SemOpenAlex |

SemOpenAlex

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2028391785> ?p ?o ?g. }

Showing items 1 to 94 of 94 with 100 items per page.

W2028391785 endingPage "10297" @default.
W2028391785 startingPage "10291" @default.
W2028391785 abstract "Human DHRS6 is a previously uncharacterized member of the short chain dehydrogenases/reductase family and displays significant homologies to bacterial hydroxybutyrate dehydrogenases. Substrate screening reveals sole NAD+-dependent conversion of (R)-hydroxybutyrate to acetoacetate with Km values of about 10 mm, consistent with plasma levels of circulating ketone bodies in situations of starvation or ketoacidosis. The structure of human DHRS6 was determined at a resolution of 1.8 Å in complex with NAD(H) and reveals a tetrameric organization with a short chain dehydrogenases/reductase-typical folding pattern. A highly conserved triad of Arg residues (“triple R” motif consisting of Arg144, Arg188, and Arg205) was found to bind a sulfate molecule at the active site. Docking analysis of R-β-hydroxybutyrate into the active site reveals an experimentally consistent model of substrate carboxylate binding and catalytically competent orientation. GFP reporter gene analysis reveals a cytosolic localization upon transfection into mammalian cells. These data establish DHRS6 as a novel, cytosolic type 2 (R)-hydroxybutyrate dehydrogenase, distinct from its well characterized mitochondrial type 1 counterpart. The properties determined for DHRS6 suggest a possible physiological role in cytosolic ketone body utilization, either as a secondary system for energy supply in starvation or to generate precursors for lipid and sterol synthesis. Human DHRS6 is a previously uncharacterized member of the short chain dehydrogenases/reductase family and displays significant homologies to bacterial hydroxybutyrate dehydrogenases. Substrate screening reveals sole NAD+-dependent conversion of (R)-hydroxybutyrate to acetoacetate with Km values of about 10 mm, consistent with plasma levels of circulating ketone bodies in situations of starvation or ketoacidosis. The structure of human DHRS6 was determined at a resolution of 1.8 Å in complex with NAD(H) and reveals a tetrameric organization with a short chain dehydrogenases/reductase-typical folding pattern. A highly conserved triad of Arg residues (“triple R” motif consisting of Arg144, Arg188, and Arg205) was found to bind a sulfate molecule at the active site. Docking analysis of R-β-hydroxybutyrate into the active site reveals an experimentally consistent model of substrate carboxylate binding and catalytically competent orientation. GFP reporter gene analysis reveals a cytosolic localization upon transfection into mammalian cells. These data establish DHRS6 as a novel, cytosolic type 2 (R)-hydroxybutyrate dehydrogenase, distinct from its well characterized mitochondrial type 1 counterpart. The properties determined for DHRS6 suggest a possible physiological role in cytosolic ketone body utilization, either as a secondary system for energy supply in starvation or to generate precursors for lipid and sterol synthesis. Hepatic ketone body formation and utilization of these compounds by peripheral tissues with high energy demands is essential in humans and other mammals for survival during times of starvation and extended fasting. The compounds categorized as ketone bodies comprise acetoacetate, R-β-hydroxybutyrate, and acetone, the last being a nonmetabolizable decarboxylation product of acetoacetate. The liver produces and excretes ketone bodies during times when the amount of acetyl-CoA exceeds the oxidative capacity of hepatic mitochondria. Ketone body formation is thus necessary to maintain β-oxidation by supplying free CoA. This metabolic situation occurs when high amounts of fatty acids derived from peripheral tissues during starvation or fasting are oxidized by β-oxidation pathways. In exacerbated disease states, such as ketoacidotic coma, extremely high amounts of fatty acids are oxidized as a consequence of insulin resistance in diabetes mellitus. In this situation, a potentially life-threatening metabolic acidosis occurs through the high amounts of protons provided by acetoacetate and R-β-hydroxybutyrate, exceeding the serum bicarbonate buffer capacity. Serum levels of 5-10 mm ketone bodies are reached under these circumstances as compared with levels of 1 mm in normal states. The liver synthesizes acetoacetate through the enzymes thiolase, hydroxymethylglutaryl-CoA synthase, and hydroxymethylglutaryl-CoA lyase from three molecules of acetyl-CoA, thus producing 1 mol of acetoacetate, 1 mol of acetyl-CoA, and 2 mol of free CoA. Acetoacetate is further reduced to R-β-hydroxybutyrate through mitochondrial R-β-hydroxybutyrate dehydrogenase, driven by high levels of NADH in hepatic mitochondria. Peripheral tissues take up ketone bodies and oxidize (R)-hydroxybutyrate back to acetoacetate, which is then ultimately converted into acetyl-CoA entering the tricarboxylic acid cycle. Mitochondrial R-β-hydroxybutyrate dehydrogenase (BDH) 2The abbreviations used are: BDH, mitochondrial (R)-hydroxybutyrate dehydrogenase; SDR, short chain dehydrogenase/reductase; MES, 4-morpholineethanesulfonic acid; GFP, green fluorescent protein. 2The abbreviations used are: BDH, mitochondrial (R)-hydroxybutyrate dehydrogenase; SDR, short chain dehydrogenase/reductase; MES, 4-morpholineethanesulfonic acid; GFP, green fluorescent protein. has been extensively studied (1Chelius D. Loeb-Hennard C. Fleischer S. McIntyre J.O. Marks A.R. De S. Hahn S. Jehl M.M. Moeller J. Philipp R. Wise J.G. Trommer W.E. Biochemistry. 2000; 39: 9687-9697Crossref PubMed Scopus (13) Google Scholar, 2Churchill P. Hempel J. Romovacek H. Zhang W.W. Brennan M. Churchill S. Biochemistry. 1992; 31: 3793-3799Crossref PubMed Scopus (26) Google Scholar, 3Dalton L.A. McIntyre J.O. Fleischer S. Biochem. J. 1993; 296: 563-569Crossref PubMed Scopus (8) Google Scholar, 4Green D. Marks A.R. Fleischer S. McIntyre J.O. Biochemistry. 1996; 35: 8158-8165Crossref PubMed Scopus (14) Google Scholar, 5Marks A.R. McIntyre J.O. Duncan T.M. Erdjument-Bromage H. Tempst P. Fleischer S. J. Biol. Chem. 1992; 267: 15459-15463Abstract Full Text PDF PubMed Google Scholar) and constitutes a paradigm of lipid regulation of enzymatic function; however, a crystallographic structural characterization has not been achieved to date. The enzyme belongs to the short chain dehydrogenase/reductase superfamily (6Jornvall H. Persson B. Krook M. Atrian S. Gonzalez-Duarte R. Jeffery J. Ghosh D. Biochemistry. 1995; 34: 6003-6013Crossref PubMed Scopus (1154) Google Scholar, 7Kallberg Y. Oppermann U. Jornvall H. Persson B. Protein Sci. 2002; 11: 636-641Crossref PubMed Scopus (195) Google Scholar, 8Oppermann U. Filling C. Hult M. Shafqat N. Wu X. Lindh M. Shafqat J. Nordling E. Kallberg Y. Persson B. Jornvall H. Chem. Biol. Interact. 2003; 143: 247-253Crossref PubMed Scopus (539) Google Scholar), an evolutionarily conserved family of oxidoreductases found in all forms of life. At present, well over 4000 members are deposited in sequence data-bases, and about 50 three-dimensional structures comprising 20-30 distinct enzymatic activities are available (6Jornvall H. Persson B. Krook M. Atrian S. Gonzalez-Duarte R. Jeffery J. Ghosh D. Biochemistry. 1995; 34: 6003-6013Crossref PubMed Scopus (1154) Google Scholar, 7Kallberg Y. Oppermann U. Jornvall H. Persson B. Protein Sci. 2002; 11: 636-641Crossref PubMed Scopus (195) Google Scholar, 8Oppermann U. Filling C. Hult M. Shafqat N. Wu X. Lindh M. Shafqat J. Nordling E. Kallberg Y. Persson B. Jornvall H. Chem. Biol. Interact. 2003; 143: 247-253Crossref PubMed Scopus (539) Google Scholar). Within the human genome, we have previously identified about 70 members of this superfamily (7Kallberg Y. Oppermann U. Jornvall H. Persson B. Protein Sci. 2002; 11: 636-641Crossref PubMed Scopus (195) Google Scholar, 9Oppermann U.C. Filling C. Jornvall H. Chem. Biol. Interact. 2001; 130: 699-705Crossref PubMed Scopus (92) Google Scholar). Of these human genes, about one-third are still functionally largely uncharacterized, and about 15 human members have been structurally determined. Here we describe the functional and structural annotation of human DHRS6 as a novel, cytosolic type II R-β-hydroxybutyrate dehydrogenase. Human DHRS6 or any other species ortholog represents a previously completely uncharacterized member of the SDR family. The human DHRS6 gene and a putative pseudogene with 95% amino acid sequence identity (DHRS6L) are found on chromosomes 4q24 and 6q16.3, respectively. Human DHRS6 and its vertebrate orthologs show high levels of sequence identities to bacterial hydroxybutyrate dehydrogenases (30-40%) (Fig. 1, A and B). This level is higher than that of any other human paralog SDR (30%). Furthermore, a phylogenetic analysis (Fig. 1B) establishes a clear relationship between prokaryotic BDHs and the vertebrate DHRS6 cluster. This finding prompted us to investigate the possibility that DHRS6 acts as hydroxybutyrate dehydrogenase. Cloning, Expression, and Purification of Human DHRS6 and DHRS6L—N-terminally His6-tagged variants encoding human DHRS6 and DHRS6L constructs were expressed in the Escherichia coli expression strain BL21(DE3) in TB medium. For bacterial expression, the coding sequences for human DHRS6 (gi|14754051) and DHRS6L (gi|14754051) were codon-optimized for expression in E. coli. The genes were synthesized (Genscript) and subcloned into a modified pET vector using NdeI and BamHI sites, resulting in an N-terminal His6 tag and an engineered TEV protease site and a C-terminal sequence of Gly-Ser before the stop codon. High level soluble protein production was achieved by isopropyl 1-thio-β-d-galactopyranoside induction (0.5 mm) at 18 °C for 12 h. Whereas expression of soluble DHRS6 was observed, soluble DHRS6L expression proved to be unsuccessful. Cells from DHRS6 cultures were disrupted in a high pressure homogenizer, and the resulting cell lysate was centrifuged for 40 min at 15,000 × g. The clarified supernatant was then subjected to immobilized metal affinity chromatography (Ni2+-nitrilotriacetic acid resin; Qiagen) and eluted in 250 mm imidazole, 500 mm NaCl, 50 mm HEPES, pH 7.5, 5% glycerol. This was followed by a final gel filtration chromatographic step on a Superdex 200 HiLoad 26/60 column (GE Healthcare, Uppsala, Sweden). DHRS6 was purified in 10 mm HEPES, pH 7.5, containing 2 mm tris(2-carboxyethyl)phosphine, 5% (w/v) glycerol, and concentrated to 18.3 mg/ml using a 30,000-kDa molecular mass cut-off Amicon Ultra concentration device (Millipore Corp., Bedford, MA). This two-step purification resulted in a homogenous protein preparation (Fig. 2). The experimentally determined mass by electrospray ionization-time-of-flight mass spectrometry (Agilent LC-MSD TOF) was in agreement with the predicted mass value. Crystallization of Human DHRS6—Immediately prior to crystallization, 5 mm NADH (Sigma) was added to the concentrated DHRS6 protein. 50 nl of the protein (at 18.3 mg/ml) was mixed with 100 nl of crystallization solution containing 30% polyethylene glycol monomethylether 5000, 0.2 m ammonium sulfate, and 0.1 m MES, pH 6.5 (Molecular Dimensions Screen I). The crystals were obtained by using the sitting drop vapor diffusion technique at 20 °C. Data Collection, Processing, and Refinement—A single crystal was transferred to a cryoprotectant consisting of mother liquor and supplemented to a final glycerol concentration of 20% and then flash-frozen in liquid nitrogen. A data set extending to a resolution of 1.84 Å was collected from this crystal on an R-AXIS HTC imaging plate area detector mounted on a Rigaku F-RE SuperBright rotating anode generator (both from Rigaku MSC) operating at 45 kV and 45 mA. Data were indexed, integrated, and scaled using the programs MOSFLM version 6.2.5 and SCALA version 5.0. Initial phases were calculated by molecular replacement implemented by Phaser version 1.3.1. The search model was an SDR structure with the Protein Data Bank code 1NFF (product of the Rv2002 gene from Mycobacterium tuberculosis). The first maps were of sufficient quality to allow the deletion of incorrect regions and adjustment of the amino acid sequence to the DHRS6 sequence. Starting from this model, 50 cycles of automated model building were carried out using the program ARP/wARP. Water molecules were automatically picked by ARP/wARP and later checked manually for appropriate density and hydrogen-bonding pattern. The final rounds of manual model building and refinement were carried out in Coot and REFMAC version 5.02.0005, respectively. Docking Analysis of DHRS6—A molecular three-dimensional model of the substrate molecule (R)-3-hydroxybutyrate was generated using the Dundee PRODRG2 server (available on the World Wide Web at davapc1.bioch.dundee.ac.uk/programs/prodrg/) and saved in the Protein Data Bank format. This molecule and the structure of DHRS6 were loaded into the program ICM (available on the World Wide Web at www.molsoft.com) (10Totrov M. Abagyan R. Proteins. 1997; (Suppl. 1): 215-220Crossref PubMed Scopus (400) Google Scholar) and converted into the internal coordinates format that includes the addition of hydrogen atoms to the protein model. Both molecules were submitted to the small molecules docking protocol, using pseudoenergy grid potentials to represent the protein molecule and fully flexible ligand molecule as described (10Totrov M. Abagyan R. Proteins. 1997; (Suppl. 1): 215-220Crossref PubMed Scopus (400) Google Scholar) and implemented in ICM. The active site pocket was easily identified and consisted of a closed cavity inaccessible to the solvent located at the nicotinamide ring end of the bound cofactor molecule. The χ-1 angle of Ser133 was modified to bring the active site to the probable catalytic conformation. The thoroughness parameter was set to 10. The resulting poses of the ligand after docking were individually analyzed. Substrate Screening and Determination of Kinetic Constants—Enzyme activities were measured as NAD(P)(H)-dependent hydroxydehydrogenase activities of various hydroxybutyryl derivatives. Nucleotide cofactors and d/l-hydroxybutyryl-CoA were from Sigma, and R and S isomers of hydroxybutyrate and hydroxyisobutyrate were obtained from Fluka. Activities were determined by the change of absorbance at 340 nm, using a molar extinction coefficient for NAD(P)H of 6220 m-1 cm-1. Recordings were carried out with a SpectraMax2 (Amersham Biosciences) instrument. Reactions were performed in 1.0-ml volumes or in 96-well microtiter plates in 200-μl volumes at different temperatures and pH values. A linear relationship between product formation and reaction time or amount of enzyme was established and used in subsequent experiments. For determination of kinetic parameters, the substrate concentrations were varied at least between 20 and 500% of an estimated Km value. Kinetic constants were calculated from initial velocity data by direct curve fitting to the Michaelis-Menten equation (V = Vmax×Sh/(Kmh + Sh); h = 1) using nonlinear regression analysis and the Prism software package (GraphPad). Subcellular Localization of Human DHRS6—For localization studies, the full-length coding sequence of human DHRS6 was cloned into different Living Colors™ Vectors (BD Biosciences Clontech, Heidelberg, Germany), resulting in fluorescent protein-tagged constructs. N-terminal green fluorescent protein (GFP) tags were achieved by subcloning into pEGFP-C2; C-terminal tags were constructed by cloning into pAcGFP1-N1. Primers used for amplification of DHRS6 for subcloning into GFP expression vectors were as follows: pEGFP-C2/DHRS6-for (TATAGAATTCATGGGTCGACTTGATGGGAAAGTCATC), pEGFP-C2/DHRS6-rev (TTAAGGATCCTCACAAGCTCCAGCCTCCATCAATG), pAcGFP1-N1/DHRS6-for (TATAAAGCTTATGGGTCGACTTGATGGGAAAGTCATC), and pAcGFP1-N1/DHRS6-rev (TTAACCGCGGCAAGCTCCAGCCTCCATCAATGATG). Generated constructs were subsequently verified by sequencing on an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA). The human cell line HeLa was maintained in minimal essential medium, 10% fetal bovine serum, 1% penicillin/streptomycin (Invitrogen) at 37 °C and 5% CO2. About 5 × 104 HeLa cells were plated out in 6-well plates containing glass coverslips, transiently transfected with 1 μg of DNA, 3 μl of FuGENE 6 Transfection Reagent (Roche Applied Science) according to the manufacturer's protocol, and studied after an incubation time of 24 h. For staining of endoplasmic reticulum or mitochondria, cells were incubated under growth conditions for 30 min with fresh medium containing 1 μm ER-Tracker Blue-White DPX or 300 nm Mito Tracker Orange CMTMRos (stains by Molecular Probes, Karlsruhe, Germany), respectively. Cells were washed twice with PBS and fixed for fluorescence microscopy by incubation for 10 min at growth conditions in medium containing 3.7% formaldehyde. For staining the nucleus, fixed cells were incubated for 2 min under growth conditions with fresh medium containing 300 nm 4′,6-diamidino-2-phenylindole solution (in H2O; stain by Sigma). Cells were washed twice in PBS, mounted on slides with VectaShield mounting medium (VectorLabs, Grünberg, Germany), and examined with an Axiophot epifluorescence microscope (Zeiss) using a × 40 oil immersion objective. Three-channel optical data were collected with an ISIS system (Metasystems, Altlussheim, Germany). Expression, Purification, and Substrate Analysis of Human DHRS6— Whereas human DHRS6 could be expressed and purified in a rapid two-step chromatography procedure (Fig. 2A), yielding about 20 mg of soluble protein per liter of culture, the DHRS6L protein could not be expressed solubly. Gel filtration experiments show that the DHRS6 protein fraction elutes at a position indicating that its solution state is tetrameric (Fig. 2B). A substrate screening using a spectrophotometric assay with a variety of hydroxybutyryl derivatives reveals that the purified enzyme is active toward (R)-β-hydroxybutyrate but not toward the S enantiomer or toward the (R)- or (S)-hydroxybutyryl-CoA derivatives or toward (S)- or (R)-hydroxyisobutyrate (Table 1). Steady-state kinetic experiments show that R-β-hydroxybutyrate is oxidized with a Vmax of about 82.3 nmol × min-1 × mg-1 and a Km of 9.1 mm (Table 1) at 30 °C and at pH 9.0. At pH 7.5, DHRS6 oxidizes (R)-OH butyrate with a Vmax of 31.9 nmol × min-1 × mg-1 and a Km of 12.6 mm. The enzyme follows a Michaelis-Menten kinetic pattern (Fig. 1C), and no signs for allosteric behavior were observed. The enzyme is specific for NAD+ and shows a Km for this cofactor of 59.8 μm (cf. Table 1).TABLE 1Kinetic analysis for human DHRS6 Experiments were carried out in the indicated buffer system at saturating concentrations for the second substrate ((R)-OH butyrate (50 mm) or NAD+ (1 mm), respectively). Screening experiments for activities with (S)-OH butyrate, dl-OH-butyryl-CoA, and NADP+ were carried out at 1 mm NADP+, 50 mm (S)-OH-butyrate, and 125 mm dl-OH-butyryl-CoA, respectively, at pH 9.0. NA, no activity detectable. Number of experiments (n) = 4-6. Experiments were carried out at 25 °C unless otherwise stated.SubstrateBuffer/pHKmVmaxkcatkcat/Kmmmnmol × min–1 × mg–1min–1min–1 × mm–1(R)-OH butyrate50 mm HEPES, pH 7.512.6 ± 5.531.9 ± 5.60.95 ± 0.20.075(R)-OH butyrate50 mm Tris/Cl, pH 9.010.5 ± 0.764.1 ± 2.91.9 ± 0.10.18(R)-OH butyrateaConducted at 30 °C50 mm Tris/Cl, pH 9.09.1 ± 0.482.3 ± 4.32.4 ± 0.20.26NAD+50 mm Tris/Cl, pH 9.059.8 ± 11.057.0 ± 4.1(S)-OH butyrate50 mm Tris/Cl, pH 9.0NAdl-OH-butyryl-CoA50 mm Tris/Cl, pH 9.0NA3-OH-R-2-methylbutyrate50 mm Tris/Cl, pH 9.0NA3-OH-S-2-methylbutyrate50 mm Tris/Cl, pH 9.0NANADP+50 mm Tris/Cl, pH 9.0NAa Conducted at 30 °C Open table in a new tab Crystal Structure of Human DHRS6—Crystals obtained diffracted to a resolution of about 1.84 Å, and phases were calculated by molecular replacement (for data processing and refinement statistics, see Table 2). The crystallographic asymmetric unit of human DHRS6 consists of four monomers (A-D), four NAD+ molecules, four sulfate molecules, and 869 water molecules. The final model contains residues 1-246 of chain A, residues 2-246 of chain B, and residues 2-245 of chains C and D. A Ramachandran plot (Procheck) indicates that 92% of the residues are in the most favored regions, and the remaining 8% are in the additional allowed (7.5%) and generously allowed (0.5%) regions. The 245-residue core domain of human DHRS6 (without residues introduced through cloning) forms a single α/β domain typical of SDR enzymes (Fig. 3). The topology is based on the Rossmann fold, with a seven-stranded parallel β-sheet (βA-βG), which is sandwiched between three α-helices on each side (αB-αG) (Fig. 3B). Additional secondary structural elements are inserted between βF and αG and consist of two short helices (αFG1 (residues Asp182-Arg191) and αFG2 (residues Asn194-Arg205), connected by a turn introduced through Arg192 and Gly193. Furthermore, two short strands (βFG1 (Thr179-Asp181) and βFG2 (Phe211-Thr213)) preceding helices αFG1 and αG (Fig. 3C) are found. This region is the most dissimilar found in SDR enzymes and constitutes large parts of the substrate binding region (cf. Fig. 3C). Comparison of subunits of DHRS6 and rat type II hydroxyacyl-CoA dehydrogenase with bound NAD+ and acetoacetate (11Powell A.J. Read J.A. Banfield M.J. Gunn-Moore F. Yan S.D. Lustbader J. Stern A.R. Stern D.M. Brady R.L. J. Mol. Biol. 2000; 303: 311-327Crossref PubMed Scopus (76) Google Scholar) shows distinct secondary structure arrangements around the active site, despite conservation of catalytic residues.TABLE 2Data collection and refinement statistics for DHRS6 crystalParametersValuesData processingWavelength (Å)1.54Space groupP1Unit cell parameters (Å)62.1, 62.1, 74.0, 106.0, 106.0, 101.0Resolution range (outer shell)(Å)66.7–1.84 (1.94–1.84)Observed reflections (outer shell)150,655 (15,097)Unique reflections (outer shell)76,179 (7831)Completeness (outer shell)(%)89.7 (62.9)Mean I/σ(I) (outer shell)11.8 (3.1)Multiplicity (outer shell)2.0 (1.9)Rmerge (outer shell)0.062 (0.205)VM (Å3 Da–1)2.2RefinementProtein atoms7449Protein residues (per chain)A, 1–246; B, 2–246; C, 2–245; D, 2–245Waters in model869Heteroatoms in model4 SO4,aSO4, sulfate 4 NADRwork0.168Rfree0.224Root mean square deviation bond lengths (Å)0.022Root mean square deviation bond angles (degrees)1.744Average B factor (Å2)Main chain (per chain)A:28.6, B:28.7, C:28.6, D:28.6Side chain (per chain)A:31.1, B:30.9, C:30.9, D:30.9Waters37.1Lingands26.8Protein Data Bank code2AG5a SO4, sulfate Open table in a new tab The functional oligomeric state of the enzyme is a tetramer, composed of subunits A, B, C, and D, showing a 222-point group symmetry (Fig. 3A). DHRS6 thus displays a prototype quaternary arrangement as observed in several SDRs (e.g. bacterial 3α/20β-HSD, rat type II HADH, or murine MLCR) (11Powell A.J. Read J.A. Banfield M.J. Gunn-Moore F. Yan S.D. Lustbader J. Stern A.R. Stern D.M. Brady R.L. J. Mol. Biol. 2000; 303: 311-327Crossref PubMed Scopus (76) Google Scholar, 12Ghosh D. Weeks C.M. Grochulski P. Duax W.L. Erman M. Rimsay R.L. Orr J.C. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 10064-10068Crossref PubMed Scopus (231) Google Scholar, 13Tanaka N. Nonaka T. Nakanishi M. Deyashiki Y. Hara A. Mitsui Y. Structure. 1996; 4: 33-45Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar). Cofactor Binding and Active Site Architecture of Human DHRS6—The structure of DHRS6 was solved in complex with NAD+, and well defined electron density is observed for all parts of the cofactor molecule. NAD+ binds in an extended conformation (14.3 Å between C2 of nicotinamide and C6 of the adenine ring), with the adenine ring in anti conformation and syn for the nicotinamide ring, consistent with B-face 4-pro-S hydride transfer. DHRS6 shows an unusual sequence motif (TAAAQGIG instead of TGXXXGIG found in the majority of SDRs), which determines the turn between βA and αB, necessary to accommodate the pyrophosphate moiety of the cofactor (6Jornvall H. Persson B. Krook M. Atrian S. Gonzalez-Duarte R. Jeffery J. Ghosh D. Biochemistry. 1995; 34: 6003-6013Crossref PubMed Scopus (1154) Google Scholar, 13Tanaka N. Nonaka T. Nakanishi M. Deyashiki Y. Hara A. Mitsui Y. Structure. 1996; 4: 33-45Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, 14Ghosh D. Wawrzak Z. Weeks C.M. Duax W.L. Erman M. Structure. 1994; 2: 629-640Abstract Full Text Full Text PDF PubMed Scopus (209) Google Scholar). The degree of variability in this basic and critical SDR motif is also observed in Drosophila ADH, which has the sequence VAALGIG (15Benach J. Atrian S. Gonzalez-Duarte R. Ladenstein R. J. Mol. Biol. 1999; 289: 335-355Crossref PubMed Scopus (92) Google Scholar). The active site is a deep cleft, with the NAD+ cofactor forming the bottom of the active site cavity. The active site is flanked on one site by a long loop from Asn80 to His87, connecting βD and αE, and on the other side by the loop connecting βD-αF and reaches further into helix αF (residues Ser132-Lys150). Within this cavity, the catalytic residues of DHRS6 are found at homologous positions previously identified in other SDR-type dehydrogenases (6Jornvall H. Persson B. Krook M. Atrian S. Gonzalez-Duarte R. Jeffery J. Ghosh D. Biochemistry. 1995; 34: 6003-6013Crossref PubMed Scopus (1154) Google Scholar, 16Filling C. Berndt K.D. Benach J. Knapp S. Prozorovski T. Nordling E. Ladenstein R. Jornvall H. Oppermann U. J. Biol. Chem. 2002; 277: 25677-25684Abstract Full Text Full Text PDF PubMed Scopus (459) Google Scholar). These residues comprise Ser133, Tyr147, and Lys151 (Fig. 4A). Furthermore, the characteristic polar contacts between Tyr147, Lys151, the 2′- and 3′-OH of the nicotinamide, and the water contacts involving the main chain carbonyl of conserved Asn105 and the side chain of Lys151, indicate a possible proton relay (16Filling C. Berndt K.D. Benach J. Knapp S. Prozorovski T. Nordling E. Ladenstein R. Jornvall H. Oppermann U. J. Biol. Chem. 2002; 277: 25677-25684Abstract Full Text Full Text PDF PubMed Scopus (459) Google Scholar) (data not shown). The side chain of Asn105 binds to the main chain amide of Phe84, thus introducing a characteristic kink in helix αE, a structural motif found in the majority of SDR structures determined to date (16Filling C. Berndt K.D. Benach J. Knapp S. Prozorovski T. Nordling E. Ladenstein R. Jornvall H. Oppermann U. J. Biol. Chem. 2002; 277: 25677-25684Abstract Full Text Full Text PDF PubMed Scopus (459) Google Scholar). Within the active site, a sulfate molecule derived from the crystallization solution, forms hydrogen bonds with the basic residues Arg144, Arg188, and Arg205 (Fig. 4A). These residues are found to be highly conserved in the DHRS6 cluster as well as the bacterial BDHs identified above (Fig. 1A). This suggests a conserved binding mode of this “triple R” motif to a negatively charged substrate group. The interaction described presumably closes the active site, by moving helices αFG1 (contacts between Arg188-SO4: 2.9 and 3.0 Å) and αFG2 (contacts between Arg205-SO4: 3.1 and 2.8 Å) toward helix αF (contacts between Arg144-SO4: 2.9 and 2.9 Å) (Fig. 4A). Substrate docking of hydroxybutyrate into the active site of human DHRS6 was performed. The results generated by the docking protocol were then analyzed, and we present here the best solution satisfying the catalysis conditions. The three conserved arginines (Arg188, Arg144, and Arg205) are coordinating the carboxyl group of (R)-3-hydroxybutyrate, whereas the catalytic residues Ser133 and Tyr147 are interacting with the carbonyl group. This results in the positioning of the C3-S hydrogen of (R)-hydroxybutyrate facing toward the nicotinamide ring of the cofactor, in close proximity (3.2 Å) for its transfer to the position C4 of NAD+ (Fig. 4B). Subcellular Localization of Human DHRS6—Reporter experiments with either N- or C-terminally GFP-tagged human DHRS6 transfected into HeLa cells reveal a fluorescence pattern consistent with a cytoplasmic localization (Fig. 5). Moreover, no mitochondrial (Fig. 5) or endoplasmic reticulum (data not shown) targeting is observed using mitochondrial fluorescence dyes as reporter, thus distinguishing DHRS6 further from type 1 BDH. Human DHRS6 and its vertebrate orthologs represent a striking example of structural and functional conservation between pro- and eukaryotic species. The high degree of sequence conservation and the confirmed overlapping substrate specificities between prokaryotic BDHs and human DHRS6 allow us to predict that prokaryotic members of this DHRS6/BDH cluster share significant structural similarities, as observed and discussed in the structure presented in this report. The similarities observed are not only found in the regular SDR sequence motifs defined earlier (6Jornvall H. Persson B. Krook M. Atrian S. Gonzalez-Duarte R. Jeffery J. Ghosh D. Biochemistry. 1995; 34: 6003-6013Crossref PubMed Scopus (1154) Google Scholar, 9Oppermann U.C. Filling C. Jornvall H. Chem. Biol. Interact. 2001; 130: 699-705Crossref PubMed Scopus (92) Google Scholar, 16Filling C. Berndt K.D. Benach J. Knapp S. Prozorovski T. Nordling E. Ladenstein R. Jornvall H. Oppermann U. J. Biol. Chem. 2002; 277: 25677-25684Abstract Full Text Full Text PDF PubMed Scopus (459) Google Scholar, 17Oppermann U.C. Filling C. Berndt K.D. Persson B. Benach J. Ladenstein R. Jornvall H. Biochemistry. 1997; 36: 34-40Crossref PubMed Scopus (132) Google Scholar) but also extend especially into the substrate and active site region, pointing to essentially the same substrate specificities and mechanisms. The enzymes described in this report are thus clearly different from mammalian type 1 (mitochondrial) BDH (sharing about 20% sequence identities), mammalian 3-hydroxyisobutyrate dehydrogenases involved in valine catabolism (18Hawes J.W. Crabb D.W. Chan R.J. Rougraff P.M. Paxton R. Harris R.A. Methods Enzymol. 2000; 324: 218-228Cro" @default.
W2028391785 created "2016-06-24" @default.
W2028391785 creator A5030288845 @default.
W2028391785 creator A5031585984 @default.
W2028391785 creator A5056817661 @default.
W2028391785 creator A5061314864 @default.
W2028391785 creator A5061627231 @default.
W2028391785 creator A5073484380 @default.
W2028391785 creator A5074357068 @default.
W2028391785 date "2006-04-01" @default.
W2028391785 modified "2023-10-10" @default.
W2028391785 title "Characterization of Human DHRS6, an Orphan Short Chain Dehydrogenase/Reductase Enzyme" @default.
W2028391785 cites W135956568 @default.
W2028391785 cites W1502473233 @default.
W2028391785 cites W1566055820 @default.
W2028391785 cites W1849836964 @default.
W2028391785 cites W1988530421 @default.
W2028391785 cites W1996456384 @default.
W2028391785 cites W2004228892 @default.
W2028391785 cites W2016922790 @default.
W2028391785 cites W2017741040 @default.
W2028391785 cites W2028401838 @default.
W2028391785 cites W2031370072 @default.
W2028391785 cites W2036030554 @default.
W2028391785 cites W2042773462 @default.
W2028391785 cites W2046032859 @default.
W2028391785 cites W2047894301 @default.
W2028391785 cites W2053914556 @default.
W2028391785 cites W2058249223 @default.
W2028391785 cites W2061619626 @default.
W2028391785 cites W2063773959 @default.
W2028391785 cites W2068960204 @default.
W2028391785 cites W2101418310 @default.
W2028391785 cites W2121891040 @default.
W2028391785 cites W2283151715 @default.
W2028391785 cites W2340724520 @default.
W2028391785 cites W4296588184 @default.
W2028391785 doi "https://doi.org/10.1074/jbc.m511346200" @default.
W2028391785 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16380372" @default.
W2028391785 hasPublicationYear "2006" @default.
W2028391785 type Work @default.
W2028391785 sameAs 2028391785 @default.
W2028391785 citedByCount "62" @default.
W2028391785 countsByYear W20283917852012 @default.
W2028391785 countsByYear W20283917852013 @default.
W2028391785 countsByYear W20283917852014 @default.
W2028391785 countsByYear W20283917852015 @default.
W2028391785 countsByYear W20283917852016 @default.
W2028391785 countsByYear W20283917852017 @default.
W2028391785 countsByYear W20283917852019 @default.
W2028391785 countsByYear W20283917852020 @default.
W2028391785 countsByYear W20283917852021 @default.
W2028391785 countsByYear W20283917852022 @default.
W2028391785 countsByYear W20283917852023 @default.
W2028391785 crossrefType "journal-article" @default.
W2028391785 hasAuthorship W2028391785A5030288845 @default.
W2028391785 hasAuthorship W2028391785A5031585984 @default.
W2028391785 hasAuthorship W2028391785A5056817661 @default.
W2028391785 hasAuthorship W2028391785A5061314864 @default.
W2028391785 hasAuthorship W2028391785A5061627231 @default.
W2028391785 hasAuthorship W2028391785A5073484380 @default.
W2028391785 hasAuthorship W2028391785A5074357068 @default.
W2028391785 hasBestOaLocation W20283917851 @default.
W2028391785 hasConcept C134651460 @default.
W2028391785 hasConcept C181199279 @default.
W2028391785 hasConcept C185592680 @default.
W2028391785 hasConcept C2776317432 @default.
W2028391785 hasConcept C55493867 @default.
W2028391785 hasConceptScore W2028391785C134651460 @default.
W2028391785 hasConceptScore W2028391785C181199279 @default.
W2028391785 hasConceptScore W2028391785C185592680 @default.
W2028391785 hasConceptScore W2028391785C2776317432 @default.
W2028391785 hasConceptScore W2028391785C55493867 @default.
W2028391785 hasIssue "15" @default.
W2028391785 hasLocation W20283917851 @default.
W2028391785 hasOpenAccess W2028391785 @default.
W2028391785 hasPrimaryLocation W20283917851 @default.
W2028391785 hasRelatedWork W1531601525 @default.
W2028391785 hasRelatedWork W1585891632 @default.
W2028391785 hasRelatedWork W2012199819 @default.
W2028391785 hasRelatedWork W2023262018 @default.
W2028391785 hasRelatedWork W2138557102 @default.
W2028391785 hasRelatedWork W2607424097 @default.
W2028391785 hasRelatedWork W2748952813 @default.
W2028391785 hasRelatedWork W2899084033 @default.
W2028391785 hasRelatedWork W2948807893 @default.
W2028391785 hasRelatedWork W2778153218 @default.
W2028391785 hasVolume "281" @default.
W2028391785 isParatext "false" @default.
W2028391785 isRetracted "false" @default.
W2028391785 magId "2028391785" @default.
W2028391785 workType "article" @default.