FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2027838253> ?p ?o ?g. }

• W2027838253 endingPage "42343" @default.
• W2027838253 startingPage "42334" @default.
• W2027838253 abstract "Salt-inducible kinase (SIK), a serine/threonine protein kinase expressed at an early stage of adrenocorticotropic hormone (ACTH) stimulation in Y1 mouse adrenocortical tumor cells, repressed the cAMP-responsive element (CRE)-dependent gene transcription by acting on the basic leucine zipper domain of the CRE-binding protein (Doi, J., Takemori, H., Lin, X.-z., Horike, N., Katoh, Y., and Okamoto, M. (2002)J. Biol. Chem. 277, 15629–15637). The mechanism of SIK-mediated gene regulation has been further explored. Here we show that SIK changes its subcellular location after the addition of ACTH. The immunocytochemical and fluorocytochemical analyses showed that SIK was present both in the nuclear and cytoplasmic compartments of resting cells; when the cells were stimulated with ACTH the nuclear SIK moved into the cytoplasm within 15 min; the level of SIK in the nuclear compartment gradually returned to the initial level after 12 h. SIK translocation was blocked by pretreatment with leptomycin B. A mutant SIK whose Ser-577, the cAMP-dependent protein kinase (PKA)-dependent phosphorylation site, was replaced with Ala could not move out of the nucleus under stimulation by ACTH. As expected, the degree of repression exerted by SIK on CRE reporter activity was weak as long as SIK was present in the cytoplasmic compartment. The same was true for the SIK-mediated repression of a steroidogenic acute regulatory (StAR) protein-gene promoter, which contained a CRE-like sequence at −95 to −85 bp. These results suggest that in the ACTH-stimulated Y1 cells the nuclear SIK was PKA-dependently phosphorylated, and the phosphorylated SIK was then translocated out of the nuclei. This intracellular translocation of SIK, a CRE-repressor, may account for the time-dependent change in the level of ACTH-activated expression of the StAR protein gene. Salt-inducible kinase (SIK), a serine/threonine protein kinase expressed at an early stage of adrenocorticotropic hormone (ACTH) stimulation in Y1 mouse adrenocortical tumor cells, repressed the cAMP-responsive element (CRE)-dependent gene transcription by acting on the basic leucine zipper domain of the CRE-binding protein (Doi, J., Takemori, H., Lin, X.-z., Horike, N., Katoh, Y., and Okamoto, M. (2002)J. Biol. Chem. 277, 15629–15637). The mechanism of SIK-mediated gene regulation has been further explored. Here we show that SIK changes its subcellular location after the addition of ACTH. The immunocytochemical and fluorocytochemical analyses showed that SIK was present both in the nuclear and cytoplasmic compartments of resting cells; when the cells were stimulated with ACTH the nuclear SIK moved into the cytoplasm within 15 min; the level of SIK in the nuclear compartment gradually returned to the initial level after 12 h. SIK translocation was blocked by pretreatment with leptomycin B. A mutant SIK whose Ser-577, the cAMP-dependent protein kinase (PKA)-dependent phosphorylation site, was replaced with Ala could not move out of the nucleus under stimulation by ACTH. As expected, the degree of repression exerted by SIK on CRE reporter activity was weak as long as SIK was present in the cytoplasmic compartment. The same was true for the SIK-mediated repression of a steroidogenic acute regulatory (StAR) protein-gene promoter, which contained a CRE-like sequence at −95 to −85 bp. These results suggest that in the ACTH-stimulated Y1 cells the nuclear SIK was PKA-dependently phosphorylated, and the phosphorylated SIK was then translocated out of the nuclei. This intracellular translocation of SIK, a CRE-repressor, may account for the time-dependent change in the level of ACTH-activated expression of the StAR protein gene. adrenocorticotropic hormone cAMP-dependent protein kinase steroidogenic acute regulatory cholesterol side-chain cleavage cytochrome P450 salt-inducible kinase cAMP response element-binding protein cAMP response element steroidogenic factor-1 8-bromo-cyclic AMP hemagglutinin glutathione S-transferase CRE modulator keyhole limpet hemocyanin phospho-Ser-577 basic leucine zipper the NH2-terminal domain of SIK phosphate-buffered saline Extracellular hormonal stimuli, received at the cell surface by the corresponding receptors, are transduced into several chemical messengers in the cytoplasm and regulate the transcription of genes in the nuclei. Adrenocorticotropic hormone (ACTH),1 binding to its receptor on the adrenocortical cell surface, activates adenylate cyclase and increases intracellular cAMP, which in turn activates the cAMP-dependent protein kinase (PKA) (1Kramer R.E. Rainey W.E. Funkenstein B. Dee A. Simpson E.R. Waterman M.R. J. Biol. Chem. 1984; 259: 707-713Abstract Full Text PDF PubMed Google Scholar, 2Olson M.F. Krolczyk A.J. Gorman K.B. Steinberg R.A. Schimmer B.P. Mol. Endocrinol. 1993; 7: 477-487Crossref PubMed Scopus (0) Google Scholar, 3Richards J.S. Mol. Endocrinol. 2001; 15: 209-218Crossref PubMed Scopus (340) Google Scholar). The activated PKA then promptly stimulates the biosynthesis and secretion of steroid hormone. This is achieved through stimulation of several intracellular events; PKA activates cholesterol esterases (4Trzeciak W.H. Boyd G.S. Eur. J. Biochem. 1973; 37: 327-333Crossref PubMed Scopus (66) Google Scholar, 5Cook K.G. Yeaman S.J. Stralfors P. Fredrikson G. Belfrage P. Eur. J. Biochem. 1982; 125: 245-249Crossref PubMed Scopus (100) Google Scholar, 6Beins D.M. Vining R. Balasubramaniam S. Biochem. J. 1982; 202: 631-637Crossref PubMed Scopus (26) Google Scholar, 7Holm C. Belfrage P. Fredrikson G. Biochem. Biophys. Res. Commun. 1987; 148: 99-105Crossref PubMed Scopus (132) Google Scholar), thus increasing the intracellular cholesterol pool, and elevates the levels of transcription (8Clark B.J. Soo S.C. Caron K.M. Ikeda Y. Parker K.L. Stocco D.M. Mol. Endocrinol. 1995; 9: 1346-1355Crossref PubMed Google Scholar, 9Caron K.M. Ikeda Y. Soo S.C. Stocco D.M. Parker K.L. Clark B.J. Mol. Endocrinol. 1997; 11: 138-147Crossref PubMed Scopus (219) Google Scholar), mRNA stability (10Ariyoshi N. Kim Y.C. Artemenko I. Bhattacharyya K.K. Jefcoate C.R. J. Biol. Chem. 1998; 273: 7610-7619Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar), translation (8Clark B.J. Soo S.C. Caron K.M. Ikeda Y. Parker K.L. Stocco D.M. Mol. Endocrinol. 1995; 9: 1346-1355Crossref PubMed Google Scholar), and post-translational modification (11Arakane F. Sugawara T. Nishino H. Liu Z. Holt J.A. Pain D. Stocco D.M. Miller W.L. Strauss 3rd., J.F. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 13731-13736Crossref PubMed Scopus (249) Google Scholar, 12Arakane F. Kallen C.B. Watari H. Foster J.A. Sepuri N.B. Pain D. Stayrook S.E. Lewis M. Gerton G.L. Strauss 3rd., J.F. J. Biol. Chem. 1998; 273: 16339-16345Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar, 13Clark B.J. Ranganathan V. Combs R. Mol. Cell. Endocrinol. 2001; 173: 183-192Crossref PubMed Scopus (38) Google Scholar, 14Artemenko I.P. Zhao D. Hales D.B. Hales K.H. Jefcoate C.R. J. Biol. Chem. 2001; 276: 46583-46596Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 15Bose H. Lingappa V.R. Miller W.L. Nature. 2002; 417: 87-91Crossref PubMed Scopus (281) Google Scholar) of the steroidogenic acute regulatory (StAR) protein (16Clark B.J. Wells J. King S.R. Stocco D.M. J. Biol. Chem. 1994; 269: 28314-28322Abstract Full Text PDF PubMed Google Scholar). This accelerates the transport of cholesterol from the outer to inner mitochondrial membranes, which activates the side chain cleavage cytochrome P450 (CYP11A) reaction (17Gwynne J.T. Strauss 3rd., J.F. Endocr. Rev. 1982; 3: 299-329Crossref PubMed Scopus (440) Google Scholar, 18Stocco D.M. Nat. Struct. Biol. 2000; 7: 445-447Crossref PubMed Scopus (24) Google Scholar, 19Stocco D.M. Biochim. Biophys. Acta. 2000; 1486: 184-197Crossref PubMed Scopus (127) Google Scholar, 20Christenson L.K. Strauss 3rd., J.F. Arch. Med. Res. 2001; 32: 576-586Crossref PubMed Scopus (110) Google Scholar, 21Stocco D.M. Mol. Endocrinol. 2001; 15: 1245-1254Crossref PubMed Scopus (150) Google Scholar). The resultant elevation of the plasma glucocorticoid level acts as a negative signal on the ACTH secretion from the pituitary gland, thus completing the feedback regulatory loop of the hypothalamic-pituitary-adrenocortical axis (22Chalmers D.T. Lovenberg T.W. Grigoriadis D.E. Behan D.P. De Souza E.B. Trends Pharmacol. Sci. 1996; 17: 166-172Abstract Full Text PDF PubMed Scopus (372) Google Scholar, 23Timpl P. Spanagel R. Sillaber I. Kresse A. Reul J.M. Stalla G.K. Blanquet V. Steckler T. Holsboer F. Wurst W. Nat. Genet. 1998; 19: 162-166Crossref PubMed Scopus (817) Google Scholar). Several signaling molecules (24Reyland M.E. Mol. Endocrinol. 1993; 7: 1021-1030Crossref PubMed Scopus (24) Google Scholar, 25Bird I.M. Pasquarette M.M. Rainey W.E. Mason J.I. J. Clin. Endocrinol. Metab. 1996; 81: 2171-2178Crossref PubMed Scopus (63) Google Scholar, 26Wang X. Walsh L.P. Reinhart A.J. Stocco D.M. J. Biol. Chem. 2000; 275: 20204-20209Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 27Reyland M.E. Evans R.M. White E.K. J. Biol. Chem. 2000; 275: 36637-36644Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar, 28Doi J. Takemori H. Ohta M. Nonaka Y. Okamoto M. J. Endocrinol. 2001; 168: 87-94Crossref PubMed Scopus (19) Google Scholar, 29Gyles S.L. Burns C.J. Whitehouse B.J. Sugden D. Marsh P.J. Persaud S.J. Jones P.M. J. Biol. Chem. 2001; 276: 34888-34895Abstract Full Text Full Text PDF PubMed Scopus (148) Google Scholar, 30Seger R. Hanoch T. Rosenberg R. Dantes A. Merz W.E. Strauss 3rd, J.F. Amsterdam A. J. Biol. Chem. 2001; 276: 13957-13964Abstract Full Text Full Text PDF PubMed Scopus (209) Google Scholar) other than those mentioned above, such as phosphodiesterase (31Gallo-Payet N. Cote M. Chorvatova A. Guillon G. Payet M.D. J. Steroid Biochem. Mol. Biol. 1999; 69: 335-342Crossref PubMed Scopus (26) Google Scholar) and protein phosphatase (32Sewer M.B. Waterman M.R. Endocrinology. 2002; 143: 1769-1777Crossref PubMed Scopus (103) Google Scholar) have also been implicated in regulating steroidogenesis, indicating that the steroidogenic cells are equipped with finely tuned signal transducing systems. However, the precise mechanism underlying the acute regulation of steroidogenic gene expression, including the molecular events occurring during the initiation, maintenance, and termination of the steroidogenic gene transcription, is as yet not well understood. Salt-inducible kinase (SIK) was identified as a serine/threonine protein kinase induced in the adrenal glands of high-salt diet-fed rats (33Halder S.K. Takemori H. Hatano O. Nonaka Y. Wada A. Okamoto M. Endocrinology. 1998; 139: 3316-3328Crossref PubMed Scopus (90) Google Scholar, 34Wang Z. Takemori H. Halder S.K. Nonaka Y. Okamoto M. FEBS Lett. 1999; 453: 135-139Crossref PubMed Scopus (114) Google Scholar). When Y1 mouse adrenocortical tumor cells were incubated with ACTH, the cellular levels of mRNA, protein, and kinase activity of SIK were elevated within 1 h through the cAMP/PKA signaling mechanism, and then after a few hours the levels declined (35Lin X. Takemori H. Katoh Y. Doi J. Horike N. Makino A. Nonaka Y. Okamoto M. Mol. Endocrinol. 2001; 15: 1264-1276Crossref PubMed Scopus (51) Google Scholar). In contrast, the transcription of StAR andCYP11A genes begin later, at a time coinciding with the decline of the SIK level. A finding that the ACTH-induced transcription of the CYP11A gene failed to occur in SIK-overexpressing cells (35Lin X. Takemori H. Katoh Y. Doi J. Horike N. Makino A. Nonaka Y. Okamoto M. Mol. Endocrinol. 2001; 15: 1264-1276Crossref PubMed Scopus (51) Google Scholar) prompted us to explore further the mechanism of action of SIK. Subsequent studies (36Doi J. Takemori H. Lin X.-z. Horike N. Katoh Y. Okamoto M. J. Biol. Chem. 2002; 277: 15629-15637Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar) demonstrated that SIK repressed the PKA-induced activation of the human CYP11A gene promoter by acting on cAMP-responsive element (CRE)-binding protein (CREB) bound to the CRE (36Doi J. Takemori H. Lin X.-z. Horike N. Katoh Y. Okamoto M. J. Biol. Chem. 2002; 277: 15629-15637Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). The suppression of ACTH-induced transcription of the StARgene in SIK-overexpressing cells was also noted, but the time course of its manifestation seemed different from that of the CYP11Agene. Thus, 2 h after the addition of ACTH, the level of StAR mRNA in the SIK-overexpressing cells was elevated to a similar level as that in the control cells, but the level was markedly suppressed after 12 h (35Lin X. Takemori H. Katoh Y. Doi J. Horike N. Makino A. Nonaka Y. Okamoto M. Mol. Endocrinol. 2001; 15: 1264-1276Crossref PubMed Scopus (51) Google Scholar). This may imply that the time course ofStAR gene expression during ACTH activation might be divided into two consecutive phases; the first in which SIK was not capable of exerting a repressive effect on the StAR gene, and the second in which SIK exerted repressive activity. During the course of this study to explore the mechanism underlying SIK-mediated steroidogenic gene regulation, we noticed that SIK changed its subcellular location during ACTH stimulation. Before stimulation it was present both in the nuclear and cytoplasmic compartments; however, within 5 min after ACTH treatment, the nuclear SIK moved into the cytoplasmic compartment. The level of SIK in the nuclei was not recovered until 6 h post-ACTH treatment. The nuclear export of SIK occurred concomitantly with PKA-dependent phosphorylation at Ser-577 of SIK. When the phosphorylation was inhibited, SIK was retained in the nuclei. During SIK's absence from the nuclear compartment the SIK-mediated repression of CRE-reporter activity was not obvious. Experiments conducted on the human StAR gene promoter suggested that SIK repressed the StAR promoter via CREs coupled with a cAMP-responsive SF-1 site. The two consecutive phases found in the time course of StAR gene expression in SIK-overexpressing Y1 cells could be explained by SIK intracellular translocation during ACTH stimulation. StAR promoter reporter plasmids, pGL2-hStAR (37Sugawara T. Holt J.A. Kiriakidou M. Strauss 3rd., J.F. Biochemistry. 1996; 35: 9052-9059Crossref PubMed Scopus (236) Google Scholar) and pEBG vector were generous gifts from Dr. T. Sugawara at Hokkaido University School of Medicine, Sapporo, Japan and Dr. Lee A. Witters at Dartmouth Medical School, Hanover, NH, respectively. Kin-7 (38Wong M. Krolczyk A.J. Schimmer B.P. Mol. Endocrinol. 1992; 6: 1614-1624PubMed Google Scholar) and Y1 cells were generously donated by Dr. B. P. Schimmer at the University of Toronto, Canada and Dr. Ken-ichirou Morohashi at the National Institute for Basic Biology, Okazaki, Japan, respectively. Plasmids described below were obtained from commercial sources; pEGFP-N1, pIRES1neo, pTAL, and pTAL-CRE from Clontech (Palo Alto, CA), pM and FR-Luc from Stratagene (La Jolla, CA), pGL3 and pRL-SV40 from Promega (Madison, WI), pGEX-6P3 from Amersham Biosciences. pM-CREB(F), pM-CREB(F)(L311A/L318A), pTAL-5XGAL-4, pIRES-PKA, and pIRES(HA)-SIK(F) were described in Refs. 35Lin X. Takemori H. Katoh Y. Doi J. Horike N. Makino A. Nonaka Y. Okamoto M. Mol. Endocrinol. 2001; 15: 1264-1276Crossref PubMed Scopus (51) Google Scholar and 36Doi J. Takemori H. Lin X.-z. Horike N. Katoh Y. Okamoto M. J. Biol. Chem. 2002; 277: 15629-15637Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar. The following reagents were obtained from commercial sources: 8-bromo-cyclic AMP (8-Br-cAMP), fetal calf serum, dithiothreitol, leptomycin B (LMB), and phenylmethylsulfonyl fluoride from Sigma, LipofectAMINE 2000 and trypsin-EDTA from Invitrogen (Carlsbad, CA) and ACTH (Cortrosyn) from Daiichi Seiyaku Co. (Tokyo, Japan). DNA fragments containing 150 and 84 bp of the human StARpromoter were prepared from pGL2 by digesting withKpnI/HindIII and ligating into theKpnI/HindIII site of pGL3. A StARpromoter fragment (−2.0 to −1.3 kbp) was amplified by PCR using the −2.0F primer (5′-AAAGGTACCGTGGTGGCAGGACACAGAACT) and the −1.3R primer (5′-GGGGTCTTGGTATGTGCAGAA) (the sequences from GenBankTMaccession no. AP000065), digested withKpnI/HindIII and ligated into theKpnI/HindIII site of pGL3. The DNA fragment of 1.3 kbp upstream of the transcriptional start site was prepared from pGL2 by HindIII digestion and introduced into theHindIII site of pGL3 reporter with the −2.0 to −1.3-kbp fragment. To prepare a −1.8-kbp StAR promoter construct, a −2.0 to −1.8-kbp fragment was removed from the −2.0-kbpStAR promoter construct by KpnI/AatI digestion. The mutant StAR promoter (−150 bp) with a non-functional SF-1/CRE site at −95 to −85 bp was created by site-directed mutagenesis with a mutagenic primer (5′-GAGGCAATCGCTCTATCTAGAACCCCTTCCTTTGC) using a site-directed mutagenesis kit, GeneEditor (Promega). To prepare the expression vectors for GFP-SIK fusion proteins (GFPs fused to the NH2 termini of SIKs), pEGFP-C plasmid was constructed as follows. First, pEGFP-N1 plasmid was digested withBglII/BamHI (in the multicloning site) and self-ligated, and the resultant EcoRI and BamHI sites were eliminated. Second, oligonucleotides (5′-GTACGGATCCCTGCGGCCGCTGAATTCTAA and 5′-GGCCTTAGAATTCAGCGGCCGCAGGGATCC) were annealed and ligated into theBsrGI/NotI site of the above vector, and thus a new BamHI-NotI-EcoRI site with a stop codon in the 3′-end of the EGFP-coding region was created. cDNA fragments of full-length SIK and its mutants were cloned into theBamHI/EcoRI site of the pEGFP-C plasmid. Mutant SIK cDNAs were created by site-directed mutagenesis using a template, pT7-SIK (35Lin X. Takemori H. Katoh Y. Doi J. Horike N. Makino A. Nonaka Y. Okamoto M. Mol. Endocrinol. 2001; 15: 1264-1276Crossref PubMed Scopus (51) Google Scholar). Oligonucleotides used for preparing the mutants were as follows: (T268A, 5′-CCCGCCAAGCGCATCGCCATTGCCCAGATCCGC; T478A, 5′-GCACTGGCCGGAGGCATGCACTGGCTGAAGTTTCCACC; S577A, 5′-GGAGGGACGGAGAGCGGCGGATACGTCTCTCACTCAAGG; R574A, 5′- GTCAGCTTCCAGGAGGGAGCGAGAGCGTCGGATACGTCTCTCACTC; R575A, 5′- GTCAGCTTCCAGGAGGGACGGGCAGCGTCGGATACGTCTCTCACTC; RR574/575AA, 5′- GTCAGCTTCCAGGAGGGAGCGGCAGCGTCGGATACGTCTCTCACTC). An overexpression vector for hemagglutinin (HA)-tagged SIK protein was prepared by modification of the pSVL vector (Amersham Biosciences). Oligonucleotides corresponding to a coding sequence of the HA tag linked to BamHI-EcoRI sites (5′- TCGAATGGCTTACCCATACGACGTCCCAGACTACGCGGGATCCCTCGAGGAATTC and 5′- GATCGAATTCCTCGAGGGATCCCGCGTAGTGTGGGACGTCGTATGGGTAAGCCTA) were ligated into the XhoI/BamHI site of pSVL, and the resultant plasmid was named pSVL(HA). SIK cDNAs were inserted into the BamHI-EcoRI site of pSVL(HA). Plasmids for expression of glutathione S-transferase (GST) fusion SIK peptide (573–581 amino acid residues), and its mutant peptides were prepared by introducing oligonucleotides into theBamHI/EcoRI site of pGEX-6P3. The nucleotide sequences of oligonucleotides were: wild type, 5′-GATCCGGTCGTCGTGCGTCGGATACGTCTCTCG and 5′-AATTCGAGAGACGTATCCGACGCACGACGACCG; S577A, 5′- GATCCGGTCGTCGTGCGGCGGATACGTCTCTCG and 5′- AATTCGAGAGACGTATCCGCCGCACGACGACCG; R574A, 5′- GATCCGGTCGTCGTGCGTCGGATACGTCTCTCG and 5′- AATTCGAGAGACGTATCCGACGCACGCGCACCG; R575A, 5′- GATCCGGTCGTGCGGCGTCGGATACGTCTCTCG and 5′- AATTCGAGAGACGTATCCGACGCCGCACGACCG; RR574/575AA, 5′- GATCCGGTGCGGCAGCGTCGGATACGTCTCTCG and 5′- AATTCGAGAGACGTATCCGACGCT- GCCGCACCG. To construct mammalian expression vectors (pEBG-SIK peptides) of GST-fused SIK peptides, the DNA fragments encoding the SIK peptides were prepared from the Escherichia coli GST expression vector, pGEX-6P3, by BamHI/NotI digestion followed by ligation into the BamHI/NotI of pEBG. To create CREB-bZIP expression vector, a cDNA fragment encoding the CREB bZIP domain, similar to an inhibitory CRE modulator (CREM) isoform ICRE, was amplified by RT-PCR using primers (5′-GGGAATTCATGGCTTCCTCCCCAGCACT and 5′-GGGATCCATTTTCCACCTTAACAGGTGA) and pM-CREB(F) plasmid as a template, and it was digested withEcoRI/BamHI and ligated into theEcoRI/BamHI of pIRES1neo vector. Y1 and COS-7 cells were maintained in Dulbecco's Modified Eagle's medium (Sigma) containing 10% fetal calf serum and antibiotics at 37 C under an atmosphere of 5% CO2, 95% air. The method of reporter assays was described previously (35Lin X. Takemori H. Katoh Y. Doi J. Horike N. Makino A. Nonaka Y. Okamoto M. Mol. Endocrinol. 2001; 15: 1264-1276Crossref PubMed Scopus (51) Google Scholar). To introduce DNAs into cells, LipofectAMINE 2000 was used in this study. For fluorescent microscopical observation, cells were cultured on poly-l-lysine coated coverslips (18-mm) (Matsunami Co. LTD, Tokyo, Japan) using a 12-well dish. Cells were fixed with 1 ml of 4% paraformaldehyde dissolved in PBS and washed with PBS three times. For immunostaining, cells were incubated with 1 ml of 1% bovine serum albumin in PBS for 30 min at room temperature and then reacted with anti-SIK antibody (1:1000 dilution) (35Lin X. Takemori H. Katoh Y. Doi J. Horike N. Makino A. Nonaka Y. Okamoto M. Mol. Endocrinol. 2001; 15: 1264-1276Crossref PubMed Scopus (51) Google Scholar) for 1 h at 4 C. After the cells were washed with PBS four times, the antigen-antibody complexes were reacted with anti-rabbit IgG-Cy2 conjugate IgG (1:300 dilution) (Amersham Biosciences) for 1 h at 4 C. Cells on the coverslip were embedded onto a slide glass using 50% glycerol. These analytical methods were described previously (35Lin X. Takemori H. Katoh Y. Doi J. Horike N. Makino A. Nonaka Y. Okamoto M. Mol. Endocrinol. 2001; 15: 1264-1276Crossref PubMed Scopus (51) Google Scholar). Lysis buffer (50 mm Tris-HCl (pH 8.0), 300 mm NaCl, 5 mm EDTA, 5 mm EGTA, 2 mm dithiothreitol, 50 mm β-glycerol phosphate, 50 mm NaF, 1 mm NaVO4, 0.5% Triton X-100, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml leupeptin, and 14 μg/ml aprotinin) and 3× SDS sample buffer (150 mm Tris-HCl (pH 6.8), 6% SDS, 30% glycerol, and 0.1% bromphenol blue) were used in this study. The expression plasmids for GST-SIK peptide (pGEX-6P3-SIK (573–581)) and its mutant peptides were transformed into bacterial strain BL21 (codon plus) (Stratagene). The resultant transformants were grown in 300 ml of Terrific Broth (Sigma) containing 8% glycerol and 50 mm potassium phosphate (pH 7.4) at 28 °C. When the optical density at 600 nm of the culture solution reached 1.0, recombinant proteins were induced by the addition of 0.2 mm iso-1-thio-β-d-galactoside. The bacteria were harvested by centrifugation 3 h after the induction, and the cell pellet was suspended in 50 ml of sonication buffer (50 mm Tris-HCl (pH 8.0), 150 mm NaCl, 1 mm EDTA, 1 mm dithiothreitol, 10% glycerol, and 1 mm phenylmethylsulfonyl fluoride). The cells were broken by sonication, and the resultant cell suspension was mixed with Triton X-100 (final 1%), incubated at 4 C for 30 min, and subjected to centrifugation at 100,000 × g for 45 min. The GST-SIK peptides were recovered in the supernatant. For purification of the peptides, glutathione-Sepharose and HiTrap Q column chromatography (Amersham Biosciences) were performed as described in Ref. 35Lin X. Takemori H. Katoh Y. Doi J. Horike N. Makino A. Nonaka Y. Okamoto M. Mol. Endocrinol. 2001; 15: 1264-1276Crossref PubMed Scopus (51) Google Scholar. The procedure for in vivo kinase assay was described in Ref. 36Doi J. Takemori H. Lin X.-z. Horike N. Katoh Y. Okamoto M. J. Biol. Chem. 2002; 277: 15629-15637Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar. To purify GST-SIK peptide, a glutathione column (MicroSpinTM GST Purification Module,Amersham Biosciences) was used. The catalytic subunit of PKA from bovine heart was purchased from Sigma. PKA (0.5 units) was mixed with 0.5 μCi (18.5 kBq) of [γ-32P]ATP and substrates (5 μg of GST or GST-SIK peptides) in 20 μl of PKA-reaction buffer (50 mm Tris-HCl (pH 7.4), 1 mm dithiothreitol, and 5 mm MgCl2). Reactions were performed at 30 °C for 10 min and stopped by the addition of 10 μl of 3× SDS sample buffer. The reaction mixture was boiled for 5 min, and proteins in 10-μl aliquots were subjected to SDS-PAGE in a 15% gel. The gel was dried and exposed to an x-ray film at room temperature for 10 min. To examine the kinase activity of immunopurified HA-tagged SIK, 30 μl of the samples were mixed with 10 μl of 4× SIK-reaction buffer (200 mm Tris-HCl (pH 7.4), 4 mm dithiothreitol, and 40 mm MnCl2) containing 20 μg of GST-Syntide2 and 1.0 μCi (37 kBq) [γ-32P]ATP, and the mixture was incubated at 30 °C for 1 h. After the addition of 20 μl of 3× SDS sample buffer, the reaction mixture was heated at 100 °C for 5 min, and an aliquot (10 μl) was subjected to SDS-PAGE (15%) followed by autoradiography as described above. Phospho-SIK peptides (CQEGRRApSDTSLT, the 571–582-residue peptide with an extra Cys at the NH2terminus: pS indicates phosphoserine), conjugated with keyhole limpet hemocyanin (KLH) or biotin utilizing the NH2-terminal Cys, were obtained from Sigma Genosys Co. LTD. 0.4 mg of KLH-phospho-SIK peptide was emulsified with one volume of TiterMax Gold (TiterMax USA Inc., Norcross, GA) and used to immunize Japanese white rabbits (females, 2.0 kg-body-weight). To purify the specific immunoglobulin G (IgG), 0.5 mg of biotin-linked phospho-SIK peptide was loaded onto a 1-ml streptavidin column (HiTrap-streptoavidine, Amersham Biosciences), and the column was washed with 10 ml of PBS containing 1 m NaCl and then equilibrated with 5 ml of PBS. The antiserum (5 ml) was diluted with 5 ml of PBS, filtered with a disk filter (0.45 μm), and applied onto the phospho-SIK peptide column. The column was washed with 5 ml of PBS, 5 ml of PBS containing 1 m NaCl, and the antiphospho-Ser-577 (anti-pS577) IgG was eluted with 5 ml of 150 mm glycine-HCl (pH 2.5). Almost 80% of IgG was eluted in the first 1-ml fraction; this fraction neutralized with 0.15 ml of 1m Tris-HCl (pH 9.5). To detect SIK protein or peptide with pS577, the samples were subjected to SDS-PAGE (10 or 15% gel, respectively) and immunoblotted onto polyvinylidene difluoride membranes, as described in Ref. 35Lin X. Takemori H. Katoh Y. Doi J. Horike N. Makino A. Nonaka Y. Okamoto M. Mol. Endocrinol. 2001; 15: 1264-1276Crossref PubMed Scopus (51) Google Scholar. The membrane was first incubated with 1% bovine serum albumin for 30 min, and then incubated with the anti-pS577 antibody (diluted at 1:1000 with 4 ml of PBS) for 1 h. The antigen-antibody complexes on the membranes were reacted with goat anti-rabbit IgG-horseradish peroxidase conjugate (Cappel, Durham, NC). The peroxidase conjugate was visualized with a Konica immunostaining kit (Konica, Tokyo, Japan). By using an anti-SIK antibody we examined the subcellular location of SIK in resting and ACTH-stimulated Y1 cells. In the resting cells a weak signal for the presence of SIK (stained green) was found in both the nuclear and cytoplasmic compartments (Fig.1 A). After ACTH treatment the cells looked circular and had an intense signal only in the cytoplasmic compartment. No significant staining occurred with preimmune serum (data not shown). Because ACTH enhanced the biosynthesis of SIK protein in Y1 cells (35Lin X. Takemori H. Katoh Y. Doi J. Horike N. Makino A. Nonaka Y. Okamoto M. Mol. Endocrinol. 2001; 15: 1264-1276Crossref PubMed Scopus (51) Google Scholar), the immunochemically stained signal after the stimulation must have resulted from the sum total of the SIK present before ACTH treatment and that newly synthesized in the cytoplasm after the treatment. Therefore, when the intracellular translocation of SIK is considered, the immunocytochemical approach may cause difficulty in the interpretation of the results. To overcome this difficulty, GFP-tagged SIK protein was expressed in Y1 cells, and the subcellular translocation of green fluorescence signal was followed after the addition of ACTH. As shown in Fig. 1 B, the fluorescence signal was present in both the nuclear and cytoplasmic compartments of resting cells. The nuclear signal formed speckles, the size of respective speckle appearing to be negatively correlated with the number of speckles in a nucleus (data not shown). When the cells were treated with ACTH, the green fluorescence signal seemed to move out of the nuclei and was diffusely distributed in the cytoplasm. When the cells were pretreated with LMB, an inhibitor of CRM1-dependent nuclear export (39Fukuda M. Asano S. Nakamura T. Adachi M. Yoshida M. Yanagida M. Nishida E. Nature. 1997; 390: 308-311Crossref PubMed Scopus (1015) Google Scholar, 40Fornerod M. Ohno M. Yoshida M. Mattaj I.W. Cell. 1997; 90: 1051-1060Abstract Full Text Full Text PDF PubMed Scopus (1724) Google Scholar, 41Ossareh-Nazari B. Bachelerie F. Dargemont C. Science. 1997; 278: 141-144Crossref PubMed Scopus (619) Google Scholar), the fluorescence signal in the resting cell seemed to be more concentrated in the nucleus, and this localization did not change after ACTH treatment (Fig. 1 C). When GFP tag alone was introduced into Y1 cells, the fluorescence signal did not localize at any specific subcellular area, and its distribution did not change after the ACTH addition (data not shown). To answer whether the cAMP/PKA signaling was involved in the intracellular redistribution of SIK, Y1 cells and PKA-less mutant Y1, Kin-7, cells (38Wong M. Krolczyk A.J. Schimmer B.P. Mol. Endocrinol. 1992; 6: 1614-1624PubMed Google Scholar) were treated with 8-Br-cAMP (Fig. 1 D). cAMP-stimulated the nuclear export of GFP-SIK in Y1, but not in Kin-7, cells. Moreover, in PKA-overexpressing Kin-7 cells GFP-SIK was exclusively present in the cytoplasm. These results indicated that ACTH induced the nuclear export of SIK through the activation of cAMP/PKA signaling. There are three consensus PKA-dependent phosphorylation motifs (R/K)(R/K)X(S/T) in SIK protein;" @default.
• W2027838253 created "2016-06-24" @default.
• W2027838253 creator A5031128573 @default.
• W2027838253 creator A5044706467 @default.
• W2027838253 creator A5072363463 @default.
• W2027838253 creator A5082185893 @default.
• W2027838253 creator A5087774085 @default.
• W2027838253 date "2002-11-01" @default.
• W2027838253 modified "2023-10-16" @default.
• W2027838253 title "ACTH-induced Nucleocytoplasmic Translocation of Salt-inducible Kinase" @default.
• W2027838253 cites W1490741899 @default.
• W2027838253 cites W1493181842 @default.
• W2027838253 cites W1562998360 @default.
• W2027838253 cites W1572525448 @default.
• W2027838253 cites W1599163395 @default.
• W2027838253 cites W1608322029 @default.
• W2027838253 cites W1610204701 @default.
• W2027838253 cites W1890970634 @default.
• W2027838253 cites W1966720607 @default.
• W2027838253 cites W1967838762 @default.
• W2027838253 cites W1967889267 @default.
• W2027838253 cites W1988495226 @default.
• W2027838253 cites W1989553571 @default.
• W2027838253 cites W1989819921 @default.
• W2027838253 cites W1995629401 @default.
• W2027838253 cites W2001293789 @default.
• W2027838253 cites W2003432885 @default.
• W2027838253 cites W2004913119 @default.
• W2027838253 cites W2005930762 @default.
• W2027838253 cites W2008922773 @default.
• W2027838253 cites W2010885000 @default.
• W2027838253 cites W2015170595 @default.
• W2027838253 cites W2019771407 @default.
• W2027838253 cites W2027832548 @default.
• W2027838253 cites W2027981450 @default.
• W2027838253 cites W2029952484 @default.
• W2027838253 cites W2031091378 @default.
• W2027838253 cites W2033722975 @default.
• W2027838253 cites W2036495761 @default.
• W2027838253 cites W2037411672 @default.
• W2027838253 cites W2037448519 @default.
• W2027838253 cites W2038256325 @default.
• W2027838253 cites W2038435132 @default.
• W2027838253 cites W2048168473 @default.
• W2027838253 cites W2048796957 @default.
• W2027838253 cites W2050144502 @default.
• W2027838253 cites W2053497150 @default.
• W2027838253 cites W2059514154 @default.
• W2027838253 cites W2059692874 @default.
• W2027838253 cites W2061933315 @default.
• W2027838253 cites W2067099248 @default.
• W2027838253 cites W2071565757 @default.
• W2027838253 cites W2075107566 @default.
• W2027838253 cites W2075496544 @default.
• W2027838253 cites W2076314401 @default.
• W2027838253 cites W2076500432 @default.
• W2027838253 cites W2076614498 @default.
• W2027838253 cites W2081500836 @default.
• W2027838253 cites W2081687544 @default.
• W2027838253 cites W2085832732 @default.
• W2027838253 cites W2089106590 @default.
• W2027838253 cites W2089269914 @default.
• W2027838253 cites W2091181490 @default.
• W2027838253 cites W2096576561 @default.
• W2027838253 cites W2104512123 @default.
• W2027838253 cites W2105592350 @default.
• W2027838253 cites W2114257218 @default.
• W2027838253 cites W2137035181 @default.
• W2027838253 cites W2139334062 @default.
• W2027838253 cites W2158912211 @default.
• W2027838253 cites W2169720510 @default.
• W2027838253 cites W2171258458 @default.
• W2027838253 cites W2171347864 @default.
• W2027838253 doi "https://doi.org/10.1074/jbc.m204602200" @default.
• W2027838253 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12200423" @default.
• W2027838253 hasPublicationYear "2002" @default.
• W2027838253 type Work @default.
• W2027838253 sameAs 2027838253 @default.
• W2027838253 citedByCount "77" @default.
• W2027838253 countsByYear W20278382532012 @default.
• W2027838253 countsByYear W20278382532013 @default.
• W2027838253 countsByYear W20278382532014 @default.
• W2027838253 countsByYear W20278382532015 @default.
• W2027838253 countsByYear W20278382532016 @default.
• W2027838253 countsByYear W20278382532017 @default.
• W2027838253 countsByYear W20278382532018 @default.
• W2027838253 countsByYear W20278382532019 @default.
• W2027838253 countsByYear W20278382532020 @default.
• W2027838253 countsByYear W20278382532021 @default.
• W2027838253 countsByYear W20278382532022 @default.
• W2027838253 countsByYear W20278382532023 @default.
• W2027838253 crossrefType "journal-article" @default.
• W2027838253 hasAuthorship W2027838253A5031128573 @default.
• W2027838253 hasAuthorship W2027838253A5044706467 @default.
• W2027838253 hasAuthorship W2027838253A5072363463 @default.
• W2027838253 hasAuthorship W2027838253A5082185893 @default.
• W2027838253 hasAuthorship W2027838253A5087774085 @default.
• W2027838253 hasBestOaLocation W20278382531 @default.

• next