 form was predominantly found in fraction 5, although some antigenic material corresponding to higher order complexes could be detected. Treatment of both FEdm and FEdm-ER with 0.5% SDS resulted in a shift of protein to the monomeric form sedimenting in fraction 3 of the gradient because of destruction of noncovalent complexes. Thus, F and H homo-oligomerization capacities are unchanged by their ER retention. We assessed the biological consequence of the ER localization of FEdm-ER and HEdm-ER by studying their effect on syncytium induction mediated by unmodified MV H and F when transiently co-expressed in Vero cells (Fig. 3 A). Expression of either HEdm-ER with unmodified FEdm or, reciprocally, FEdm-ER with unmodified HEdm resulted in minimal syncytium formation, consistent with efficient intracellular retention of HEdm-ER and FEdm-ER. Expression of both unmodified HEdm and FEdm with a 3-fold excess of HEdm-ER resulted in a dominant negative effect on syncytium formation, with a delay in development of cytopathic effects. Expression of FEdm-ER with unmodified HEdm and FEdm also delayed the onset of syncytia but to a lesser degree than that observed with HEdm-ER. This difference is probably because of the covalent and therefore more stable dimerization of MV H in comparison to the noncovalent homo-oligomerization observed for MV F. By using a 5-fold excess of the ER-retained constructs to establish more stringent retention of the unmodified proteins, only very few isolated syncytia could be detected in contrast to the massive formation of syncytia in cells expressing the unmodified proteins alone (Fig. 3 B). Subsequent Western analysis of cell lysates revealed that in the presence of FEdm-ER, proteolytic processing of FEdm to F1 was strongly inhibited, whereas in its absence, FEdm was efficiently processed to F1 indicating transport to post-ER compartments (Fig. 3 C). Similarly, in the cells co-expressing HEdm-ER (Fig.3 D), HEdm showed a strongly reduced rate of Golgi-type carbohydrate chain trimming, indicated by its nearly complete sensitivity to Endo H treatment. In the absence of HEdm-ER however, ∼50% of HEdm was found to be resistant to Endo H treatment. Thus, both FEdm and HEdm are strongly retained in the ER in the presence of FEdm-ER and HEdm-ER, respectively. To address whether hetero-oligomerization of the ER-retained glycoproteins with their unmodified counterparts also contributes to the dominant negative phenotype, their influence on transport kinetics of HEdm and FEdm was investigated by pulse-chase analysis (Fig. 4,A and B). FLAG epitope-tagged versions of HEdm and FEdm proteins were used for these experiments to achieve identical immunoprecipitation conditions. Transport kinetics of the tagged glycoproteins were shown not to be influenced by the FLAG epitope itself (Ref. 7Plemper R.K. Hammond A.L. Cattaneo R. J. Virol. 2000; 74: 6485-6493Crossref PubMed Scopus (57) Google Scholar and data not shown). In the presence of equivalent amounts of HEdm and FEdm-ER, kinetics of carbohydrate chain conversion of HEdm to the Golgi-specific pattern was significantly reduced, with far less than 50% conversion after 180 min (Fig.4 A). In contrast, when co-expressed with FEdm, 50% carbohydrate chain conversion of HEdm was observed after less than 120 min. When the reciprocal analysis of FEdm transport was carried out, FEdm was processed efficiently, with furin cleavage ∼75% complete by 120 min in the presence of unmodified HEdm (Fig. 4 B). After co-expression with HEdm-ER, however, processing to F1 was less than 30% complete after 120-min chase time. Thus, both HEdm and FEdm are significantly retained in the ER because of a heterotypic interaction with HEdm-ER and FEdm-ER, respectively. Interestingly, the amount of metabolically labeled FEdmimmunoprecipitated in the presence of HEdm-ER was consistently reduced compared with that in cells co-expressing HEdm. Conceivably, this reflects a slightly reduced FEdm protein expression level in the presence of HEdm-ER. To assess hetero-oligomerization of MV glycoproteins in the ER by a more direct biochemical approach, we followed the interaction of FEdm or FEdm-ER with HEdm or HEdm-ER by co-immunoprecipitation of MV F with H, using anti-F antibodies for detection by Western analysis (Fig.4 C). The relative efficiency of co-precipitation was determined for each sample by comparison with directly loaded total cell lysates. FEdm-ER not only co-precipitated with HEdm, but this interaction was significantly more efficient than that of the unmodified parental proteins FEdm with HEdm. Similarly, the reciprocal co-immunoprecipitation of FEdm with HEdm-ER was substantially more efficient than that of FEdm with HEdm (Fig.4 C). For control, cells were co-transfected with both ER-retained glycoproteins; as expected very efficient co-precipitation was observed under these conditions. Thus, the dominant negative effect of the ER-retained species on syncytium formation is attributable to both homotypic interaction of FEdm-ER with FEdmor HEdm-ER with HEdm and heterotypic oligomerization of FEdm-ER trimers with HEdm or HEdm-ER complexes with FEdm. To address the interference function of HEdm-ER, which displayed the stronger negative effect on syncytium formation, in a viral infection, an MV-susceptible HT1080 cell line stably expressing HEdm-ER was generated. When infected with MV-Edm, however, generation of cell-associated infectious MV particles was unaffected, although release of virus was reduced at early time points (data not shown). Assessing the relative levels of nuclear and virally encoded H proteins demonstrated that the virus overcomes any inhibitory effects of HEdm-ER by producing a vast excess of virally encoded HEdm. To express ER-retained glycoproteins at higher levels in the context of a viral infection, the genes encoding HEdm-ER and FEdm-ER were thus inserted as additional transcription units downstream of either P or H in a positive strand copy of the MV genome (Fig. 5 A). Because of a transcription gradient described for MV, levels of gene expression from the P position are about three times higher than from the H position (36Cattaneo R. Rebmann G. Schmid A. Baczko K. ter Meulen V. Billeter M.A. EMBO J. 1987; 6: 681-688Crossref PubMed Scopus (163) Google Scholar). In repeated attempts none of these recombinant MVs could be recovered, whereas parallel rescues of unmodified MV-Edm were successful (data not shown). To facilitate detection of infection, full-length genomes carrying GFP in addition to HEdm-ER and FEdm-ER in post-H position were generated (Fig. 5 A). Whereas MV-GFP (H)HEdm-ER could not be rescued, MV-GFP (H)FEdm-ER was recovered, and the integrity of the insert in the viral genome was confirmed for several independent clones by reverse transcriptase-polymerase chain reaction and DNA sequencing (data not shown). When a single infectious center of either MV-GFP (H)FEdm-ER or MV-GFP was transferred to Vero cells, MV-GFP spread completely through the cell monolayer by 5 days post-infection (Fig. 5 B). In contrast, MV-GFP (H)FEdm-ER demonstrated a greatly reduced lateral spread characterized by the formation of very few defined syncytia even 7 days post-infection. Release of MV-GFP (H)FEdm-ER particles into the medium was greatly delayed in comparison with MV-GFP, with ∼100-fold less particles released at 48–56 h post-infection (Fig. 5 C). This finding mirrored our previous observation of delayed particle release from HT1080 HEdm-ER cells. Consistent with the viral growth curve, barely detectable levels of F1 in released MV-GFP (H)FEdm-ER particles were found 64 h post-infection, whereas F1 incorporated into MV-GFP was detected 48 h post-infection (Fig. 5 D). In MV-GFP-infected cells, F1 was detected 40 h post-infection, and the F1 signal was stronger than the F0 signal (Fig. 5 E), a pattern of F expression consistent in MV infections. In MV-GFP (H)FEdm-ER-infected cells, however, appearance of F1 was greatly delayed as compared with F0, with a faint F1 band visible only after 48 h (Fig. 5 E). In contrast, ER export of MV H, as measured by conversion from core to Golgi-specific complex N-linked oligosaccharide chains, was only slightly reduced (Fig. 5 F), suggesting a stronger homotypic interaction in the context of this virus. Thus, in the presence of virally encoded FEdm-ER protein, transport of MV F and release of viral particles are significantly impaired resulting in a diminished cytopathic effect. Our study demonstrates that ER-localized MV H and F proteins interfere with the ER export of their unmodified homologues via both homo- and hetero-oligomerization. Importantly, ER retention of H and F has biological consequences, not only diminishing their ability to induce cell-cell fusion upon transient expression but also reducing particle release in the context of a viral infection. Although a concern of our approach may be that ER retention of MV H and F results in formation of non-native multimers,the demonstration that both proteins are able to homo-oligomerize efficiently suggests that this is not the case. Furthermore, that ER-retained SV5 and HPIV-3 HN and F carrying similar retention signals do not interact with their unmodified counterparts (19Paterson R.G. Johnson M.L. Lamb R.A. Virology. 1997; 237: 1-9Crossref PubMed Scopus (33) Google Scholar) suggests that our contrasting findings are not a general consequence of the approach but rather reflect a specific property of MV glycoprotein complex formation. Given the native conformation of our ER-retained MV glycoproteins and their inhibitory effect on biological activity of unmodified H and F through both homo- and hetero-oligomerization when transiently expressed, it was feasible to assess their impact on virus replication. When ER-retained and nonretained glycoproteins were both virally encoded, the retained proteins apparently had a strong negative effect on virus viability. Several recombinant MV genomes were constructed, but only that expressing the protein least efficient in ER retention, FEdm-ER, at the lowest level could be recovered and propagated. In MV-GFP (H)FEdm-ER infected cells release of viral particles was severely impaired, and secondary infections were greatly reduced, resulting in a delay of viral spread through a cell monolayer. Consistent with this, processing of F0 to F1 was markedly delayed, suggesting ER retention of the virus-encoded unmodified F protein. This delay was not mirrored when following cell-associated infectious titer, possibly reflecting activation by furin cleavage of the ER-retained particles during the harvesting process. Although our transient expression data demonstrate both homo- and hetero-oligomerization of MV H and F in the ER, ER export of H in MV-GFP (H)FEdm-ER-infected cells was not significantly delayed. Thus under these conditions hetero-oligomerization of HEdm with FEdm-ER cannot be observed, possibly because of a combination of stronger homotypic than heterotypic interaction in the ER and a lower expression level of FEdm-ER compared with unmodified F. The recombinant particles in which this ratio is reversed, however, could not be rescued. In contrast to our findings, ER-retained HN and F proteins of the related SV5 and human parainfluenza virus type 3 (HPIV-3) do not interact with their unmodified homologues when transiently expressed (19Paterson R.G. Johnson M.L. Lamb R.A. Virology. 1997; 237: 1-9Crossref PubMed Scopus (33) Google Scholar). For these paramyxoviruses, it is therefore likely that HN and F interact functionally only at the cell surface, a strategy that may prevent fusion in inappropriate cellular compartments after furin cleavage. That MV H and F proteins do interact in the ER suggests MV must either adopt a different mechanism to prevent premature fusion or must not require such a strategy at all. It is intriguing to speculate that distinct entry mechanisms for different paramyxoviruses may confer virus-specific requirements for fusion regulation. The receptor for both SV5 and HPIV-3, and all paramyxoviridae with neuraminidase activity, is the abundant ganglioside sialic acid (37Markwell M.A. Paulson J.C. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 5693-5697Crossref PubMed Scopus (99) Google Scholar, 38Suzuki T. Portner A. Scroggs R.A. Uchikawa M. Koyama N. Matsuo K. Suzuki Y. Takimoto T. J. Virol. 2001; 75: 4604-4613Crossref PubMed Scopus (110) Google Scholar). In contrast, MV uses a specific protein, either CD46 or signaling lymphocytic activation molecule as a receptor (2Naniche D. Varior-Krishnan G. Cervoni F. Wild T.F. Rossi B. Rabourdin-Combe C. Gerlier D. J. Virol. 1993; 67: 6025-6032Crossref PubMed Google Scholar, 3Dorig R.E. Marcil A. Chopra A. Richardson C.D. Cell. 1993; 75: 295-305Abstract Full Text PDF PubMed Scopus (874) Google Scholar, 4Tatsuo H. Ono N. Tanaka K. Yanagi Y. Nature. 2000; 406: 893-897Crossref PubMed Scopus (859) Google Scholar). These proteins may be less available for early fusion than sialic acid, rendering the problem of inappropriate intracellular less pronounced for MV. In conclusion, the data obtained in our study show that MV H and F glycoprotein oligomers associate in the ER and that this interaction has relevance for efficient virus replication. Thus, the ER may be considered an assembly site of functional MV glycoprotein complexes. Although we have not observed any escape mutants of the virus expressing FEdm-ER so far, it is intriguing whether extended passaging results in the appearance of such mutants with altered glycoprotein complex stability. Analysis of these mutations may allow further insight into requirements for the interaction of H and F and thus into the earliest steps of MV particle assembly. We thank L. Hangartner and M. Billeter for providing plasmids encoding full-length MV genomes, B. Fuchs and S. Vongpunsawad for assistance, and A. Fielding for critical reading of the manuscript." @default.
• W2026547503 created "2016-06-24" @default.
• W2026547503 creator A5065473767 @default.
• W2026547503 creator A5070703755 @default.
• W2026547503 creator A5079468607 @default.
• W2026547503 date "2001-11-01" @default.
• W2026547503 modified "2023-09-27" @default.
• W2026547503 title "Measles Virus Envelope Glycoproteins Hetero-oligomerize in the Endoplasmic Reticulum" @default.
• W2026547503 cites W1521407235 @default.
• W2026547503 cites W1591890160 @default.
• W2026547503 cites W1605220975 @default.
• W2026547503 cites W1845094941 @default.
• W2026547503 cites W1850066587 @default.
• W2026547503 cites W1903694863 @default.
• W2026547503 cites W1976525356 @default.
• W2026547503 cites W1994974221 @default.
• W2026547503 cites W2002942987 @default.
• W2026547503 cites W2007143893 @default.
• W2026547503 cites W2010086813 @default.
• W2026547503 cites W2020958698 @default.
• W2026547503 cites W2034579075 @default.
• W2026547503 cites W2042288895 @default.
• W2026547503 cites W2045893780 @default.
• W2026547503 cites W2050394333 @default.
• W2026547503 cites W2051043872 @default.
• W2026547503 cites W2064185793 @default.
• W2026547503 cites W2064697966 @default.
• W2026547503 cites W2065954860 @default.
• W2026547503 cites W2102530926 @default.
• W2026547503 cites W2105502162 @default.
• W2026547503 cites W2108361166 @default.
• W2026547503 cites W2116345938 @default.
• W2026547503 cites W2116432774 @default.
• W2026547503 cites W2132242260 @default.
• W2026547503 cites W2136487762 @default.
• W2026547503 cites W2142204958 @default.
• W2026547503 cites W2145835877 @default.
• W2026547503 cites W2153520212 @default.
• W2026547503 cites W2157692781 @default.
• W2026547503 cites W2159689005 @default.
• W2026547503 cites W2162180102 @default.
• W2026547503 cites W2169866627 @default.
• W2026547503 cites W2408822320 @default.
• W2026547503 cites W76787895 @default.
• W2026547503 cites W86630917 @default.
• W2026547503 doi "https://doi.org/10.1074/jbc.m105967200" @default.
• W2026547503 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11535597" @default.
• W2026547503 hasPublicationYear "2001" @default.
• W2026547503 type Work @default.
• W2026547503 sameAs 2026547503 @default.
• W2026547503 citedByCount "105" @default.
• W2026547503 countsByYear W20265475032012 @default.
• W2026547503 countsByYear W20265475032013 @default.
• W2026547503 countsByYear W20265475032014 @default.
• W2026547503 countsByYear W20265475032015 @default.
• W2026547503 countsByYear W20265475032016 @default.
• W2026547503 countsByYear W20265475032017 @default.
• W2026547503 countsByYear W20265475032018 @default.
• W2026547503 countsByYear W20265475032019 @default.
• W2026547503 countsByYear W20265475032020 @default.
• W2026547503 countsByYear W20265475032021 @default.
• W2026547503 countsByYear W20265475032023 @default.
• W2026547503 crossrefType "journal-article" @default.
• W2026547503 hasAuthorship W2026547503A5065473767 @default.
• W2026547503 hasAuthorship W2026547503A5070703755 @default.
• W2026547503 hasAuthorship W2026547503A5079468607 @default.
• W2026547503 hasBestOaLocation W20265475031 @default.
• W2026547503 hasConcept C108625454 @default.
• W2026547503 hasConcept C127413603 @default.
• W2026547503 hasConcept C158617107 @default.
• W2026547503 hasConcept C159047783 @default.
• W2026547503 hasConcept C185592680 @default.
• W2026547503 hasConcept C22070199 @default.
• W2026547503 hasConcept C2776438120 @default.
• W2026547503 hasConcept C2778199166 @default.
• W2026547503 hasConcept C554190296 @default.
• W2026547503 hasConcept C55493867 @default.
• W2026547503 hasConcept C65155139 @default.
• W2026547503 hasConcept C76155785 @default.
• W2026547503 hasConcept C86803240 @default.
• W2026547503 hasConcept C95444343 @default.
• W2026547503 hasConceptScore W2026547503C108625454 @default.
• W2026547503 hasConceptScore W2026547503C127413603 @default.
• W2026547503 hasConceptScore W2026547503C158617107 @default.
• W2026547503 hasConceptScore W2026547503C159047783 @default.
• W2026547503 hasConceptScore W2026547503C185592680 @default.
• W2026547503 hasConceptScore W2026547503C22070199 @default.
• W2026547503 hasConceptScore W2026547503C2776438120 @default.
• W2026547503 hasConceptScore W2026547503C2778199166 @default.
• W2026547503 hasConceptScore W2026547503C554190296 @default.
• W2026547503 hasConceptScore W2026547503C55493867 @default.
• W2026547503 hasConceptScore W2026547503C65155139 @default.
• W2026547503 hasConceptScore W2026547503C76155785 @default.
• W2026547503 hasConceptScore W2026547503C86803240 @default.
• W2026547503 hasConceptScore W2026547503C95444343 @default.
• W2026547503 hasIssue "47" @default.
• W2026547503 hasLocation W20265475031 @default.
• W2026547503 hasOpenAccess W2026547503 @default.

• next