FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2029214965> ?p ?o ?g. }

• W2029214965 endingPage "4217" @default.
• W2029214965 startingPage "4211" @default.
• W2029214965 abstract "The amyloid peptide is the main constituent of the amyloid plaques in brain of Alzheimer's disease patients. This peptide is generated from the amyloid precursor protein by two consecutive cleavages. Cleavage at the N terminus is performed by the recently discovered β-secretase (Bace). This aspartyl protease contains a propeptide that has to be removed to obtain mature Bace. Furin and other members of the furin family of prohormone convertases are involved in this process. Surprisingly, β-secretase activity, neither at the classical Asp1 position nor at the Glu11 position of amyloid precursor protein, seems to be controlled by this maturation step. Furthermore, we show that Glu11 cleavage is a function of the expression level of Bace, that it depends on the membrane anchorage of Bace, and that Asp1 cleavage can be followed by Glu11cleavage. Our data suggest that pro-Bace could be active as a β-secretase in the early biosynthetic compartments of the cell and could be involved in the generation of the intracellular pool of the amyloid peptide. We conclude that modulation of the conversion of pro-Bace to mature Bace is not a relevant drug target to treat Alzheimer's disease. The amyloid peptide is the main constituent of the amyloid plaques in brain of Alzheimer's disease patients. This peptide is generated from the amyloid precursor protein by two consecutive cleavages. Cleavage at the N terminus is performed by the recently discovered β-secretase (Bace). This aspartyl protease contains a propeptide that has to be removed to obtain mature Bace. Furin and other members of the furin family of prohormone convertases are involved in this process. Surprisingly, β-secretase activity, neither at the classical Asp1 position nor at the Glu11 position of amyloid precursor protein, seems to be controlled by this maturation step. Furthermore, we show that Glu11 cleavage is a function of the expression level of Bace, that it depends on the membrane anchorage of Bace, and that Asp1 cleavage can be followed by Glu11cleavage. Our data suggest that pro-Bace could be active as a β-secretase in the early biosynthetic compartments of the cell and could be involved in the generation of the intracellular pool of the amyloid peptide. We conclude that modulation of the conversion of pro-Bace to mature Bace is not a relevant drug target to treat Alzheimer's disease. Alzheimer's disease amyloid precursor protein isoelectric focusing beta-site APP-cleavingenzyme soluble Bace Bace in which the propeptide cleavage site RLPR↓ is mutated into ALPA (single letter amino acid code) proprotein convertases polyacrylamide gel electrophoresis α1-antitrypsin Portland amyloid β C-terminal fragments wild type Chinese hamster ovary The brain of patients suffering from Alzheimer's disease (AD)1 is characterized by the presence of amyloid plaques composed mainly of the 39–42 amino acid amyloid β (Aβ) peptide (1Glenner G.G. Wong C.W. Biochem. Biophys. Res. Commun. 1984; 120: 885-890Crossref PubMed Scopus (4170) Google Scholar, 2Masters C.L. Simms G. Weinman N.A. Multhaup G. McDonald B.L. Beyreuther K. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 4245-4249Crossref PubMed Scopus (3621) Google Scholar). Aβ derives from a type I single membrane-spanning protein termed amyloid precursor protein (APP) by post-translational proteolytic cleavage (3Haass C. Selkoe D.J. Cell. 1993; 75: 1039-1042Abstract Full Text PDF PubMed Scopus (737) Google Scholar). Two cleavages by β-and γ-secretases, respectively, are required to release Aβ from APP. Only recently the molecular identity of these enzymes has been elucidated. γ-Secretase is apparently a large complex, with presenilin being an essential component of it (4De Strooper B. Saftig P. Craessaerts K. Vanderstichele H. Guhde G. Annaert W. Von Figura K. Van Leuven F. Nature. 1998; 391: 387-390Crossref PubMed Scopus (1544) Google Scholar, 5Esler W.P. Kimberly W.T. Ostaszewski B.L. Diehl T.S. Moore C.L. Tsai J.Y. Rahmati T. Xia W. Selkoe D.J. Wolfe M.S. Nat. Cell. Biol. 2000; 2: 428-434Crossref PubMed Scopus (504) Google Scholar, 6Wolfe M.S. Xia W. Ostaszewski B.L. Diehl T.S. Kimberly W.T. Selkoe D.J. Nature. 1999; 398: 513-517Crossref PubMed Scopus (1679) Google Scholar, 7Li Y.M. Xu M. Lai M.T. Huang Q. Castro J.L. DiMuzio-Mower J. Harrison T. Lellis C. Nadin A. Neduvelil J.G. Register R.B. Sardana M.K. Shearman M.S. Smith A.L. Shi X.P. Yin K.C. Shafer J.A. Gardell S.J. Nature. 2000; 405: 689-694Crossref PubMed Scopus (861) Google Scholar). β-Secretase has been identified independently by 5 groups and was named Bace (beta-site APP cleavingenzyme), Asp-2, or memapsin 2 (membrane-anchored aspartic protease of the pepsin family) (8Hussain I. Powell D. Howlett D.R. Tew D.G. Meek T.D. Chapman C. Gloger I.S. Murphy K.E. Southan C.D. Ryan D.M. Smith T.S. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell. Neurosci. 1999; 14: 419-427Crossref PubMed Scopus (997) Google Scholar, 9Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3271) Google Scholar, 10Sinha S. Anderson J.P. Barbour R. Basi G.S. Caccavello R. Davis D. Doan M. Dovey H.F. Frigon N. Hong J. Jacobson-Croak K. Jewett N. Keim P. Knops J. Lieberburg I. Power M. Tan H. Tatsuno G. Tung J. Schenk D. Seubert P. Suomensaari S.M. Wang S. Walker D. Zhao J. McConologue L. John V. Nature. 1999; 402: 537-540Crossref PubMed Scopus (1474) Google Scholar, 11Yan R. Bienkowski M.J. Shuck M.E. Miao H. Tory M.C. Pauley A.M. Brashier J.R. Stratman N.C. Mathews W.R. Buhl A.E. Carter D.B. Tomasselli A.G. Parodi L.A. Heinrikson R.L. Gurney M.E. Nature. 1999; 402: 533-537Crossref PubMed Scopus (1329) Google Scholar, 12Lin X. Koelsch G. Wu S. Downs D. Dashti A. Tang J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1456-1460Crossref PubMed Scopus (738) Google Scholar). Bace is a type I integral membrane protein, with a typical aspartyl protease motif in its luminal domain. Bace fulfills most of the requirements expected for a candidate β-secretase. It has broad tissue distribution with higher expression in the brain (8Hussain I. Powell D. Howlett D.R. Tew D.G. Meek T.D. Chapman C. Gloger I.S. Murphy K.E. Southan C.D. Ryan D.M. Smith T.S. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell. Neurosci. 1999; 14: 419-427Crossref PubMed Scopus (997) Google Scholar, 9Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3271) Google Scholar, 10Sinha S. Anderson J.P. Barbour R. Basi G.S. Caccavello R. Davis D. Doan M. Dovey H.F. Frigon N. Hong J. Jacobson-Croak K. Jewett N. Keim P. Knops J. Lieberburg I. Power M. Tan H. Tatsuno G. Tung J. Schenk D. Seubert P. Suomensaari S.M. Wang S. Walker D. Zhao J. McConologue L. John V. Nature. 1999; 402: 537-540Crossref PubMed Scopus (1474) Google Scholar). It localizes mainly in Golgi and endosomes (8Hussain I. Powell D. Howlett D.R. Tew D.G. Meek T.D. Chapman C. Gloger I.S. Murphy K.E. Southan C.D. Ryan D.M. Smith T.S. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell. Neurosci. 1999; 14: 419-427Crossref PubMed Scopus (997) Google Scholar,9Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3271) Google Scholar). Bace overexpression increases, and treatment of cells with antisense oligonucleotides complementary to Bace mRNA decreases β-secretase cleavage of APP (8Hussain I. Powell D. Howlett D.R. Tew D.G. Meek T.D. Chapman C. Gloger I.S. Murphy K.E. Southan C.D. Ryan D.M. Smith T.S. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell. Neurosci. 1999; 14: 419-427Crossref PubMed Scopus (997) Google Scholar, 9Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3271) Google Scholar, 10Sinha S. Anderson J.P. Barbour R. Basi G.S. Caccavello R. Davis D. Doan M. Dovey H.F. Frigon N. Hong J. Jacobson-Croak K. Jewett N. Keim P. Knops J. Lieberburg I. Power M. Tan H. Tatsuno G. Tung J. Schenk D. Seubert P. Suomensaari S.M. Wang S. Walker D. Zhao J. McConologue L. John V. Nature. 1999; 402: 537-540Crossref PubMed Scopus (1474) Google Scholar, 11Yan R. Bienkowski M.J. Shuck M.E. Miao H. Tory M.C. Pauley A.M. Brashier J.R. Stratman N.C. Mathews W.R. Buhl A.E. Carter D.B. Tomasselli A.G. Parodi L.A. Heinrikson R.L. Gurney M.E. Nature. 1999; 402: 533-537Crossref PubMed Scopus (1329) Google Scholar, 12Lin X. Koelsch G. Wu S. Downs D. Dashti A. Tang J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1456-1460Crossref PubMed Scopus (738) Google Scholar). Bace is a transmembrane protein whose predicted topology is correct with respect to the β-secretase cleavage site in APP. It cleaves more efficiently APP carrying the Swedish mutation than wild-type APP (9Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3271) Google Scholar, 10Sinha S. Anderson J.P. Barbour R. Basi G.S. Caccavello R. Davis D. Doan M. Dovey H.F. Frigon N. Hong J. Jacobson-Croak K. Jewett N. Keim P. Knops J. Lieberburg I. Power M. Tan H. Tatsuno G. Tung J. Schenk D. Seubert P. Suomensaari S.M. Wang S. Walker D. Zhao J. McConologue L. John V. Nature. 1999; 402: 537-540Crossref PubMed Scopus (1474) Google Scholar, 11Yan R. Bienkowski M.J. Shuck M.E. Miao H. Tory M.C. Pauley A.M. Brashier J.R. Stratman N.C. Mathews W.R. Buhl A.E. Carter D.B. Tomasselli A.G. Parodi L.A. Heinrikson R.L. Gurney M.E. Nature. 1999; 402: 533-537Crossref PubMed Scopus (1329) Google Scholar, 12Lin X. Koelsch G. Wu S. Downs D. Dashti A. Tang J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1456-1460Crossref PubMed Scopus (738) Google Scholar). The purified enzyme cleaves synthetic APP substrates encompassing the β-secretase site (9Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3271) Google Scholar, 10Sinha S. Anderson J.P. Barbour R. Basi G.S. Caccavello R. Davis D. Doan M. Dovey H.F. Frigon N. Hong J. Jacobson-Croak K. Jewett N. Keim P. Knops J. Lieberburg I. Power M. Tan H. Tatsuno G. Tung J. Schenk D. Seubert P. Suomensaari S.M. Wang S. Walker D. Zhao J. McConologue L. John V. Nature. 1999; 402: 537-540Crossref PubMed Scopus (1474) Google Scholar, 11Yan R. Bienkowski M.J. Shuck M.E. Miao H. Tory M.C. Pauley A.M. Brashier J.R. Stratman N.C. Mathews W.R. Buhl A.E. Carter D.B. Tomasselli A.G. Parodi L.A. Heinrikson R.L. Gurney M.E. Nature. 1999; 402: 533-537Crossref PubMed Scopus (1329) Google Scholar, 12Lin X. Koelsch G. Wu S. Downs D. Dashti A. Tang J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1456-1460Crossref PubMed Scopus (738) Google Scholar). Finally, Bace has an acidic pH optimum and is resistant to the aspartic protease inhibitor pepstatin A (9Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3271) Google Scholar, 10Sinha S. Anderson J.P. Barbour R. Basi G.S. Caccavello R. Davis D. Doan M. Dovey H.F. Frigon N. Hong J. Jacobson-Croak K. Jewett N. Keim P. Knops J. Lieberburg I. Power M. Tan H. Tatsuno G. Tung J. Schenk D. Seubert P. Suomensaari S.M. Wang S. Walker D. Zhao J. McConologue L. John V. Nature. 1999; 402: 537-540Crossref PubMed Scopus (1474) Google Scholar). Although this evidence is impressive, only limited information is available on the cell biology of Bace. Bace is anN-glycosylated transmembrane protein encoded in a 501-amino acid open reading frame, from which the first 21 amino acids correspond to the signal peptide. N-terminal sequencing of Bace purified from human brain revealed that the mature protein starts at glutamic acid 46 (10), indicating that Bace is further processed after its translocation into the endoplasmic reticulum. Other proteases, e.g. proprotein convertases (PCs) and members of the ADAM family, are also synthesized as inactive proenzymes that require the removal of the propeptide to become active (13Seidah N.G. Chretien M. Brain Res. 1999; 848: 45-62Crossref PubMed Scopus (684) Google Scholar). It has recently been shown that pro-Bace is predominantly located in the endoplasmic reticulum and that constitutive propeptide cleavage takes place in the Golgi apparatus C-terminal to the Arg-Leu-Pro-Arg motif (14Haniu M. Denis P. Young Y. Mendiaz E.A. Fuller J. Hui J.O. Bennett B.D. Kahn S. Ross S. Burgess T. Katta V. Rogers G. Vassar R. Citron M. J. Biol. Chem. 2000; 275: 21099-21106Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar, 15Capell A. Steiner H. Willem M. Kaiser H. Meyer C. Walter J. Lammich S. Multhaup G. Haass C. J. Biol. Chem. 2000; 275: 30849-30854Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar), suggestive for the involvement of members of the PC family in this process. PCs are subtilisin-like serine proteases involved in the activation of many neuropeptides, peptide hormones, growth and differentiation factors, membrane-associated receptors, adhesion molecules, blood coagulation factors, plasma proteins, and some pathogenic proteins like viral coat proteins and bacterial toxins (13Seidah N.G. Chretien M. Brain Res. 1999; 848: 45-62Crossref PubMed Scopus (684) Google Scholar, 16Steiner D.F. Curr. Opin. Chem. Biol. 1998; 2: 31-39Crossref PubMed Scopus (578) Google Scholar, 17Nakayama K. Biochem. J. 1997; 327: 625-635Crossref PubMed Scopus (701) Google Scholar). Precursors are usually cleaved C-terminal to basic motifs like Lys/Arg-(X)n-Lys/Arg, where n = 2, 4, or 6 and X is essentially any amino acid but Cys and rarely Pro (13Seidah N.G. Chretien M. Brain Res. 1999; 848: 45-62Crossref PubMed Scopus (684) Google Scholar). Seven members have been thus far isolated as follows: furin, PC1 (also called PC3), PC2, PC4, PC6 (also called PC5), PACE4, and LPC (also called PC7 or PC8). All enzymes have a specific, albeit partially overlapping, expression pattern and similar but not identical substrate specificities. Recently furin was implied in the production of amyloidogenic peptides in familial British dementia (18Kim S.H. Wang R. Gordon D.J. Bass J. Steiner D.F. Lynn D.G. Thinakaran G. Meredith S.C. Sisodia S.S. Nat. Neurosci. 1999; 2: 984-988Crossref PubMed Scopus (128) Google Scholar, 19Vidal R. Frangione B. Rostagno A. Mead S. Revesz T. Plant G. Ghiso J. Nature. 1999; 399: 776-781Crossref PubMed Scopus (372) Google Scholar). This observation stimulated us to ask whether proteases of the PC family could be involved in the regulation of the activity of Bace. Although the answer to this question is important from a cell biological point of view, we obviously also speculated that new insights in the regulation of Bace activity could foster new ideas for therapeutic intervention in AD. We investigate here the posttranslational maturation of Bace in cells in culture, and we demonstrate that mainly furin but, in addition, although to a lesser extent, other PCs like PACE4, LPC, PC6A, and PC6B could cleave the Bace propeptide in vivo, indicating some redundancy in this controlling step. We find also that Bace activity on APP is not significantly affected by the absence of furin or by PC inhibitors, strongly suggesting that pro-Bace can process APP. We conclude that it is unlikely that the proteolytic maturation of pro-Bace is a valid therapeutic target. Two primers were designed based on the sequence of mouse Bace/Asp2 cDNA (GenBankTM accession number AF200346 (11Yan R. Bienkowski M.J. Shuck M.E. Miao H. Tory M.C. Pauley A.M. Brashier J.R. Stratman N.C. Mathews W.R. Buhl A.E. Carter D.B. Tomasselli A.G. Parodi L.A. Heinrikson R.L. Gurney M.E. Nature. 1999; 402: 533-537Crossref PubMed Scopus (1329) Google Scholar)), corresponding to positions 1–23 (5′atggccccagcgctgcactggct3′, sense primer) and 1483–1507 (5′tcacttgagcagggagatgtcatc3′, antisense primer) and used for amplification. The PCR product was cloned into pGEM-T (Promega). This was subsequently used as template to introduce a C-terminal Myc tag in Bace and sBace. The latter encompasses the entire ectodomain of Bace but lacks the transmembrane domain and cytoplasmic tail. The sense primer contained the start codon, preceded by aBam HI restriction site (5′ctcggatccatggccccagcgctgcactgg3′), the antisense primer contained the Myc tag, followed by a stop codon, and an Eco RI restriction site (Bace, 5′ctcgaattctacaagtcctcttcagaaatgagcttttgctccttgagcagggagatgtcatc3′; sBace, 5′ctcgaattcctccaagtcctcttcagaaatgagcttttgctcataggctatggtcataagtg3′). The PCR products were digested with Bam HI andEco RI and cloned in pcDNA3 (Invitrogen). Bace-ALPA and sBace-ALPA, in which the propeptide cleavage site RLPR↓ was mutated into ALPA, were made using QuikChange Site-directed Mutagenesis Kit (Stratagene), according to the suppliers guidelines and using Bace-Myc as template. Note that these constructs also contain the Myc tag. All constructs were verified by sequencing. A polyclonal antibody was raised in New Zealand White rabbits against a synthetic polypeptide (ETDEEPEEPGRRGSFV) corresponding to the region immediately C-terminal to the propeptide, coupled to keyhole limpet hemocyanin. Generation of antibody GM 190, directed against the propeptide of Bace, has been described before (15Capell A. Steiner H. Willem M. Kaiser H. Meyer C. Walter J. Lammich S. Multhaup G. Haass C. J. Biol. Chem. 2000; 275: 30849-30854Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar). Mouse anti-Myc monoclonal antibody clone 9E10 was used to detect the Myc-tagged Bace proteins. All antibodies used for immunodetection of the different members of the proprotein convertase family were obtained from Alexis Biochemicals. The polyclonal antibodies against the APP C terminus and against the ectodomain of APP have been described elsewhere (4De Strooper B. Saftig P. Craessaerts K. Vanderstichele H. Guhde G. Annaert W. Von Figura K. Van Leuven F. Nature. 1998; 391: 387-390Crossref PubMed Scopus (1544) Google Scholar). Monoclonal 4G8 and 6E10 antibodies were raised against Aβ-(17–24) and Aβ-(1–16), respectively, and were obtained from Senetek. Polyclonal rabbit 53/4 specifically recognizes the β-secretase-generated neoepitope and was kindly provided by Dr. Savage, Cephalon (20Thinakaran G. Teplow D.B. Siman R. Greenberg B. Sisodia S.S. J. Biol. Chem. 1996; 271: 9390-9397Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar). Hippocampal neurons were cultured from embryonic day 17 C57 black embryos and co-cultured with a glial feeder layer. At day 15 post-plating, neurons were fixed using 4% paraformaldehyde in 0.1 m phosphate buffer for 30 min at room temperature followed by ice-cold methanol/acetone incubation to permeabilize the cells (36Annaert W.G. Levesque L. Craessaerts K. Dierinck I. Snellings G. Westaway D. St. George-Hyslop P. Cordell B. Fraser P. De Strooper B. J. Cell Biol. 1999; 147: 277-294Crossref PubMed Scopus (276) Google Scholar). After blocking (4 °C, overnight), neurons were incubated with primary antibodies anti-Bace polyclonal and anti-β-COP monoclonal antibody (clone MAD, Sigma) for 2 h at room temperature. For detection, Alexa488 and Alexa546 dyes coupled to secondary antibodies (Molecular Probes) were used (1 h at room temperature). Analysis was done on a NIKON inverted microscope DIAPHOT 300 (PlanApo 60/1.40 oil) connected to a Bio-Rad MRC1024 confocal microscope, and images were captured by Lasersharp (version 3.2) and processed using Adobe Photoshop 5.0 (Adobe, CA). Medium, serum, and supplements used for the maintenance of cells were obtained from Life Technologies, Inc. Chinese hamster ovary (CHO) and the furin-deficient derivative RPE.40 cells (21Spence M.J. Sucic J.F. Foley B.T. Moehring T.J. Somatic Cell Mol. Genet. 1995; 21: 1-18Crossref PubMed Scopus (30) Google Scholar), N2A, and COS cells were maintained in Dulbecco's modified Eagle's medium/F12 (1:1) supplemented with 10% fetal calf serum. 8–10 × 105 cells/10-cm2 culture plate were transfected with 2 μg of DNA and 6 μl of Fugene (Roche Molecular Biochemicals) and were used for experiments the next day (CHO and RPE.40) or after 2 days (N2A and COS cells). Cells (8–10 × 105 cells/10 cm2) were starved for 1 h in methionine-free RPMI 1640 medium and then labeled in the same medium containing 100 μCi/ml [35S]methionine and chased with Dulbecco's modified Eagle's medium/F12 (1:1) for the times indicated in the figure legends. In case of overnight labeling, 5% dialyzed fetal calf serum was added to the labeling medium, and starvation was omitted. For immunoprecipitation of Bace and PCs, cells were lysed in 1 ml of DIPA (50 mm Tris/HCl, pH 7.8, 150 mmNaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS). Immunoprecipitations and endoglycosidase H and F digestions were performed as described (22Creemers J.W. Vey M. Schafer W. Ayoubi T.A. Roebroek A.J. Klenk H.D. Garten W. Van de Ven W.J. J. Biol. Chem. 1995; 270: 2695-2702Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 23van de Loo J.W. Creemers J.W. Bright N.A. Young B.D. Roebroek A.J. Van de Ven W.J. J. Biol. Chem. 1997; 272: 27116-27123Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Immunoprecipitation of Bace and Bace mutants with either anti-Myc 9E10 or anti-Bace antibody gave identical results (data not shown). The figure legends indicated which antibody was used. To study APP processing, cells were cotransfected with plasmids encoding APP, Bace constructs, furin, and PDX as indicated in the figures. Twenty four (for CHO and RPE.40 cells) or 48 h (N2A and COS cells) after transfection, cells were pulse-labeled for 4 h and immediately lysed. APP full-length and C-terminal fragments (CTFs) were immunoprecipitated from the cell extracts, whereas Aβ and total secreted APP (APPs) were immunoprecipitated from the conditioned medium as described (4De Strooper B. Saftig P. Craessaerts K. Vanderstichele H. Guhde G. Annaert W. Von Figura K. Van Leuven F. Nature. 1998; 391: 387-390Crossref PubMed Scopus (1544) Google Scholar, 24De Strooper B. Craessaerts K. Van Leuven F. Van Den Berghe H. J. Biol. Chem. 1995; 270: 30310-30314Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). To discriminate between APPs originating from α- versusβ-cleavage, samples from the conditional medium were resolved by 10% PAGE. Western blotting was subsequently performed with either 6E10 or 53/4 antibodies. Separation of Bace immunoreactive bands in isoelectric focusing was performed essentially as described (25Ploegh H.L. Coligan J.E. Dunn B.M. Ploegh H.L. Speicher D.W. Wingfield P.T. Current Protocols in Protein Science. John Wiley & Sons, Inc., New York1995: 10.2.1-10.2.8Google Scholar). Briefly, a 5% acrylamide (w/v) reducing gel containing 2% Triton X-100, 9.1 m urea, 4% ampholytes, pH 5–7, and 1% ampholytes, pH 3.5–10, was run 13–16 h at a starting voltage of ∼20 V/cm and a limiting voltage of 50 V/cm. Prior to IEF samples were deglycosylated with endoglycosidase F as described above. We used confocal microscopy to study the intracellular localization of Bace in primary cultures of hippocampal neurons (Fig.1). Mouse neurons indeed express Bace, and some overlap in the distribution of Bace and the Golgi marker β-COP is observed. Bace is, however, also present in β-COP negative vesicles, most likely endosomes. Previous studies have addressed the issue of Bace subcellular distribution in non-neuronal cells using Bace overexpressed from transfected cDNA (8Hussain I. Powell D. Howlett D.R. Tew D.G. Meek T.D. Chapman C. Gloger I.S. Murphy K.E. Southan C.D. Ryan D.M. Smith T.S. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell. Neurosci. 1999; 14: 419-427Crossref PubMed Scopus (997) Google Scholar, 9Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3271) Google Scholar, 12Lin X. Koelsch G. Wu S. Downs D. Dashti A. Tang J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1456-1460Crossref PubMed Scopus (738) Google Scholar, 14Haniu M. Denis P. Young Y. Mendiaz E.A. Fuller J. Hui J.O. Bennett B.D. Kahn S. Ross S. Burgess T. Katta V. Rogers G. Vassar R. Citron M. J. Biol. Chem. 2000; 275: 21099-21106Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar, 15Capell A. Steiner H. Willem M. Kaiser H. Meyer C. Walter J. Lammich S. Multhaup G. Haass C. J. Biol. Chem. 2000; 275: 30849-30854Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar). Our data confirm these previous findings at the endogenous levels of expression and indicate that transfected Bace localizes to the relevant subcellular compartments. Since the levels of endogenous expression of Bace are very low (results not shown), further biochemical analysis to characterize the maturation and the activity of Bace was performed in transfected cells. We next cloned and sequenced the cDNA encoding Bace from a brain-specific mouse cDNA library (Stratagene) and confirmed its identity to the sequence published by Yan et al. (11Yan R. Bienkowski M.J. Shuck M.E. Miao H. Tory M.C. Pauley A.M. Brashier J.R. Stratman N.C. Mathews W.R. Buhl A.E. Carter D.B. Tomasselli A.G. Parodi L.A. Heinrikson R.L. Gurney M.E. Nature. 1999; 402: 533-537Crossref PubMed Scopus (1329) Google Scholar). To characterize the biosynthesis and maturation of Bace, pulse-chase experiments were performed. Transiently transfected CHO cells were radiolabeled and chased for various times (Fig. 2 A). Immediately after the pulse labeling, three specific protein bands were observed as follows: a major one migrating with an approximate mass of 65 kDa and two minor ones migrating at 50 and 75 kDa, consistent with previous reports (14Haniu M. Denis P. Young Y. Mendiaz E.A. Fuller J. Hui J.O. Bennett B.D. Kahn S. Ross S. Burgess T. Katta V. Rogers G. Vassar R. Citron M. J. Biol. Chem. 2000; 275: 21099-21106Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar, 15Capell A. Steiner H. Willem M. Kaiser H. Meyer C. Walter J. Lammich S. Multhaup G. Haass C. J. Biol. Chem. 2000; 275: 30849-30854Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar). The 50-kDa protein disappeared during the chase, whereas the amount of 65-kDa protein decreased but remained prominent and the 75-kDa increased during the first 2 h of chase and remained constant afterward. Deglycosylation experiments with endoglycosidase H (Fig. 2 B) demonstrated that the 75-kDa protein but not the 65-kDa protein carries complex-type oligosaccharides. Removing all N-linked sugars using endoglycosidase F resulted in a single band of 50 kDa. This indicates that the three protein species contain the same polypeptide backbone. The 50-kDa protein is therefore the unglycosylated Bace precursor; the 65-kDa protein is Bace containing simple N-linked oligosaccharides; and the 75-kDa species finally is the fully complex glycosylated protein. The large shifts in molecular weight upon glycosylation indicate that the four potential glycosylation sites of Bace are probably all utilized, although some heterogeneity is possible (14Haniu M. Denis P. Young Y. Mendiaz E.A. Fuller J. Hui J.O. Bennett B.D. Kahn S. Ross S. Burgess T. Katta V. Rogers G. Vassar R. Citron M. J. Biol. Chem. 2000; 275: 21099-21106Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar). Analysis of the N terminus of Bace reveals a potential propeptide of 24 amino acids, ending in the sequence Arg-Leu-Pro-Arg45. Basic motifs are often recognized and cleaved by PCs (13Seidah N.G. Chretien M. Brain Res. 1999; 848: 45-62Crossref PubMed Scopus (684) Google Scholar, 16Steiner D.F. Curr. Opin. Chem. Biol. 1998; 2: 31-39Crossref PubMed Scopus (578) Google Scholar, 17Nakayama K. Biochem. J. 1997; 327: 625-635Crossref PubMed Scopus (701) Google Scholar). Since Bace purified from human brain or transfected cells starts at Glu46 (9Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3271) Google Scholar, 10Sinha S. Anderson J.P. Barbour R. Basi G.S. Caccavello R. Davis D. Doan M. Dovey H.F. Frigon N. Hong J. Jacobson-Croak K. Jewett N. Keim P. Knops J. Lieberburg I. Power M. Tan H. Tatsuno G. Tung J. Schenk D. Seubert P. Suomensaari S.M." @default.
• W2029214965 created "2016-06-24" @default.
• W2029214965 creator A5008503396 @default.
• W2029214965 creator A5014570685 @default.
• W2029214965 creator A5021772353 @default.
• W2029214965 creator A5023258601 @default.
• W2029214965 creator A5034130805 @default.
• W2029214965 creator A5055180342 @default.
• W2029214965 creator A5067340716 @default.
• W2029214965 creator A5082687728 @default.
• W2029214965 creator A5089667935 @default.
• W2029214965 date "2001-02-01" @default.
• W2029214965 modified "2023-10-13" @default.
• W2029214965 title "Processing of β-Secretase by Furin and Other Members of the Proprotein Convertase Family" @default.
• W2029214965 cites W1480987708 @default.
• W2029214965 cites W1510308646 @default.
• W2029214965 cites W1510793409 @default.
• W2029214965 cites W1534001036 @default.
• W2029214965 cites W1536159446 @default.
• W2029214965 cites W1554824558 @default.
• W2029214965 cites W1644122431 @default.
• W2029214965 cites W1645365656 @default.
• W2029214965 cites W1655404681 @default.
• W2029214965 cites W1885047062 @default.
• W2029214965 cites W1967684462 @default.
• W2029214965 cites W1979773315 @default.
• W2029214965 cites W1985325561 @default.
• W2029214965 cites W1985487147 @default.
• W2029214965 cites W1987452659 @default.
• W2029214965 cites W2004593684 @default.
• W2029214965 cites W2009389965 @default.
• W2029214965 cites W2022527113 @default.
• W2029214965 cites W2026053103 @default.
• W2029214965 cites W2031183392 @default.
• W2029214965 cites W2032920422 @default.
• W2029214965 cites W2046820814 @default.
• W2029214965 cites W2046847750 @default.
• W2029214965 cites W2062283435 @default.
• W2029214965 cites W2062808764 @default.
• W2029214965 cites W2079651671 @default.
• W2029214965 cites W2081678091 @default.
• W2029214965 cites W2094076838 @default.
• W2029214965 cites W2095710744 @default.
• W2029214965 cites W2130082245 @default.
• W2029214965 cites W2133019124 @default.
• W2029214965 cites W2149579301 @default.
• W2029214965 cites W2154375856 @default.
• W2029214965 cites W2162815565 @default.
• W2029214965 cites W2171607869 @default.
• W2029214965 cites W2775777157 @default.
• W2029214965 doi "https://doi.org/10.1074/jbc.m006947200" @default.
• W2029214965 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11071887" @default.
• W2029214965 hasPublicationYear "2001" @default.
• W2029214965 type Work @default.
• W2029214965 sameAs 2029214965 @default.
• W2029214965 citedByCount "178" @default.
• W2029214965 countsByYear W20292149652012 @default.
• W2029214965 countsByYear W20292149652013 @default.
• W2029214965 countsByYear W20292149652014 @default.
• W2029214965 countsByYear W20292149652015 @default.
• W2029214965 countsByYear W20292149652016 @default.
• W2029214965 countsByYear W20292149652017 @default.
• W2029214965 countsByYear W20292149652018 @default.
• W2029214965 countsByYear W20292149652019 @default.
• W2029214965 countsByYear W20292149652020 @default.
• W2029214965 countsByYear W20292149652021 @default.
• W2029214965 countsByYear W20292149652022 @default.
• W2029214965 crossrefType "journal-article" @default.
• W2029214965 hasAuthorship W2029214965A5008503396 @default.
• W2029214965 hasAuthorship W2029214965A5014570685 @default.
• W2029214965 hasAuthorship W2029214965A5021772353 @default.
• W2029214965 hasAuthorship W2029214965A5023258601 @default.
• W2029214965 hasAuthorship W2029214965A5034130805 @default.
• W2029214965 hasAuthorship W2029214965A5055180342 @default.
• W2029214965 hasAuthorship W2029214965A5067340716 @default.
• W2029214965 hasAuthorship W2029214965A5082687728 @default.
• W2029214965 hasAuthorship W2029214965A5089667935 @default.
• W2029214965 hasBestOaLocation W20292149651 @default.
• W2029214965 hasConcept C181199279 @default.
• W2029214965 hasConcept C185592680 @default.
• W2029214965 hasConcept C2777265534 @default.
• W2029214965 hasConcept C2778163477 @default.
• W2029214965 hasConcept C2778824825 @default.
• W2029214965 hasConcept C2778849439 @default.
• W2029214965 hasConcept C2780072125 @default.
• W2029214965 hasConcept C2780948078 @default.
• W2029214965 hasConcept C2908627167 @default.
• W2029214965 hasConcept C43554185 @default.
• W2029214965 hasConcept C55493867 @default.
• W2029214965 hasConcept C86803240 @default.
• W2029214965 hasConceptScore W2029214965C181199279 @default.
• W2029214965 hasConceptScore W2029214965C185592680 @default.
• W2029214965 hasConceptScore W2029214965C2777265534 @default.
• W2029214965 hasConceptScore W2029214965C2778163477 @default.
• W2029214965 hasConceptScore W2029214965C2778824825 @default.
• W2029214965 hasConceptScore W2029214965C2778849439 @default.
• W2029214965 hasConceptScore W2029214965C2780072125 @default.
• W2029214965 hasConceptScore W2029214965C2780948078 @default.

• next