FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2028279692> ?p ?o ?g. }

• W2028279692 endingPage "11680" @default.
• W2028279692 startingPage "11667" @default.
• W2028279692 abstract "In vertebrates, stathmins form a family of proteins possessing two tubulin binding repeats (TBRs), which each binds one soluble tubulin heterodimer. The stathmins thus sequester two tubulins in a phosphorylation-dependent manner, providing a link between signal transduction and microtubule dynamics. In Drosophila, we show here that a single stathmin gene (stai) encodes a family of D-stathmin proteins. Two of the D-stathmins are maternally deposited and then restricted to germ cells, and the other two are detected in the nervous system during embryo development. Like in vertebrates, the nervous system-enriched stathmins contain an N-terminal domain involved in subcellular targeting. All the D-stathmins possess a domain containing three or four predicted TBRs, and we demonstrate here, using complementary biochemical and biophysical methods, that all four predicted TBR domains actually bind tubulin. D-stathmins can indeed bind up to four tubulins, the resulting complex being directly visualized by electron microscopy. Phylogenetic analysis shows that the presence of regulated multiple tubulin sites is a conserved characteristic of stathmins in invertebrates and allows us to predict key residues in stathmin for the binding of tubulin. Altogether, our results reveal that the single Drosophila stathmin gene codes for a stathmin family similar to the multigene vertebrate one, but with particular tubulin binding properties. In vertebrates, stathmins form a family of proteins possessing two tubulin binding repeats (TBRs), which each binds one soluble tubulin heterodimer. The stathmins thus sequester two tubulins in a phosphorylation-dependent manner, providing a link between signal transduction and microtubule dynamics. In Drosophila, we show here that a single stathmin gene (stai) encodes a family of D-stathmin proteins. Two of the D-stathmins are maternally deposited and then restricted to germ cells, and the other two are detected in the nervous system during embryo development. Like in vertebrates, the nervous system-enriched stathmins contain an N-terminal domain involved in subcellular targeting. All the D-stathmins possess a domain containing three or four predicted TBRs, and we demonstrate here, using complementary biochemical and biophysical methods, that all four predicted TBR domains actually bind tubulin. D-stathmins can indeed bind up to four tubulins, the resulting complex being directly visualized by electron microscopy. Phylogenetic analysis shows that the presence of regulated multiple tubulin sites is a conserved characteristic of stathmins in invertebrates and allows us to predict key residues in stathmin for the binding of tubulin. Altogether, our results reveal that the single Drosophila stathmin gene codes for a stathmin family similar to the multigene vertebrate one, but with particular tubulin binding properties. In vertebrates, stathmin is the generic element of a family of microtubule-regulating proteins comprising stathmin, SCG10, SCLIP, and RB3/RB3′/RB3″ coded by four different genes (stmn 1–4) (1Maucuer A. Moreau J. Méchali M. Sobel A. J. Biol. Chem. 1993; 268: 16420-16429Abstract Full Text PDF PubMed Google Scholar, 2Stein R. Orit S. Anderson D.J. Dev. Biol. 1988; 127: 316-325Crossref PubMed Scopus (109) Google Scholar, 3Ozon S. Byk T. Sobel A. J. Neurochem. 1998; 70: 2386-2396Crossref PubMed Scopus (79) Google Scholar, 4Ozon S. Maucuer A. Sobel A. Eur. J. Biochem. 1997; 248: 794-806Crossref PubMed Scopus (98) Google Scholar). Stathmin is a ubiquitous cytosolic phosphoprotein highly expressed in early embryos, gonads, and in the nervous system (5Amat J.A. Fields K.L. Schubart U.K. Brain Res. Dev. Brain Res. 1991; 60: 205-218Crossref PubMed Scopus (47) Google Scholar, 6Koppel J. Boutterin M.C. Doye V. Peyro-Saint-Paul H. Sobel A. J. Biol. Chem. 1990; 265: 3703-3707Abstract Full Text PDF PubMed Google Scholar, 7Doye V. Kellermann O. Buc-Caron M.H. Sobel A. Differentiation. 1992; 50: 89-96Crossref PubMed Scopus (40) Google Scholar, 8Schubart U.K. Xu J. Fan W. Cheng G. Goldstein H. Alpini G. Shafritz D.A. Amat J.A. Farooq M. Norton W.T. et al.Differentiation. 1992; 51: 21-32Crossref PubMed Scopus (45) Google Scholar, 9Guillaume E. Evrard B. Com E. Moertz E. Jégou B. Pineau C. Mol. Reprod. Dev. 2001; 60: 439-445Crossref PubMed Scopus (40) Google Scholar, 10Koppel J. Rehák P. Baran V. Veselá J. Hlinka D. Manceau V. Sobel A. Mol. Reprod. Dev. 1999; 53: 306-317Crossref PubMed Scopus (9) Google Scholar). Stathmin-related proteins are enriched in the brain (11Wuenschell C.W. Mori N. Anderson D.J. Neuron. 1990; 4: 595-602Abstract Full Text PDF PubMed Scopus (83) Google Scholar, 12Ozon S. El Mestikawy S. Sobel A. J. Neurosci. Res. 1999; 56: 553-564Crossref PubMed Scopus (43) Google Scholar) and targeted to vesicular and Golgi membranes via an N-terminal extension containing two close palmitoylated cysteines (13Stein R. Mori N. Matthews K. Lo L.C. Anderson D.J. Neuron. 1988; 1: 463-476Abstract Full Text PDF PubMed Scopus (198) Google Scholar, 14Di Paolo G. Lutjens R. Pellier V. Stimpson S.A. Beuchat M.H. Catsicas S. Grenningloh G. J. Biol. Chem. 1997; 272: 5175-5182Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 15Lutjens R. Igarashi M. Pellier V. Blasey H. Di Paolo G. Ruchti E. Pfulg C. Staple J.K. Catsicas S. Grenningloh G. Eur. J. Neurosci. 2000; 12: 2224-2234Crossref PubMed Scopus (66) Google Scholar, 16Maekawa S. Morii H. Kumanogoh H. Sano M. Naruse Y. Sokawa Y. Mori N. J. Biochem. 2001; 129: 691-697Crossref PubMed Scopus (26) Google Scholar, 17Charbaut E. Chauvin S. Enslen H. Zamaroczy S. Sobel A. J. Cell Sci. 2005; 118: 2313-2323Crossref PubMed Scopus (26) Google Scholar, 18Gavet O. El Messari S. Ozon S. Sobel A. J. Neurosci. Res. 2002; 68: 535-550Crossref PubMed Scopus (51) Google Scholar, 19Chauvin S. Poulain F.E. Ozon S. Sobel A. Biol. Cell. 2008; 100: 577-589Crossref PubMed Scopus (18) Google Scholar). Stathmin proteins are involved in the control of cell proliferation (20Melhem R.F. Strahler J.R. Hailat N. Zhu X.X. Hanash S.M. Biochem. Biophys. Res. Commun. 1991; 179: 1649-1655Crossref PubMed Scopus (59) Google Scholar, 21Rubin C.I. Atweh G.F. J. Cell. Biochem. 2004; 93: 242-250Crossref PubMed Scopus (309) Google Scholar), differentiation (10Koppel J. Rehák P. Baran V. Veselá J. Hlinka D. Manceau V. Sobel A. Mol. Reprod. Dev. 1999; 53: 306-317Crossref PubMed Scopus (9) Google Scholar, 22Balogh A. Mège R.M. Sobel A. Exp. Cell Res. 1996; 224: 8-15Crossref PubMed Scopus (33) Google Scholar, 23Ohkawa N. Fujitani K. Tokunaga E. Furuya S. Inokuchi K. J. Cell Sci. 2007; 120: 1447-1456Crossref PubMed Scopus (75) Google Scholar), and migration (24Baldassarre G. Belletti B. Nicoloso M.S. Schiappacassi M. Vecchione A. Spessotto P. Morrione A. Canzonieri V. Colombatti A. Cancer Cell. 2005; 7: 51-63Abstract Full Text Full Text PDF PubMed Scopus (242) Google Scholar, 25Giampietro C. Luzzati F. Gambarotta G. Giacobini P. Boda E. Fasolo A. Perroteau I. Endocrinology. 2005; 146: 1825-1834Crossref PubMed Scopus (32) Google Scholar). Cellular RNA interference knock-down experiments also revealed that SCG10 and SCLIP play essential roles in neuronal morphogenesis and, as predicted on the basis of the existence of different genes, that these roles are at least partially distinct (26Poulain F.E. Chauvin S. Wehrlé R. Desclaux M. Mallet J. Vodjdani G. Dusart I. Sobel A. J. Neurosci. 2008; 28: 7387-7398Crossref PubMed Scopus (34) Google Scholar, 27Poulain F.E. Sobel A. Mol. Cell Neurosci. 2007; 34: 137-146Crossref PubMed Scopus (47) Google Scholar). In the stathmin knock-out mouse mild phenotypes were detected with a decreased innate fear response (28Shumyatsky G.P. Malleret G. Shin R.M. Takizawa S. Tully K. Tsvetkov E. Zakharenko S.S. Joseph J. Vronskaya S. Yin D. Schubart U.K. Kandel E.R. Bolshakov V.Y. Cell. 2005; 123: 697-709Abstract Full Text Full Text PDF PubMed Scopus (183) Google Scholar) and a minor axonopathy in aged animals (29Liedtke W. Leman E.E. Fyffe R.E. Raine C.S. Schubart U.K. Am J. Pathol. 2002; 160: 469-480Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar). Microtubules are key elements of the cytoskeleton involved in the cell cycle, cell shape, and intracellular organization and trafficking. They are composed of α/β-tubulin heterodimers, which are assembled or disassembled through phases of slow growth or rapid shrinkage separated by catastrophe and rescue events (30Mitchison T. Kirschner M. Nature. 1984; 312: 237-242Crossref PubMed Scopus (2310) Google Scholar). This “dynamic instability” of microtubules is controlled by a variety of proteins that include, beside stabilizing and destabilizing proteins binding to microtubules, proteins of the stathmin family (31Curmi P.A. Gavet O. Charbaut E. Ozon S. Lachkar-Colmerauer S. Manceau V. Siavoshian S. Maucuer A. Sobel A. Cell Struct. Funct. 1999; 24: 345-357Crossref PubMed Scopus (160) Google Scholar), which bind soluble tubulin. Stathmin forms a complex and hence sequesters or releases two soluble tubulin molecules (32Curmi P.A. Andersen S.S. Lachkar S. Gavet O. Karsenti E. Knossow M. Sobel A. J. Biol. Chem. 1997; 272: 25029-25036Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar, 33Gigant B. Curmi P.A. Martin-Barbey C. Charbaut E. Lachkar S. Lebeau L. Siavoshian S. Sobel A. Knossow M. Cell. 2000; 102: 809-816Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar, 34Honnappa S. Cutting B. Jahnke W. Seelig J. Steinmetz M.O. J. Biol. Chem. 2003; 278: 38926-38934Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 35Jourdain L. Curmi P. Sobel A. Pantaloni D. Carlier M.F. Biochemistry. 1997; 36: 10817-10821Crossref PubMed Scopus (213) Google Scholar, 36Ravelli R.B. Gigant B. Curmi P.A. Jourdain I. Lachkar S. Sobel A. Knossow M. Nature. 2004; 428: 198-202Crossref PubMed Scopus (1280) Google Scholar, 37Steinmetz M.O. Kammerer R.A. Jahnke W. Goldie K.N. Lustig A. van Oostrum J. EMBO J. 2000; 19: 572-580Crossref PubMed Scopus (87) Google Scholar), thus favoring microtubule depolymerization or polymerization in a phosphorylation-dependent manner (32Curmi P.A. Andersen S.S. Lachkar S. Gavet O. Karsenti E. Knossow M. Sobel A. J. Biol. Chem. 1997; 272: 25029-25036Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar, 38Amayed P. Pantaloni D. Carlier M.F. J. Biol. Chem. 2002; 277: 22718-22724Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 39Honnappa S. Jahnke W. Seelig J. Steinmetz M.O. J. Biol. Chem. 2006; 281: 16078-16083Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar, 40Larsson N. Segerman B. Howell B. Fridell K. Cassimeris L. Gullberg M. J. Cell Biol. 1999; 146: 1289-1302Crossref PubMed Scopus (60) Google Scholar). The nervous system-enriched stathmins also bind tubulin albeit with different kinetics and complex stabilities (41Charbaut E. Curmi P.A. Ozon S. Lachkar S. Redeker V. Sobel A. J. Biol. Chem. 2001; 276: 16146-16154Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 42Jourdain I. Lachkar S. Charbaut E. Gigant B. Knossow M. Sobel A. Curmi P.A. Biochem. J. 2004; 378: 877-888Crossref PubMed Google Scholar). It has been also proposed that stathmin may be involved in microtubule depolymerization independently of its sequestering activity by promoting directly microtubule catastrophe (43Manna T. Thrower D. Miller H.P. Curmi P. Wilson L. J. Biol. Chem. 2006; 281: 2071-2078Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 44Howell B. Larsson N. Gullberg M. Cassimeris L. Mol. Biol. Cell. 1999; 10: 105-118Crossref PubMed Scopus (158) Google Scholar, for review see Ref. 45Cassimeris L. Curr. Opin. Cell Biol. 2002; 14: 18-24Crossref PubMed Scopus (363) Google Scholar). To decipher the in vivo roles of stathmin proteins and their important features conserved through evolution, we previously identified a unique stathmin-related gene (stai) in Drosophila predicted to code for at least two transcripts (46Ozon S. Guichet A. Gavet O. Roth S. Sobel A. Mol. Biol. Cell. 2002; 13: 698-710Crossref PubMed Scopus (62) Google Scholar). The D-stathmin gene is expressed in germ cells and in the nervous system of the developing Drosophila embryos, and its role in tubulin sequestration is conserved. However the determinants of tubulin interaction in D-stathmin were not characterized, and its stoichiometry was not quantitatively analyzed. A striking physiological role of D-stathmins was revealed following RNA knockdown in Drosophila embryos, which resulted in germ cell migration defects as well as a major disorganization of nervous system development (46Ozon S. Guichet A. Gavet O. Roth S. Sobel A. Mol. Biol. Cell. 2002; 13: 698-710Crossref PubMed Scopus (62) Google Scholar). In the present study, we show that the single Drosophila stathmin gene codes for a family of four different D-stathmin proteins whose expression patterns are regulated during development. The stathmin gene is conserved in invertebrates and codes for isoforms with tubulin binding stoichiometries that are variable, higher than in vertebrates, and regulated by alternative splicing. Moreover, phylogenetic analysis allowed us to show the specificity of each tubulin binding region and predict key residues for the binding of tubulin. LD04103 clone (GenBankTM accession number) and clone 14 (46Ozon S. Guichet A. Gavet O. Roth S. Sobel A. Mol. Biol. Cell. 2002; 13: 698-710Crossref PubMed Scopus (62) Google Scholar) were used for the construction of D-stathmin B2 and A1, respectively. To obtain the D-stathmin B1 construction, clone LD04103 and clone 19 (46Ozon S. Guichet A. Gavet O. Roth S. Sobel A. Mol. Biol. Cell. 2002; 13: 698-710Crossref PubMed Scopus (62) Google Scholar) were digested by AflIII and BamHI and ligated together. The various D-stathmin derivatives used were: amino acids 55–196 of D-stathmin B2 (TBR 1-2-3/7), 3The abbreviations used are: TBRtubulin binding repeatdsRNAdouble-stranded RNABisTris2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diolSLDstathmin-like domain. and 1–142 (TBR 1-2), 1–204 (TBR 1-2-3/6), or 146–257 (TBR 3/6-4) of D-stathmin A1. For eukaryotic expression, in vitro transcription/translation, prokaryotic expression, and surface plasmon resonance experiments D-stathmin cDNAs were amplified by PCR and inserted into the pcDNA3-Myc vector (47Lawler S. Gavet O. Rich T. Sobel A. FEBS Lett. 1998; 421: 55-60Crossref PubMed Scopus (23) Google Scholar), the pSp64 vector (Promega, Madison, WI), pET-8c vector (Novagen, Madison, WI), or the pDW363-inducible expression vector (42Jourdain I. Lachkar S. Charbaut E. Gigant B. Knossow M. Sobel A. Curmi P.A. Biochem. J. 2004; 378: 877-888Crossref PubMed Google Scholar), respectively. All cDNA constructs were checked by sequencing (Genome express, Meylan, France). tubulin binding repeat double-stranded RNA 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol stathmin-like domain. 1 μg of pSp64 plasmid containing D-stathmin A1, B1, and B2 coding sequences was used for in vitro transcription and translation with the TnTTM Coupled Reticulocyte Lysate System (Promega). 5 μl of 25 μl of total transcription/translation mix were analyzed by gel electrophoresis and Western blot analysis. h-stathmin was purified as previously described (32Curmi P.A. Andersen S.S. Lachkar S. Gavet O. Karsenti E. Knossow M. Sobel A. J. Biol. Chem. 1997; 272: 25029-25036Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). The PET- 8C and the pDW363 cDNA clones were used to produce and purify the corresponding D-stathmin derivatives in the BL-21(DE3) Escherichia coli strain as described previously (42Jourdain I. Lachkar S. Charbaut E. Gigant B. Knossow M. Sobel A. Curmi P.A. Biochem. J. 2004; 378: 877-888Crossref PubMed Google Scholar). Drosophila tissues were homogenized in TRIzol reagent (Invitrogen). S2R+ RNA was prepared using the RNeasy Minikit (Qiagen, Courtaboeuf, France) according to the manufacturer's protocol. Northern blots were performed as described (46Ozon S. Guichet A. Gavet O. Roth S. Sobel A. Mol. Biol. Cell. 2002; 13: 698-710Crossref PubMed Scopus (62) Google Scholar). Multiprime-labeled fragments of PCR-amplified probes 1′-2′, 3-4-5, and 1-2 were added at 0.5 × 106 cpm/ml in the hybridization buffer, and hybridization was allowed to proceed overnight. The final wash was performed at 60 °C in 0.1× SSC, 0.1% SDS for 30 min. Reverse transcription-PCRs were performed on 1 μg of template RNA using 20 pmol of dT oligonucleotides, 1 h at 42 °C, with the ImProm-IITM reverse transcription system (Promega) followed by a PCR using appropriate oligonucleotides (1′, gagagctcgaggaaaccgtccgcgatataa; 7, ttgctaagctttgtgttggtgtattatgca; and 1, cattcgcttaattttcgccgacgacgcg). Templates for in vitro transcription were generated by PCR using the following pairs of oligonucleotides containing the sequence recognized by the T7 RNA polymerase: gagaattctaatacgactcactatagggagaaacacaatcaaaattgccgaaatcaaa and gagaattctaatacgactcactatagggagagagtttttgaactttttcaatttttttttgc, and gagaattctaatacgactcactatagggagaattgagcagaaacttaaggcggcc and gagaattctaatacgactcactatagggagacgtcttttcgatatcctgggcatg, to amplify exon 6 and exons 3-4-5, respectively. The corresponding double strand RNAs (dsRNAs) were then synthesized using the MEGAscript kit (Ambion, Inc., Austin, TX) according to the manufacturer's instructions. 37 nm of dsRNA was added to a 35-mm well culture plate containing 106 S2R+ cells in Schneider medium without serum, and the mixture was incubated at room temperature for 30 min after vigorous shaking. 2 ml of Schneider medium containing 10% serum was then added, and the cells were further grown for 3 or 7 days before analysis by Western blot. RNA in situ hybridization was performed as described before (48Tautz D. Pfeifle C. Chromosoma. 1989; 98: 81-85Crossref PubMed Scopus (2088) Google Scholar). Briefly, regions 1-2, 1′-2′, and 6 were PCR-amplified with 3′ oligonucleotides containing the sequence of the initiation of the T7 phage polymerase to directly synthesize digoxygenin-UTP-labeled RNA. Fixed embryos were hybridized with digoxygenin-UTP-labeled RNA overnight at 55 °C and then incubated with alkaline phosphatase-conjugated anti-digoxygenin antibodies. The signal was developed using the alkaline phosphatase reaction. For examination, embryos were mounted in Aqua-Polymount (Polysciences, Inc., Warrington, PA). One-dimensional gel electrophoresis was performed on 12% BisTris polyacrylamide gels (NuPAGE, Invitrogen). The gels were transferred to nitrocellulose in a semi-dry electroblotting apparatus and probed with diluted antiserum (anti-peptide COOH-terminal antiserum 98 (1:10,000), anti-D-stathmin-DC antiserum 97 (1:10,000), or anti-Myc monoclonal antibody (1:2,000, Dako, A/S, Denmark)). Bound antibodies were detected with appropriate secondary antibodies and the chemiluminescent ECL kit (Amersham Biosciences), or by fluorescence (Odyssey, Li-COR Biosciences, Bad Homburg, Germany). Human HeLa cells were grown as monolayers in Dulbecco's modified Eagle's medium containing 10% (v/v) fetal calf serum (Invitrogen) at 37 °C in 5% CO2. Transfections were performed using FuGENE (Roche Diagnostics, Basel, Switzerland) according to the manufacturer's instructions. Cells were fixed with phosphate-buffered saline plus 2% paraformaldehyde and 30 mm saccharose for 10 min at 37 °C. Primary antibodies (monoclonal anti-α-tubulin N356, 1:300, Amersham Biosciences; polyclonal anti-Myc sc-789, 1:100, Tebu, Le Perray en Yvelines, France) were revealed with appropriate Alexa 488, 546-conjugated anti-rabbit (1:300) and anti-mouse (1:300) secondary antibodies (Jackson ImmunoResearch). The cells were mounted with Mowiol solution and examined with a Provis Olympus fluorescence photomicroscope equipped with a Princeton Instruments camera. Tubulin was purified from calf brain as described before (32Curmi P.A. Andersen S.S. Lachkar S. Gavet O. Karsenti E. Knossow M. Sobel A. J. Biol. Chem. 1997; 272: 25029-25036Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). The effect of various D-stathmin variants or fragments on tubulin polymerization in polymerization buffer (50 mm 2-(N-morpholino)ethanesulfonic acid-KOH, pH 6.8, 30% glycerol, 0.5 mm EGTA, 6 mm MgCl2, and 0.5 mm GTP) was monitored turbidimetrically at 350 nm in an Ultrospec 3000 spectrophotometer (Amersham Biosciences) thermostatted at 37 °C as described before (41Charbaut E. Curmi P.A. Ozon S. Lachkar S. Redeker V. Sobel A. J. Biol. Chem. 2001; 276: 16146-16154Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). Tubulin alone and h-stathmin were used as controls, with the results for D-stathmins being normalized on the basis of a 2:1 tubulin:h-stathmin reference ratio. The interaction of the D-stathmin derivatives with tubulin was studied by size-exclusion chromatography on a Superose 12 HR 10/30 column pre-equilibrated with buffer AB (80 mm Pipes/KOH/1 mm EGTA/5 mm MgCl2, pH 6.8) containing 1 m trimethylamine-N-oxide at 0.5 ml/min. Monitoring at 278 nm allowed us to observe the tubulin peaks mainly, because D-stathmin derivatives do not significantly absorb light at this wavelength. The interaction was favored by the addition of 1 m trimethylamine-N-oxide to the sample and elution buffers as previously described (42Jourdain I. Lachkar S. Charbaut E. Gigant B. Knossow M. Sobel A. Curmi P.A. Biochem. J. 2004; 378: 877-888Crossref PubMed Google Scholar). BIAcore 2000 system, Sensorchip SA, and HBS buffer (0.01 m Hepes (pH 7.4)/0.15 m NaCl/3 mm EDTA/0.005% polyoxyethylenesorbitan) were from BIAcore AB (Uppsala, Sweden). The Sensorchip SA coated with streptavidin was preconditioned with three 10-μl injections of 50 mm NaOH, 1 m NaCl, and saturated with three 10-μl injections of 10 mg/ml bovine serum albumin. The first flow cell was used as a reference flow cell. The other three flow cells were coupled with the dialyzed S2 of the various D-stathmin derivatives that were specifically biotinylated on their NH2-terminal tag. To obtain surfaces with comparable molar densities, the amounts of the various proteins coupled were proportional to their molecular masses: ∼2000 resonance units of h-stathmin, 900 resonance units of TBR 1–2, and 370 resonance units of D-stathmin A1 were coupled at 10-μl/min in HBS buffer. Several runs of tubulin ranging from 0.5 to 10 μm were made at a constant flow rate of 30 μl/min, in buffer AB (80 mm Pipes/KOH/1 mm EGTA/5 mm MgCl2, pH 6.8) supplemented with 0.005% (v/v) P20 surfactant in the presence of 1 mm GDP. For the analysis, the reference flow cell sensorgram was subtracted from the corresponding sensorgrams. Samples for glycerol spraying/low angle rotary metal shadowing were prepared as described (34Honnappa S. Cutting B. Jahnke W. Seelig J. Steinmetz M.O. J. Biol. Chem. 2003; 278: 38926-38934Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 37Steinmetz M.O. Kammerer R.A. Jahnke W. Goldie K.N. Lustig A. van Oostrum J. EMBO J. 2000; 19: 572-580Crossref PubMed Scopus (87) Google Scholar). Briefly, 20 μl of protein samples (0.1–0.3 mg/ml) were mixed with glycerol to a final concentration of 30%, sprayed onto freshly cleaved mica at room temperature, and rotary shadowed in a BA 511M freeze-etch apparatus (Balzers) with platinum/carbon at an elevation angle of 3–5°. Electron micrographs were taken in a Philips Morgagni transmission electron microscope operated at 80 kV equipped with a Megaview III charge-coupled device camera. The electron micrographs were used to calculate the length of the tubulin complexes formed with various stathmin constructs. If t is the length of the uncoated αβ-tubulin heterodimer, and e is the thickness of the platinum coating, the length of a coated tubulin heterodimer is T = t + 2e, and that of a platinum-coated T2S complex is T2 = 2t + 2e. Hence t = T2 − T, and e = (T − t)/2. With T = 17.5 nm, T2 = 28 nm, we found t = 10.5 nm, and e = 3.5 nm. One can then deduce from the measurements of the curved lengths (L) of the coated tubulin complexes the length (l) of the corresponding naked complexes: l = L − 2e = L − 7 nm. To identify all stathmin sequences at the mRNA and genomic level, we ran the TBLASTN or BLASTN software on expressed sequence tag, non-redundant (nr), and genomic GenBankTM libraries using the D-stathmin A1, A2, B1, and B2 nucleotidic or amino acid sequences, as well as each individual exon as the query. In most vertebrates, the six identified tubulin binding stathmin family proteins, stathmin (stathmin 1, St 1) and the mostly or exclusively neural proteins SCG10 (stathmin 2, St 2), SCLIP (stathmin 3, St 3), RB3 and its splice variants RB3′ and RB3″ (stathmin 4a, St 4a; stathmin 4b, St 4b; and stathmin 4c, St 4c), are encoded by four conserved genes (stmn1–4) (Fig. 1A). In Drosophila, a single stathmin gene (stai) (Fig. 1B) has been identified that we partially characterized previously (46Ozon S. Guichet A. Gavet O. Roth S. Sobel A. Mol. Biol. Cell. 2002; 13: 698-710Crossref PubMed Scopus (62) Google Scholar). As deduced from expressed sequence tag sequences analysis, we now further identified exon 1′ between exons 2 and 2′, which corresponds to an alternate transcription initiation (Fig. 1C) (see below and under “Experimental Procedures”), and exon 6 that can be alternatively spliced out. For a systematic identification of all stai gene products, we performed reverse transcription-PCR using PCR primer couples targeting either exons 1 and 7 or 1′ and 7 (Fig. 2A). Altogether, four different D-stathmin mRNAs were identified which differ either by transcription initiation (exons 1-2 or 1′-2′) or by alternate splicing (of exons 1′-2′ and 6). D-stathmins A1 and A2 are corresponding to exons 1-2-3-4-5-6-7 and exons 1-2-3-4-5-7, and D-stathmin B1 and B2 to exons 1′-2′-3-4-5-6-7 and exons 1′-2′-3-4-5-7, respectively (Fig. 1C). The corresponding proteins share a stathmin-like domain (SLD) (41Charbaut E. Curmi P.A. Ozon S. Lachkar S. Redeker V. Sobel A. J. Biol. Chem. 2001; 276: 16146-16154Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 46Ozon S. Guichet A. Gavet O. Roth S. Sobel A. Mol. Biol. Cell. 2002; 13: 698-710Crossref PubMed Scopus (62) Google Scholar) with C-terminal extensions of various lengths depending on the inclusion or not of exon 6 (Figs. 1C and 5D). Exons 1′-2′ encode an N-terminal extension in D-stathmins B (Figs. 1C and 5A). Exon 1′ codes for a sequence with no significant identity with the N-terminal targeting domain A of vertebrate neural stathmins 2–4 (Fig. 1D) (18Gavet O. El Messari S. Ozon S. Sobel A. J. Neurosci. Res. 2002; 68: 535-550Crossref PubMed Scopus (51) Google Scholar, 41Charbaut E. Curmi P.A. Ozon S. Lachkar S. Redeker V. Sobel A. J. Biol. Chem. 2001; 276: 16146-16154Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar), but with three potential cysteine palmitoylation sites (C13, C15, and C18), which suggests that it may similarly be involved in subcellular targeting of D-stathmins B. Exon 2′ codes for a stretch rich in basic residues, in a way comparable to domain A″ of vertebrate stathmin 4c.FIGURE 5Comparison of the various TBRs. A, TBR sequence analysis. Sequence identities and homologies with any (black, identity; gray, similarity) or adjacent (asterisk, identity; period, similarity) internal 35-amino acid TBRs in h-stathmin, D-stathmin A1, and D-stathmin A2 protein sequences. Distances between repeats are indicated with brackets, in numbers of amino acids between corresponding residues. TBR1, TBR2, TBR3, and TBR4 are the four TBRs identified in D-stathmin A1 from the N to C termini of the protein sequence. Alternate TBR3s are referred to as TBR3/6 or TBR3/7 with their C-terminal end coded either by exon 6 or 7, respectively, depending of the splicing or not of exon 6 (see also in D). B, percentage of amino acid identity of the various TBRs. C, ClustalW2 alignment-derived tree of the various D-stathmin TBRs showing their specific identity as compared with each other. D, schematic representation of the various TBRs with their exon coverage in h- and D-stathmins. E: Top, logos graphical representation resulting from the alignment of 86 stathmin TBRs (1–5) from vertebrates and invertebrates using Meme prediction software. At each position, the size of each residue is proportional to its frequency in that position, and the total height of all residues in the position is proportional to the conservation (information content) of the position. Residues of the TBR 1 and 2 regions pointing toward tubulin in the tubulin-stathmin 4a complex determined by crystallography are indicated by stars. Bottom, consensus TBR sequence derived from the alignment. In each column the residue with the highest probability is classified from top to bottom. All residues shown have a probability of being present higher than 0.2. Thus, the most likely sequence of the motif can be read from the top line.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The in vitro translation products of D-stathmin clones A1, B1, and B2 migrated with higher apparent molecular masses than their calculated molecular masses, i.e. at 40, 51, and 38 kDa, respectively, at the same level as endogenous proteins from Drosophila S2R+ cells (expected low level detection of forms B1 and B2, as for their RNAs) (Fig. 2B). A 34-kDa stathmin-immunoreactive protein was also detected in S2R+ cells, which likely corresponds to D-stathmin A2. By RNA interference in S2R+ cells (Fig. 2C), the expression of D-stathmin A1 as well as of the 34-kDa A2 assigned protein was inhibited with the dsRNA directed against exons 3-4-5 but not with that directed against exon 6, which d" @default.
• W2028279692 created "2016-06-24" @default.
• W2028279692 creator A5000905507 @default.
• W2028279692 creator A5030072547 @default.
• W2028279692 creator A5041503324 @default.
• W2028279692 creator A5045267867 @default.
• W2028279692 creator A5056479549 @default.
• W2028279692 creator A5058818624 @default.
• W2028279692 creator A5075190925 @default.
• W2028279692 creator A5082028236 @default.
• W2028279692 date "2010-04-01" @default.
• W2028279692 modified "2023-10-13" @default.
• W2028279692 title "Drosophila Stathmins Bind Tubulin Heterodimers with High and Variable Stoichiometries" @default.
• W2028279692 cites W1566757173 @default.
• W2028279692 cites W1650752673 @default.
• W2028279692 cites W1965404941 @default.
• W2028279692 cites W1965680145 @default.
• W2028279692 cites W1968440575 @default.
• W2028279692 cites W1969475953 @default.
• W2028279692 cites W1974574293 @default.
• W2028279692 cites W1977721212 @default.
• W2028279692 cites W1986324787 @default.
• W2028279692 cites W1988446845 @default.
• W2028279692 cites W1994460947 @default.
• W2028279692 cites W1996447603 @default.
• W2028279692 cites W1997058261 @default.
• W2028279692 cites W2000749806 @default.
• W2028279692 cites W2003878410 @default.
• W2028279692 cites W2006895265 @default.
• W2028279692 cites W2009887244 @default.
• W2028279692 cites W2014908429 @default.
• W2028279692 cites W2020396988 @default.
• W2028279692 cites W2020609260 @default.
• W2028279692 cites W2030747261 @default.
• W2028279692 cites W2034850763 @default.
• W2028279692 cites W2036017389 @default.
• W2028279692 cites W2041877620 @default.
• W2028279692 cites W2046886790 @default.
• W2028279692 cites W2052247684 @default.
• W2028279692 cites W2054898226 @default.
• W2028279692 cites W2056063788 @default.
• W2028279692 cites W2056751153 @default.
• W2028279692 cites W2062703052 @default.
• W2028279692 cites W2062907944 @default.
• W2028279692 cites W2064571598 @default.
• W2028279692 cites W2067590011 @default.
• W2028279692 cites W2073081664 @default.
• W2028279692 cites W2077608555 @default.
• W2028279692 cites W2081430457 @default.
• W2028279692 cites W2082303732 @default.
• W2028279692 cites W2082501089 @default.
• W2028279692 cites W2092526636 @default.
• W2028279692 cites W2092974102 @default.
• W2028279692 cites W2125579246 @default.
• W2028279692 cites W2125989085 @default.
• W2028279692 cites W2128031786 @default.
• W2028279692 cites W2129231785 @default.
• W2028279692 cites W2135329719 @default.
• W2028279692 cites W2135819044 @default.
• W2028279692 cites W2155264181 @default.
• W2028279692 cites W2163591703 @default.
• W2028279692 cites W2171546216 @default.
• W2028279692 cites W2171846011 @default.
• W2028279692 cites W6664855 @default.
• W2028279692 doi "https://doi.org/10.1074/jbc.m109.096727" @default.
• W2028279692 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2857042" @default.
• W2028279692 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/20145240" @default.
• W2028279692 hasPublicationYear "2010" @default.
• W2028279692 type Work @default.
• W2028279692 sameAs 2028279692 @default.
• W2028279692 citedByCount "19" @default.
• W2028279692 countsByYear W20282796922012 @default.
• W2028279692 countsByYear W20282796922013 @default.
• W2028279692 countsByYear W20282796922015 @default.
• W2028279692 countsByYear W20282796922016 @default.
• W2028279692 countsByYear W20282796922019 @default.
• W2028279692 countsByYear W20282796922020 @default.
• W2028279692 countsByYear W20282796922021 @default.
• W2028279692 countsByYear W20282796922022 @default.
• W2028279692 crossrefType "journal-article" @default.
• W2028279692 hasAuthorship W2028279692A5000905507 @default.
• W2028279692 hasAuthorship W2028279692A5030072547 @default.
• W2028279692 hasAuthorship W2028279692A5041503324 @default.
• W2028279692 hasAuthorship W2028279692A5045267867 @default.
• W2028279692 hasAuthorship W2028279692A5056479549 @default.
• W2028279692 hasAuthorship W2028279692A5058818624 @default.
• W2028279692 hasAuthorship W2028279692A5075190925 @default.
• W2028279692 hasAuthorship W2028279692A5082028236 @default.
• W2028279692 hasBestOaLocation W20282796921 @default.
• W2028279692 hasConcept C104317684 @default.
• W2028279692 hasConcept C12554922 @default.
• W2028279692 hasConcept C144082473 @default.
• W2028279692 hasConcept C178790620 @default.
• W2028279692 hasConcept C185592680 @default.
• W2028279692 hasConcept C20418707 @default.
• W2028279692 hasConcept C2776041557 @default.
• W2028279692 hasConcept C55493867 @default.
• W2028279692 hasConcept C84425145 @default.

• next