FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2029605380> ?p ?o ?g. }

• W2029605380 endingPage "24658" @default.
• W2029605380 startingPage "24649" @default.
• W2029605380 abstract "Imbalance between pro- and antioxidant mechanisms in the lungs can compromise pulmonary functions, including blood oxygenation, host defense, and maintenance of an anti-inflammatory environment. Thus, tight regulatory control of reactive oxygen species is critical for proper lung function. Increasing evidence supports a role for the NADPH oxidase dual oxidase (Duox) as an important source for regulated H2O2 production in the respiratory tract epithelium. In this study Duox expression, function, and regulation were investigated in a fully differentiated, mucociliary airway epithelium model. Duox-mediated H2O2 generation was dependent on calcium flux, which was required for dissociation of the NADPH oxidase regulatory protein Noxa1 from plasma membrane-bound Duox. A functional Duox1-based oxidase was reconstituted in model cell lines to permit mutational analysis of Noxa1 and Duox1. Although the activation domain of Noxa1 was not required for Duox function, mutation of a proline-rich domain in the Duox C terminus, a potential interaction motif for the Noxa1 Src homology domain 3, caused up-regulation of basal and stimulated H2O2 production. Similarly, knockdown of Noxa1 in airway cells increased basal H2O2 generation. Our data indicate a novel, inhibitory function for Noxa1 in Duox regulation. This represents a new paradigm for control of NADPH oxidase activity, where second messenger-promoted conformational change of the Nox structure promotes oxidase activation by relieving constraint induced by regulatory components. Imbalance between pro- and antioxidant mechanisms in the lungs can compromise pulmonary functions, including blood oxygenation, host defense, and maintenance of an anti-inflammatory environment. Thus, tight regulatory control of reactive oxygen species is critical for proper lung function. Increasing evidence supports a role for the NADPH oxidase dual oxidase (Duox) as an important source for regulated H2O2 production in the respiratory tract epithelium. In this study Duox expression, function, and regulation were investigated in a fully differentiated, mucociliary airway epithelium model. Duox-mediated H2O2 generation was dependent on calcium flux, which was required for dissociation of the NADPH oxidase regulatory protein Noxa1 from plasma membrane-bound Duox. A functional Duox1-based oxidase was reconstituted in model cell lines to permit mutational analysis of Noxa1 and Duox1. Although the activation domain of Noxa1 was not required for Duox function, mutation of a proline-rich domain in the Duox C terminus, a potential interaction motif for the Noxa1 Src homology domain 3, caused up-regulation of basal and stimulated H2O2 production. Similarly, knockdown of Noxa1 in airway cells increased basal H2O2 generation. Our data indicate a novel, inhibitory function for Noxa1 in Duox regulation. This represents a new paradigm for control of NADPH oxidase activity, where second messenger-promoted conformational change of the Nox structure promotes oxidase activation by relieving constraint induced by regulatory components. Inflammatory conditions often give rise to the generation of reactive oxygen species (ROS) 2The abbreviations used are:ROSreactive oxygen speciesDuoxdual oxidaseALIair-liquid interfaceSAECsmall airway epithelial cellssiRNAsmall interfering RNARNAiRNA interferenceHVAhomovanillic acidDPIdiphenylene iodoniumPIPES1,4-piperazinediethanesulfonic acidHVAhomovanillic acidRTreverse transcriptionBAPTA/AM1,2-bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid tetrakis(acetoxymethyl ester)GSTglutathione S-transferasehhumanSHSrc homology. and reactive nitrogen species, and many lung pathologies are linked to an imbalance in redox regulation of the airway. Pulmonary oxidant stress is associated with disease states, including acute respiratory distress syndrome, hyperoxia, ischemia-reperfusion, sepsis, chronic obstructive pulmonary disease, and asthma. On the other hand, ROS are important second messengers in various biological processes such as cellular signaling, cell proliferation, and apoptosis (1Burdon R.H. Free Radic. Biol. Med. 1995; 18: 775-794Crossref PubMed Scopus (1067) Google Scholar) and play a pivotal role in host defense against microbial infection (2Babior B.M. Blood. 1999; 93: 1464-1476Crossref PubMed Google Scholar, 3Moskwa P. Lorentzen D. Excoffon K.J. Zabner J. McCray Jr., P.B. Nauseef W.M. Dupuy C. Banfi B. Am. J. Respir. Crit. Care Med. 2007; 175: 174-183Crossref PubMed Scopus (239) Google Scholar). In phagocytic cells, the Nox2 (gp91phox)-based NADPH oxidase constitutes the main source for ROS generation in response to pathogens. This oxidase consists of at least six components as follows: Nox2, p22phox, p67phox, p47phox, p40phox, and the GTPase Rac. In resting cells, p67phox, p47phox, and p40phox exist in the cytosol as a complex, whereas p22phox and Nox2 form the heterodimer cytochrome b558, which is located in the plasma membrane (4Babior B.M. Curr. Opin. Hematol. 1995; 2: 55-60Crossref PubMed Scopus (123) Google Scholar). Upon activation, multiple phosphorylations and conformational changes occur, permitting translocation of the cytosolic proteins and association with the Nox2-p22phox complex. This active oxidase complex then catalyzes the one-electron reduction of oxygen to O2- at the expense of NADPH (5Yu L. Quinn M.T. Cross A.R. Dinauer M.C. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 7993-7998Crossref PubMed Scopus (178) Google Scholar). reactive oxygen species dual oxidase air-liquid interface small airway epithelial cells small interfering RNA RNA interference homovanillic acid diphenylene iodonium 1,4-piperazinediethanesulfonic acid homovanillic acid reverse transcription 1,2-bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid tetrakis(acetoxymethyl ester) glutathione S-transferase human Src homology. Nonphagocytic cells can also produce ROS, albeit usually at much lower levels when compared with the output of the phagocyte oxidase (6Cross A.R. Jones O.T. Biochim. Biophys. Acta. 1991; 1057: 281-298Crossref PubMed Scopus (454) Google Scholar, 7Finkel T. J. Leukocyte Biol. 1999; 65: 337-340Crossref PubMed Scopus (237) Google Scholar). Many different ROS sources are implicated in these cell types, including the mitochondrial electron transport chain and NADPH oxidases (Nox). Six Nox homologs with restricted tissue expression profiles have been identified. The Nox family is now comprised of Nox1–4, whose features resemble the phagocyte gp91phox (now Nox2), and Nox5, which possesses four EF hands. The additional members, Duox1 and Duox2, are characterized by an N-terminal extracellular peroxidase homology domain, followed by a transmembrane segment and an EF hand-containing cytosolic region, which connects to a Nox2 homology structure. Unlike their Nox homologs, mature Duox enzymes release hydrogen peroxide (H2O2) without forming a detectable amount of superoxide. This distinct feature of Duox may be caused by the rapid conversion of superoxide via intramolecular dismutation (8Ameziane-El-Hassani R. Morand S. Boucher J.L. Frapart Y.M. Apostolou D. Agnandji D. Gnidehou S. Ohayon R. Noel-Hudson M.S. Francon J. Lalaoui K. Virion A. Dupuy C. J. Biol. Chem. 2005; 280: 30046-30054Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar). In mammals, Duox1 and Duox2 were first characterized in the thyroid as essential H2O2-generating enzymes (9Dupuy C. Ohayon R. Valent A. Noel-Hudson M.S. Deme D. Virion A. J. Biol. Chem. 1999; 274: 37265-37269Abstract Full Text Full Text PDF PubMed Scopus (376) Google Scholar, 10De Deken X. Wang D. Many M.C. Costagliola S. Libert F. Vassart G. Dumont J.E. Miot F. J. Biol. Chem. 2000; 275: 23227-23233Abstract Full Text Full Text PDF PubMed Scopus (499) Google Scholar). At the apical surface of the thyrocytes, H2O2 is the final electron acceptor for the thyroperoxidase-catalyzed biosynthesis of thyroid hormone (11De Deken X. Wang D. Dumont J.E. Miot F. Exp. Cell Res. 2002; 273: 187-196Crossref PubMed Scopus (157) Google Scholar). The critical role of Duox in thyroid hormone synthesis has been confirmed by the development of congenital hypothyroidism in patients with inactivating Duox2 mutations (12Moreno J.C. Bikker H. Kempers M.J. van Trotsenburg A.S. Baas F. de Vijlder J.J. Vulsma T. Ris-Stalpers C. N. Engl. J. Med. 2002; 347: 95-102Crossref PubMed Scopus (394) Google Scholar, 13Vigone M.C. Fugazzola L. Zamproni I. Passoni A. Di Candia S. Chiumello G. Persani L. Weber G. Hum. Mutat. 2005; 26: 395Crossref PubMed Scopus (101) Google Scholar). Duox is also highly expressed in the respiratory tract, in epithelial cells of exocrine glands, and in the mucosa (8Ameziane-El-Hassani R. Morand S. Boucher J.L. Frapart Y.M. Apostolou D. Agnandji D. Gnidehou S. Ohayon R. Noel-Hudson M.S. Francon J. Lalaoui K. Virion A. Dupuy C. J. Biol. Chem. 2005; 280: 30046-30054Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 14El Hassani R.A. Benfares N. Caillou B. Talbot M. Sabourin J.C. Belotte V. Morand S. Gnidehou S. Agnandji D. Ohayon R. Kaniewski J. Noel-Hudson M.S. Bidart J.M. Schlumberger M. Virion A. Dupuy C. Am. J. Physiol. 2005; 288: G933-G942Crossref PubMed Scopus (191) Google Scholar). A contribution of Duox to the host innate immune response was recently suggested in Drosophila melanogaster and by in vitro studies, where H2O2 generated by Duox might be used by lactoperoxidase to oxidize thiocyanate anions present in the air-surface liquid to antimicrobial hypothiocyanite (3Moskwa P. Lorentzen D. Excoffon K.J. Zabner J. McCray Jr., P.B. Nauseef W.M. Dupuy C. Banfi B. Am. J. Respir. Crit. Care Med. 2007; 175: 174-183Crossref PubMed Scopus (239) Google Scholar, 15Ward C. Murray J. Clugston A. Dransfield I. Haslett C. Rossi A.G. Eur. J. Immunol. 2005; 35: 2728-2737Crossref PubMed Scopus (45) Google Scholar, 16Geiszt M. Witta J. Baffi J. Lekstrom K. Leto T.L. FASEB J. 2003; 17: 1502-1504Crossref PubMed Scopus (418) Google Scholar, 17Forteza R. Salathe M. Miot F. Forteza R. Conner G.E. Am. J. Respir. Cell Mol. Biol. 2005; 32: 462-469Crossref PubMed Scopus (199) Google Scholar). However, persistently elevated ROS can exert deleterious effects as observed in various airway diseases (18MacNee W. Eur. J. Pharmacol. 2001; 429: 195-207Crossref PubMed Scopus (457) Google Scholar), indicating that ROS production has to be tightly regulated to ensure its targeted and limited generation. The activation of Nox2, Nox1, and Nox3 relies on regulatory proteins such as the GTPase Rac and the proteins p47phox, p67phox, and their homologs Noxo1 and Noxa1, respectively (19Geiszt M. Lekstrom K. Witta J. Leto T.L. J. Biol. Chem. 2003; 278: 20006-20012Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar, 20Banfi B. Clark R.A. Steger K. Krause K.H. J. Biol. Chem. 2003; 278: 3510-3513Abstract Full Text Full Text PDF PubMed Scopus (405) Google Scholar, 21Takeya R. Ueno N. Kami K. Taura M. Kohjima M. Izaki T. Nunoi H. Sumimoto H. J. Biol. Chem. 2003; 278: 25234-25246Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar, 22Cheng G. Lambeth J.D. J. Biol. Chem. 2004; 279: 4737-4742Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar, 23Ueyama T. Geiszt M. Leto T.L. Mol. Cell. Biol. 2006; 26: 2160-2174Crossref PubMed Scopus (191) Google Scholar, 24Cheng G. Diebold B.A. Hughes Y. Lambeth J.D. J. Biol. Chem. 2006; 281: 17718-17726Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar). Noxa1 and p67phox serve as activating regulatory components in Nox1- and Nox2-mediated superoxide generation (19Geiszt M. Lekstrom K. Witta J. Leto T.L. J. Biol. Chem. 2003; 278: 20006-20012Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar, 20Banfi B. Clark R.A. Steger K. Krause K.H. J. Biol. Chem. 2003; 278: 3510-3513Abstract Full Text Full Text PDF PubMed Scopus (405) Google Scholar, 21Takeya R. Ueno N. Kami K. Taura M. Kohjima M. Izaki T. Nunoi H. Sumimoto H. J. Biol. Chem. 2003; 278: 25234-25246Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar). Of importance is their activation domain that is located adjacent to the GTP-Rac-binding tetratrico-peptide repeat domain. Introducing an alanine for valine in position 204 of the p67phox activation domain renders the Nox2-based NADPH oxidase inactive (25Han C.H. Freeman J.L. Lee T. Motalebi S.A. Lambeth J.D. J. Biol. Chem. 1998; 273: 16663-16668Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar, 26Nisimoto Y. Motalebi S. Han C.H. Lambeth J.D. J. Biol. Chem. 1999; 274: 22999-23005Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). A similar change in Noxa1 inhibits superoxide production by Nox1. Little is known about the regulation of Duox enzymes in the lung. Although ROS production by Duox is dependent on calcium flux and seems not to require Rac, more in-depth analysis of Duox regulation has not been performed. We decided to investigate the molecular mechanisms regulating Duox in the context of primary human airway epithelial cells. Characterization of ROS generation in a pseudostratified mucociliary epithelial model indicates an important role for Duox as apical H2O2 source. We present evidence of a functional interaction between membrane-localized Duox and Noxa1, which is disrupted in the presence of calcium. Our data suggest that Noxa1 plays a vital role in stabilizing the inactive state of Duox in resting cells, possibly to prevent Duox-mediated ROS generation by transient, low level calcium flux. Antibodies and Plasmids—Polyclonal antibodies directed against c-Myc (A-14) and anti-RhoGDI (A-20) were from Santa Cruz Biotechnology, and actin (A2066) was from Sigma. The expression plasmid for hDuox1 in pcDNA3.1 was kindly provided by F. Miot and subcloned into pGEX-2T. A point mutation, Duox1 (P1497A), was prepared by QuikChange® site-directed mutagenesis kit (Agilent-Stratagene) and verified by sequencing. The full coding sequence of hDuoxA1 was amplified by PCR with Platinum® Pfx (Invitrogen) using total RNA of small airway epithelial cells and specific primers (GenBank™ accession number DQ489735). DuoxA1 was cloned into pcDNA3.1. after adding in-frame a 3′ Myc tag. The expression plasmid for hNoxa1 in pRK5Myc was kindly provided by T. Leto. The Noxa1(V205A) and Noxa1(W436R) mutations were prepared by QuikChange® site-directed mutagenesis kit (Agilent-Stratagene) and verified by sequencing. Duox1 calcium-binding domain (amino acids 775–1026, GST-Duox1-Δ1), Duox1 C-terminal wild type (amino acids 1270–1551, GST-Duox1-Δ2) or mutated GST-Duox1M-Δ2 P1497A), the Nox2 C terminus (amino acids 290–570, GST-Nox2-Δ), or the Nox1 C terminus (amino acids 290–565, GST-Nox1-Δ) and full-length Noxa1 were inserted into pGEX-4T-3 (GE Healthcare). Proteins were expressed and affinity-purified according to standard protocols. Recombinant Noxa1 was purified after thrombin cleavage to remove the GST moiety, assessed for purity and identity by Coomassie Blue staining, and immunoblotting. Purified GST-Duox-Δ1 and Noxa1 proteins were used for polyclonal antibody generation. Antibody specificity controls were performed (supplemental Fig. 2, A and B). The Duox antibody detects Duox1 and Duox2 at 180 kDa. Cell Culture—Small airway epithelial cells (SAEC) were purchased from Lonza (Walkersville, MD) and used at culture passages 3–4. Cells were grown in serum-free medium (SABM, Lonza) supplemented with SAGM SingleQuots (Lonza) at 37 °C in a humidified 5% CO2 incubator. For the differentiated lung epithelial model (three-dimensional), cells were detached with trypsin and seeded onto inserts (Costar Transwell-clear culture insert, 0.4 μm pore; Corning Costar) coated with human placenta collagen type VI (15 μg/cm2; Sigma). Airway epithelial cells in three dimensions were grown in serum-free culture medium (50% SABM, 50% Dulbecco's modified Eagle's medium high glucose) supplemented with defined growth factors in the SingleQuots and 20–50 nm retinoic acid, prepared freshly to induce differentiation. After 2–4 days in immersed culture conditions, cell culture was switched to an air-liquid interface system for 3 weeks. Differentiation was assessed by MUC5AC expression, mucin production, resistance, and permeability measurement and electron microscopy. NCI-H292, A549, HEK293, HeLa, and H661 cells were cultured in the appropriate media. Cells were preincubated with DPI (25 μm) or BAPTA/AM (0–0.75 μm; BD Biosciences) for 10 and 5 min, respectively, before exposure to stimuli. Cells were treated with ionomycin (2–3 μm, Sigma) for 30–60 min. Expression Analysis of Nox/Duox and NADPH Oxidase Components—Total RNA was extracted from NCI-H292 cells, A549 cells, or SAEC cells grown in monolayer or on inserts by using RNAzol B reagent (TelTest, Inc.) according to the manufacturer's protocol. Amplification by reverse transcription (RT)-PCR was performed. Briefly, cDNA was generated from 1 to 2 μg of extracted total RNA using Superscript II RNase H reverse transcriptase and oligo(dT) primers (Invitrogen) according to the supplier's protocol. cDNAs were amplified by standard PCR using TaqDNA polymerase (Invitrogen), except for Noxa1 and Noxo1 PCR, which were performed with the Advantage-GC 2 PCR kit (BD Biosciences). Sense and antisense primers were designed based on human sequences published in GenBank™. The primers used were as follows: 5′-CCATCGACTACACGCAGCTG-3′ (forward primer) and 5′-GTAGGCAGTCGACGTGCAGC-3′ (reverse primer) for Noxa1 cDNA; 5′-GCAGGACATCAACCCTGCACTCTC-3′ (forward primer) and 5′-CTGCCATCTACCACACGGATCTGC-3′ (reverse primer) for Duox1 cDNA; 5′-ATGTTCTTTCCGACGTGGTGAGCGTGGA-3′ (forward primer) and 5′-CGAATCCAGTAGTTGTTGCAGACCCTGAGA-3′ (reverse primer) for Duox2 cDNA; 5′-GCAGTTTAAGACCATTGCAGG-3′ (forward primer) and 5′-GTCAGGTTCTCCATGACTCCG-3′ (reverse primer) for Nox5 long form cDNA; 5′-CAATCCCTGTGCTCCTGC-3′ (forward primer) and 5′-GTCTGACGTTTCCAACACGC-3′ (reverse primer) for Noxo1 cDNA; and 5′-CGGGATTCACAATGGGAAACTGGGTGG-3′ (forward primer) and 5′-CAAGATAGAAGCAAAGGGGGTGAC-3′ (reverse primer) for Nox1 cDNA. RT-PCR products were resolved by electrophoresis on ethidium bromide-stained agarose gels and visualized by UV. Small Interfering RNA (siRNA) Treatment—Double strand siRNA targeting hDuox was designed with BLOCK-it RNAi Designer (Invitrogen) to target both Duox1 and Duox2 (GenBank™ accession numbers AF213465 and AF267981, respectively). Predesigned hNoxa1 siRNA sets (NOXA1HSS145807, NOXA1HSS145808, and NOXA1HSS145809) were purchased from Invitrogen. The sequences of Duox siRNA 1 were (sense) GGACAAGGAGGAACUGACAUGGGAA and (antisense) UUCCCAUGUCAGUUCCUCCUU GUCC, and the sequences of Duox siRNA 2 were (sense) GCAUAAGUUUGAGGUGUCAGUGUUA and (antisense) UAACACUGACACCUCAAACUUAUGC. Silencer Negative Control siRNA GC medium (Invitrogen) was used as control siRNA. siRNA transfection into cells was carried out by using Lipofectamine 2000. To optimize conditions, different concentrations of siRNA (1–100 nm) and various duration of RNAi treatment were applied. Two separate transfections of the same cell population with siRNA were performed before ROS generation was measured. Measurement of H2O2 Release—H2O2 generation was determined by measuring the oxidation of homovanillic acid (HVA) into its fluorescent derivative in the presence of horseradish peroxidase as described previously (27Martyn K.D. Frederick L.M. von Loehneysen K. Dinauer M.C. Knaus U.G. Cell. Signal. 2006; 18: 69-82Crossref PubMed Scopus (622) Google Scholar). The activity is expressed in fluorescent units or quantified using a standard curve obtained by incubating increasing amounts of H2O2 (0–25 μm) in HVA solution. In parallel, cells were scraped and lysed in RIPA buffer, and the protein concentration was determined using the BCA protein assay kit (28Dinauer M.C. Pierce E.A. Bruns G.A. Curnutte J.T. Orkin S.H. J. Clin. Invest. 1990; 86: 1729-1737Crossref PubMed Scopus (267) Google Scholar). H2O2 generation was then normalized to the protein concentration. The calcium dependence of H2O2 production was determined by assaying cells in parallel in HVA solution prepared with calcium-free phosphate-buffered saline or by preincubating cells with BAPTA/AM as described above. Western Blot Analysis and Co-immunoprecipitation—Protein extracts in Laemmli buffer (2% SDS, 100 mm dithiothreitol) were homogenized by repeatedly passing through a 0.24-mm gauge syringe to obtain total lysate. Protein samples were heated 5 min at 65 °C for Duox detection and subjected to SDS-PAGE followed by transfer to nitrocellulose membrane. Blots were blocked in TBS containing 5% fat-free dry milk and 0.1% Tween before incubation with primary antibodies and secondary horseradish peroxidase-coupled antibodies. Detection was achieved by ECL (Pierce). A nondenaturing lysis buffer (50 mm Tris-HCl, 150 mm NaCl, 2% Triton X-100, 5 mm EGTA, and inhibitors mixture set I and II (Sigma), pH 7.4) was used for immunoprecipitation experiments. After preclearing, the extracts were immunoprecipitated with Noxa1 antibody and then bound to a mix of 50% protein A- and G-Sepharose. The immunoprecipitates were collected by centrifugation and analyzed by SDS-PAGE and Western blotting as described above. The effect of calcium on complex formation between Duox and Noxa1 was analyzed by adding water or calcium chloride (5 and 10 mm) to lysates (prepared with 5 mm EGTA-containing lysis buffer, see above) and split into equal aliquots before addition. Free final calcium concentration in the experiment was estimated to be 0.3–1 μm. Immunofluorescence—SAEC, NCI-292, and A459 cells were seeded on a glass coverslips coated with human placenta collagen type VI (10 μg/ml), HEK293, and HeLa cells on polylysine or fibronectin. At 60% confluence or after transfection (siRNA or overexpression), the cells were fixed with 4% paraformaldehyde for 10 min. After permeabilization with 0.5% Triton X-100 and blocking with 5% bovine serum albumin in phosphate-buffered saline, coverslips were incubated for 2 h at room temperature with either anti-Duox or anti-Noxa1 antibody in 2% bovine serum albumin/phosphate-buffered saline. Rabbit preimmune sera were used to verify the specificity of the staining. The secondary antibodies were anti-rabbit IgG conjugated with Alexa Fluor 488 or 568 (Invitrogen). Coverslips were mounted and examined with indirect immunofluorescence (Olympus IX70) and confocal microscopy (×6, MRC 2100; Bio-Rad). All images are representative of several independent experiments recording multiple cells in different sections of the coverslip. Cell Fractionation—With or without stimulation, cells were harvested and resuspended in relaxation buffer (KCl 100 mm, NaCl 3 mm, MgCl2 3.5 mm, EGTA 1 mm, Hepes 10 mm, PIPES 0.5 mm, pH 7.4). The cells were then disrupted by two 15-s cycles of sonication at 4 °C using a microprobe sonicator (Microson XL). Unbroken cells and nuclei were pelleted by centrifugation at 600 × g for 10 min at 4 °C. The supernatant (S1) was then centrifuged at 100,000 × g for 30 min at 4 °C in an Optima TLX ultracentrifuge with a TLA 100.3 rotor (Beckman Instruments Inc., Palo Alto, CA). The high speed supernatant (S2) represented the soluble cytosolic fraction. The pellet (P2) was resuspended in relaxation buffer with vigorous mixing, and this sample was again centrifuged for 15 min at 100,000 × g at 4 °C. The final supernatant (S3) represented a wash fraction. The final pellet (P3), representing the membrane fraction, was resuspended in relaxation buffer. An equivalent of 100–200 μg of protein was resolved by gel electrophoresis, and the membranes were probes for Noxa1, Duox, actin, RhoGDI, HSP72, or epidermal growth factor receptor. Pulldown Assay—Recombinant GST, GST-Duox1-Δ1, GST-Duox1-Δ2, GST-Duox1M-Δ2, GST-Nox1-Δ, and GST-Nox2-Δ bound to Sepharose beads were incubated with purified, recombinant Noxa1 for 3 h at 4 °C. The beads were pelleted and washed three times with phosphate-buffered saline. Proteins were resuspended in Laemmli buffer and boiled 5 min to elute proteins from the beads. The amount of Noxa1 and GST fusion proteins contained in the eluates was evaluated by electrophoresis using anti-Noxa1 and anti-GST antibodies and quantified by densitometry performed with ImageJ software. The quantity of Noxa1 bound to the different GST-coupled peptide fragments was normalized by the ratio Noxa1/GST density versus the background represented by GST beads alone using values from four different experiments. For GST-Nox1-Δ and GST-Duox1M-Δ2, two experiments were performed. Transfection—HEK293 cells were seeded in 6-well plates for 24 h prior to transfection, which was performed using Lipofectamine 2000 according to the manufacturer's protocol. In studies expressing mutant proteins, equal amounts of mutant plasmid were used in place of wild type plasmid. Twenty four hours after transfection, HEK293 cells were assayed for ROS release (with or without ionomycin stimulation) using the HVA assay, as described above. Statistical Analysis—Experiments were evaluated with the Student's t test. p < 0.05 was considered statistically significant. The symbol * indicates a value of p < 0.05; ** indicates p < 0.01, and *** indicates p < 0.001. Expression of Oxidase Components in Human Airway Epithelial Cells—Several NADPH oxidases have been implicated in ROS production in the airways. The calcium-activated oxidases Duox1 and Duox2 were linked to H2O2 generation in lung epithelial cells (16Geiszt M. Witta J. Baffi J. Lekstrom K. Leto T.L. FASEB J. 2003; 17: 1502-1504Crossref PubMed Scopus (418) Google Scholar, 17Forteza R. Salathe M. Miot F. Forteza R. Conner G.E. Am. J. Respir. Cell Mol. Biol. 2005; 32: 462-469Crossref PubMed Scopus (199) Google Scholar). Other reports connected the Nox1/Noxo1 system as well as Nox3 to tumor necrosis factor receptor or Toll-like receptor4 signaling in ROS-mediated lung alterations (29Pantano C. Anathy V. Ranjan P. Heintz N.H. Janssen-Heininger Y.M. Am. J. Respir. Cell Mol. Biol. 2007; 36: 473-479Crossref PubMed Scopus (32) Google Scholar, 30Meng Q.R. Gideon K.M. Harbo S.J. Renne R.A. Lee M.K. Brys A.M. Jones R. Inhal. Toxicol. 2006; 18: 555-568Crossref PubMed Scopus (54) Google Scholar, 31Zhang X. Shan P. Jiang G. Cohn L. Lee P.J. J. Clin. Invest. 2006; 116: 3050-3059Crossref PubMed Scopus (192) Google Scholar). RT-PCR and immunoblotting were performed to assess expression of NADPH oxidases and oxidase-regulatory components in primary human small airway cells (SAEC) and in the lung cancer cell lines NCI-H292 and A549. Duox1 and Duox2 message and protein were expressed in SAEC and NCI-H292 cells, whereas A549 cells showed faint transcripts for Duox2 only, and expressed no detectable Duox protein by immunoblot analysis. SAEC cell lysates showed a 180-kDa band representing mature Duox (Fig. 1A, see also Fig. 1C) together with a sporadic appearance of an unidentified, faster migrating band that disappeared upon airway cell differentiation and upon Duox RNAi. Comparison of SAEC cells cultured in monolayer versus air-liquid interface (ALI) conditions on inserts (three-dimensional SAEC) indicated a 5–10-fold increase in Duox expression after differentiation (Fig. 1A). This result correlates well with the initial suggestion by Geiszt and co-workers (16Geiszt M. Witta J. Baffi J. Lekstrom K. Leto T.L. FASEB J. 2003; 17: 1502-1504Crossref PubMed Scopus (418) Google Scholar) that Duox expression increases with cell differentiation. Other oxidases or certain oxidase regulatory components were absent from the cell types used in this study (supplemental Fig. 1A and data not shown). Duox-mediated ROS Generation—As a physiological stimulus for Duox activation remains unidentified, the Ca2+ ionophore ionomycin was added to SAEC or NCI-H292 cells for 30–60 min to stimulate calcium influx. In resting conditions H2O2 release was not detected, whereas exposure to ionomycin led to substantial H2O2 production. Duox expression levels correlated with the extent of H2O2 production, with ∼5-fold higher ROS production in differentiated SAEC (three-dimensional SAEC) than in SAEC cultured in monolayer (Fig. 1B). ATP and thapsigargin, two other stimuli known to increase calcium availability in cells, also led to a substantial increase in H2O2 generation in differentiated SAEC (data not shown). Similar results were obtained with Duox-expressing primary human bronchial epithelial cells and an immortalized SAEC cell line (data not shown). By using ALI-cultured SAEC, the location of Duox-mediated H2O2 production was probed by treatment of the upper and lower chamber of the inserts with ionomycin. H2O2 production was only detected on the apical side of ionomycin-stimulated cells. This ROS production was abolished after pretreatment with diphenylene iodonium (DPI), an irreversible flavoenzyme inhibitor (Fig. 1B). The contribution of Duox proteins to ROS generation by airway cells was probed with RNAi. Two different siRNAs were designed to regions identical in Duox1 and Duox2, thus targeting both Duox homologs at the same time. Time courses for both Duox1 and Duox2 mRNA and protein expression were performed in SAEC and NCI-H292 cells (Fig. 1C and supplemental Fig. 1B). Immunoblotting confirmed depletion of Duox1 and Duox2 after 96 h of RNAi treatment, which did not affect cell viability. After 96 h of treatment with Duox siRNA ROS production was inhibited by 90–100% (Fig. 1D), whereas control siRNA had no effect. These data indicate that Duox proteins are the main source for calcium-stimulated H2O2 generation in primary human lung epithelial cells and H292 cells. Noxa1 Translocates from the Membrane to the Cytosol upon Calcium Influx—The oxidase regulatory component Noxa1 was detected in cell lysates of lung epithelial cells or lung cancer cells (Fig. 2A). In resting cells immunostaining of endogenous Noxa1 showed localization at the plasma membran" @default.
• W2029605380 created "2016-06-24" @default.
• W2029605380 creator A5010406884 @default.
• W2029605380 creator A5014560562 @default.
• W2029605380 creator A5015426313 @default.
• W2029605380 creator A5024052848 @default.
• W2029605380 creator A5024076776 @default.
• W2029605380 creator A5044779621 @default.
• W2029605380 creator A5077494961 @default.
• W2029605380 date "2008-09-01" @default.
• W2029605380 modified "2023-09-26" @default.
• W2029605380 title "Inhibitory Action of NoxA1 on Dual Oxidase Activity in Airway Cells" @default.
• W2029605380 cites W1586099293 @default.
• W2029605380 cites W1971215115 @default.
• W2029605380 cites W1971798720 @default.
• W2029605380 cites W1973848841 @default.
• W2029605380 cites W1985033865 @default.
• W2029605380 cites W1986099097 @default.
• W2029605380 cites W2001322050 @default.
• W2029605380 cites W2003241255 @default.
• W2029605380 cites W2013005096 @default.
• W2029605380 cites W2014124696 @default.
• W2029605380 cites W2014944893 @default.
• W2029605380 cites W2019023424 @default.
• W2029605380 cites W2020148236 @default.
• W2029605380 cites W2020319663 @default.
• W2029605380 cites W2022385815 @default.
• W2029605380 cites W2022971967 @default.
• W2029605380 cites W2035040393 @default.
• W2029605380 cites W2049197100 @default.
• W2029605380 cites W2058461613 @default.
• W2029605380 cites W2072972271 @default.
• W2029605380 cites W2087712400 @default.
• W2029605380 cites W2087714421 @default.
• W2029605380 cites W2088164656 @default.
• W2029605380 cites W2090774505 @default.
• W2029605380 cites W2095835743 @default.
• W2029605380 cites W2101692904 @default.
• W2029605380 cites W2105940831 @default.
• W2029605380 cites W2115755375 @default.
• W2029605380 cites W2126775459 @default.
• W2029605380 cites W2137131296 @default.
• W2029605380 cites W2139316703 @default.
• W2029605380 cites W2148161012 @default.
• W2029605380 cites W2155083127 @default.
• W2029605380 cites W2158875146 @default.
• W2029605380 cites W2161997291 @default.
• W2029605380 cites W2169549805 @default.
• W2029605380 cites W2177545865 @default.
• W2029605380 cites W2227431951 @default.
• W2029605380 cites W2327543792 @default.
• W2029605380 cites W2397022935 @default.
• W2029605380 cites W2399766206 @default.
• W2029605380 doi "https://doi.org/10.1074/jbc.m709108200" @default.
• W2029605380 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2529001" @default.
• W2029605380 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18606821" @default.
• W2029605380 hasPublicationYear "2008" @default.
• W2029605380 type Work @default.
• W2029605380 sameAs 2029605380 @default.
• W2029605380 citedByCount "37" @default.
• W2029605380 countsByYear W20296053802012 @default.
• W2029605380 countsByYear W20296053802013 @default.
• W2029605380 countsByYear W20296053802014 @default.
• W2029605380 countsByYear W20296053802015 @default.
• W2029605380 countsByYear W20296053802016 @default.
• W2029605380 countsByYear W20296053802017 @default.
• W2029605380 countsByYear W20296053802018 @default.
• W2029605380 countsByYear W20296053802019 @default.
• W2029605380 countsByYear W20296053802022 @default.
• W2029605380 countsByYear W20296053802023 @default.
• W2029605380 crossrefType "journal-article" @default.
• W2029605380 hasAuthorship W2029605380A5010406884 @default.
• W2029605380 hasAuthorship W2029605380A5014560562 @default.
• W2029605380 hasAuthorship W2029605380A5015426313 @default.
• W2029605380 hasAuthorship W2029605380A5024052848 @default.
• W2029605380 hasAuthorship W2029605380A5024076776 @default.
• W2029605380 hasAuthorship W2029605380A5044779621 @default.
• W2029605380 hasAuthorship W2029605380A5077494961 @default.
• W2029605380 hasBestOaLocation W20296053801 @default.
• W2029605380 hasConcept C121332964 @default.
• W2029605380 hasConcept C169760540 @default.
• W2029605380 hasConcept C17077164 @default.
• W2029605380 hasConcept C185592680 @default.
• W2029605380 hasConcept C2780791683 @default.
• W2029605380 hasConcept C55493867 @default.
• W2029605380 hasConcept C62520636 @default.
• W2029605380 hasConcept C86803240 @default.
• W2029605380 hasConcept C98274493 @default.
• W2029605380 hasConceptScore W2029605380C121332964 @default.
• W2029605380 hasConceptScore W2029605380C169760540 @default.
• W2029605380 hasConceptScore W2029605380C17077164 @default.
• W2029605380 hasConceptScore W2029605380C185592680 @default.
• W2029605380 hasConceptScore W2029605380C2780791683 @default.
• W2029605380 hasConceptScore W2029605380C55493867 @default.
• W2029605380 hasConceptScore W2029605380C62520636 @default.
• W2029605380 hasConceptScore W2029605380C86803240 @default.
• W2029605380 hasConceptScore W2029605380C98274493 @default.
• W2029605380 hasIssue "36" @default.

• next