FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2028322521> ?p ?o ?g. }

• W2028322521 endingPage "31" @default.
• W2028322521 startingPage "23" @default.
• W2028322521 abstract "The epidemiological analysis of Erysipelothrix isolates recovered from pigs, cattle and chickens was studied by the analysis of acriflavine resistance and the PCR-based DNA fingerprinting method using random amplified polymorphic DNA (RAPD). Thirty-two Erysipelothrix field isolates, 7 Erysipelothrix reference strains and 13 random primers were tested. Among the tested primers, the primers NK6 (CCCGCGCCCC) and D9355 (CCGGATCCGTGATGCGGTGCG) produced noticeable results. The primer NK6 revealed 5 RAPD patterns (a∼e) while primer D9355 revealed 8 RAPD patterns (A∼H) that were not serovar specific. Namely, different patterns were produced among strains of the same serovar showing that the RAPD method is able to identify the genetic variations of Erysipelothrix species but the RAPD data demonstrated that the some serovar 1a E. rhusiopathiae strains including strain Koganei 65-0.15 for the production of live vaccine were closely related each other genetically, irrespective of their acriflavine resistance. Based on these results, we concluded that the RAPD method with primer D9355 is a rapid and reliable method to differentiate Erysipelothrix isolates from various animals ; and might be a useful tool for the epidemiological analysis of the Erysipelothrix species." @default.
• W2028322521 created "2016-06-24" @default.
• W2028322521 creator A5007644388 @default.
• W2028322521 creator A5040877138 @default.
• W2028322521 creator A5056087473 @default.
• W2028322521 date "2007-01-01" @default.
• W2028322521 modified "2023-10-03" @default.
• W2028322521 title "Epidemiological Analysis of Erysipelothrix Isolates from Various Animals by Acriflavine Resistance and RAPD Typing" @default.
• W2028322521 cites W1969746001 @default.
• W2028322521 cites W2005515773 @default.
• W2028322521 cites W2016163542 @default.
• W2028322521 cites W2022512902 @default.
• W2028322521 cites W2026463873 @default.
• W2028322521 cites W2035295272 @default.
• W2028322521 cites W2045444023 @default.
• W2028322521 cites W2058166524 @default.
• W2028322521 cites W2068357190 @default.
• W2028322521 cites W2076412210 @default.
• W2028322521 cites W2080490975 @default.
• W2028322521 cites W2085753987 @default.
• W2028322521 cites W2093557340 @default.
• W2028322521 cites W2121663875 @default.
• W2028322521 cites W2124465341 @default.
• W2028322521 cites W2125568758 @default.
• W2028322521 cites W2134968820 @default.
• W2028322521 cites W2142412557 @default.
• W2028322521 cites W2144245719 @default.
• W2028322521 cites W2317433107 @default.
• W2028322521 cites W2320881723 @default.
• W2028322521 cites W2418456643 @default.
• W2028322521 cites W2437226996 @default.
• W2028322521 cites W55363953 @default.
• W2028322521 doi "https://doi.org/10.2743/jve.11.23" @default.
• W2028322521 hasPublicationYear "2007" @default.
• W2028322521 type Work @default.
• W2028322521 sameAs 2028322521 @default.
• W2028322521 citedByCount "0" @default.
• W2028322521 crossrefType "journal-article" @default.
• W2028322521 hasAuthorship W2028322521A5007644388 @default.
• W2028322521 hasAuthorship W2028322521A5040877138 @default.
• W2028322521 hasAuthorship W2028322521A5056087473 @default.
• W2028322521 hasBestOaLocation W20283225211 @default.
• W2028322521 hasConcept C10389963 @default.
• W2028322521 hasConcept C104317684 @default.
• W2028322521 hasConcept C105702510 @default.
• W2028322521 hasConcept C144024400 @default.
• W2028322521 hasConcept C149923435 @default.
• W2028322521 hasConcept C178790620 @default.
• W2028322521 hasConcept C185592680 @default.
• W2028322521 hasConcept C2775942383 @default.
• W2028322521 hasConcept C2777563447 @default.
• W2028322521 hasConcept C2778022156 @default.
• W2028322521 hasConcept C2778255925 @default.
• W2028322521 hasConcept C2781209916 @default.
• W2028322521 hasConcept C2908647359 @default.
• W2028322521 hasConcept C42972112 @default.
• W2028322521 hasConcept C49105822 @default.
• W2028322521 hasConcept C54355233 @default.
• W2028322521 hasConcept C71924100 @default.
• W2028322521 hasConcept C81977670 @default.
• W2028322521 hasConcept C84623179 @default.
• W2028322521 hasConcept C86803240 @default.
• W2028322521 hasConcept C89423630 @default.
• W2028322521 hasConceptScore W2028322521C10389963 @default.
• W2028322521 hasConceptScore W2028322521C104317684 @default.
• W2028322521 hasConceptScore W2028322521C105702510 @default.
• W2028322521 hasConceptScore W2028322521C144024400 @default.
• W2028322521 hasConceptScore W2028322521C149923435 @default.
• W2028322521 hasConceptScore W2028322521C178790620 @default.
• W2028322521 hasConceptScore W2028322521C185592680 @default.
• W2028322521 hasConceptScore W2028322521C2775942383 @default.
• W2028322521 hasConceptScore W2028322521C2777563447 @default.
• W2028322521 hasConceptScore W2028322521C2778022156 @default.
• W2028322521 hasConceptScore W2028322521C2778255925 @default.
• W2028322521 hasConceptScore W2028322521C2781209916 @default.
• W2028322521 hasConceptScore W2028322521C2908647359 @default.
• W2028322521 hasConceptScore W2028322521C42972112 @default.
• W2028322521 hasConceptScore W2028322521C49105822 @default.
• W2028322521 hasConceptScore W2028322521C54355233 @default.
• W2028322521 hasConceptScore W2028322521C71924100 @default.
• W2028322521 hasConceptScore W2028322521C81977670 @default.
• W2028322521 hasConceptScore W2028322521C84623179 @default.
• W2028322521 hasConceptScore W2028322521C86803240 @default.
• W2028322521 hasConceptScore W2028322521C89423630 @default.
• W2028322521 hasIssue "1" @default.
• W2028322521 hasLocation W20283225211 @default.
• W2028322521 hasOpenAccess W2028322521 @default.
• W2028322521 hasPrimaryLocation W20283225211 @default.
• W2028322521 hasRelatedWork W151569325 @default.
• W2028322521 hasRelatedWork W1975858241 @default.
• W2028322521 hasRelatedWork W2028322521 @default.
• W2028322521 hasRelatedWork W2097368792 @default.
• W2028322521 hasRelatedWork W2106899282 @default.
• W2028322521 hasRelatedWork W2142412557 @default.
• W2028322521 hasRelatedWork W2169483395 @default.
• W2028322521 hasRelatedWork W2917070600 @default.
• W2028322521 hasRelatedWork W2992298154 @default.
• W2028322521 hasRelatedWork W2055100607 @default.

• next