FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2029753295> ?p ?o ?g. }

• W2029753295 endingPage "17347" @default.
• W2029753295 startingPage "17338" @default.
• W2029753295 abstract "Processing of membrane-bound transcription factors such as sterol regulatory element-binding proteins (SREBPs) and the ER-stress response factor ATF6, and glycoproteins of some hemorrhagic fever viruses are initiated by the proprotein convertase SKI-1/S1P. So far, no cellular protein-based inhibitor of the hydrophobic-amino acid specific SKI-1 is known. The prosegment of the basic-amino acid specific convertases (e.g. furin and PC5) or α1-PDX, a variant of α1-antitrypsin (α1-AT) exhibiting an RIPR358 sequence at the reactive site loop, were shown to potently inhibit these secretory proteinases. Accordingly, we tested the SKI-1-inhibitory potential of various point mutants of either the 198 amino acid preprosegment of SKI-1-(1–198) or α1-AT. Transient transfections data showed that, out of numerous mutants studied, the R134E prosegment mutant or the α1-AT reactive site loop variants RRVL358, RRYL358 and RRIL358 are the best specific cellular inhibitors of SKI-1. The observed inhibition of the processing of endogenous SREBP-2, exogenous ATF6 and a PDGF-A (RRLL86) variant were >55% and reach ∼80% in stable transfectants. We also show that SKI-1 forms SDS-stable complexes with these α1-AT variants, but not with wild-type α1-AT or α1-PDX. Finally, these inhibitors were also shown to affect the processing and stability of the Crimean-Congo hemorrhagic fever virus glycoprotein. Processing of membrane-bound transcription factors such as sterol regulatory element-binding proteins (SREBPs) and the ER-stress response factor ATF6, and glycoproteins of some hemorrhagic fever viruses are initiated by the proprotein convertase SKI-1/S1P. So far, no cellular protein-based inhibitor of the hydrophobic-amino acid specific SKI-1 is known. The prosegment of the basic-amino acid specific convertases (e.g. furin and PC5) or α1-PDX, a variant of α1-antitrypsin (α1-AT) exhibiting an RIPR358 sequence at the reactive site loop, were shown to potently inhibit these secretory proteinases. Accordingly, we tested the SKI-1-inhibitory potential of various point mutants of either the 198 amino acid preprosegment of SKI-1-(1–198) or α1-AT. Transient transfections data showed that, out of numerous mutants studied, the R134E prosegment mutant or the α1-AT reactive site loop variants RRVL358, RRYL358 and RRIL358 are the best specific cellular inhibitors of SKI-1. The observed inhibition of the processing of endogenous SREBP-2, exogenous ATF6 and a PDGF-A (RRLL86) variant were >55% and reach ∼80% in stable transfectants. We also show that SKI-1 forms SDS-stable complexes with these α1-AT variants, but not with wild-type α1-AT or α1-PDX. Finally, these inhibitors were also shown to affect the processing and stability of the Crimean-Congo hemorrhagic fever virus glycoprotein. Proteins and peptides that are biologically active are often generated by intracellular limited proteolysis of inactive precursors. The mammalian proprotein convertases (PCs) 1The abbreviations used are: PC, proprotein convertase; SKI-1, subtilisin kexin isozyme-1; ppSKI-1, preprosegment of SKI-1 enzyme; S1P, site-1-protease; pro-PDGF, precursor of platelet-derived growth factor; ER, endoplasmic reticulum; CHO, Chinese hamster ovary; WT, wild type; EGFP, enhanced green fluorescent protein; SCAP, sterol cleavage-activating protein; SREBP, sterol regulatory element-binding protein; nSREBP, nuclear SREBP; ATF6, activating transcription factor 6; CCHF, Crimean Congo hemorrhagic fever; AEBSF, 4-(2-aminoethyl)-benzenesulfonyl fluoride; ALLN, N-acetyl-leucinal-leucinal-norleucinal; α1-AT, α1-antitrypsin; α1-PDX, α1-antitrypsin Portland; UPR, unfolded protein response; RSL, reactive site loop; PBS, phosphate-buffered saline; PDGF, platelet-derived growth factor; DMEM, Dulbecco's modified Eagle's medium; HMAF, hyperimmune mouse ascites fluid. of the secretory pathway are calcium-dependent serine proteinases related to bacterial subtilisin that cleave various precursors at the general consensus motif (K/R)(X)n(K/R)↓, where n = 0, 2, 4, or 6 and X is any amino acid (1Seidah N.G. Chretien M. Brain Res. 1999; 848: 45-62Crossref PubMed Scopus (692) Google Scholar, 2Nakayama K. Biochem. J. 1997; 327: 625-635Crossref PubMed Scopus (705) Google Scholar, 3Zhou A. Webb G. Zhu X. Steiner D.F. J. Biol. Chem. 1999; 274: 20745-20748Abstract Full Text Full Text PDF PubMed Scopus (413) Google Scholar). The PC family counts seven basic amino acid-specific kexin-like convertases: furin, PC1/3, PC2, PC4, PACE4, PC5/6, and PC7/LPC (4Seidah N.G. Dalbey R.E. Sigman D.S. Co- and Post-translational Proteolysis of Proteins. Vol. XXII. Academic Press, San Diego2002: 237-258Google Scholar). The eighth member is the recently discovered pyrolysin-like SKI-1/S1P that cleaves at the consensus motif (R/K)X(hydrophobic)Z↓, where Z is variable (5Seidah N.G. Mowla S.J. Hamelin J. Mamarbachi A.M. Benjannet S. Toure B.B. Basak A. Munzer J.S. Marcinkiewicz J. Zhong M. Barale J.C. Lazure C. Murphy R.A. Chretien M. Marcinkiewicz M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1321-1326Crossref PubMed Scopus (249) Google Scholar), while the last member (6Sakai J. Rawson R.B. Espenshade P.J. Cheng D. Seegmiller A.C. Goldstein J.L. Brown M.S. Mol. Cell. 1998; 2: 505-514Abstract Full Text Full Text PDF PubMed Scopus (328) Google Scholar, 7Elagoz A. Benjannet S. Mammarbassi A. Wickham L. Seidah N.G. J. Biol. Chem. 2002; 277: 11265-11275Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar) NARC-1 cleaves the sequence VFAQ153↓ in its prosegment (8Seidah N.G. Benjannet S. Wickham L. Marcinkiewicz J. Jasmin S.B. Stifani S. Basak A. Prat A. Chretien M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 928-933Crossref PubMed Scopus (934) Google Scholar, 9Naureckiene S. Ma L. Sreekumar K. Purandare U. Lo C.F. Huang Y. Chiang L.W. Grenier J.M. Ozenberger B.A. Jacobsen J.S. Kennedy J.D. DiStefano P.S. Wood A. Bingham B. Arch. Biochem. Biophys. 2003; 420: 55-67Crossref PubMed Scopus (138) Google Scholar). 2S. Benjannet, L. Wickham, D. Rhainds, J. Mayne, M.-C. Asselin, J. Hamelin, M. Varret, D. Allard, M. Abifadel, C. Boileau, A. D. Attie, M. Chretien, A. Prat, and N. G. Seidah, submitted for publication. More PCs contain an N-terminal signal sequence, followed by a prosegment, a catalytic domain and a P-domain. In addition, PCs possess a C-terminal segment that varies between the different members. The critical role of PCs in the proteolytic maturation of multiple proproteins, their implication in various pathologies (1Seidah N.G. Chretien M. Brain Res. 1999; 848: 45-62Crossref PubMed Scopus (692) Google Scholar, 10Chretien M. Mbikay M. Gaspar L. Seidah N.G. Proc. Assoc. Am. Physicians. 1995; 107: 47-66PubMed Google Scholar, 11Khatib A.M. Siegfried G. Chretien M. Metrakos P. Seidah N.G. Am. J. Pathol. 2002; 160: 1921-1935Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar), and their unidentified specific and/or redundant functions, make them attractive targets for the development of potent and selective inhibitors. The various successful approaches include: active site-directed chloromethyl ketone inhibitors (12Garten W. Hallenberger S. Ortmann D. Schafer W. Vey M. Angliker H. Shaw E. Klenk H.D. Biochimie (Paris). 1994; 76: 217-225Crossref PubMed Scopus (140) Google Scholar, 13Jean F. Boudreault A. Basak A. Seidah N.G. Lazure C. J. Biol. Chem. 1995; 270: 19225-19231Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar), reversible peptide-based inhibitors (14Jean F. Basak A. DiMaio J. Seidah N.G. Lazure C. Biochem. J. 1995; 307: 689-695Crossref PubMed Scopus (45) Google Scholar, 15Angliker H. J. Med. Chem. 1995; 38: 4014-4018Crossref PubMed Scopus (45) Google Scholar, 16Basak A. Schmidt C. Ismail A.A. Seidah N.G. Chretien M. Lazure C. Int. J. Pept. Protein Res. 1995; 46: 228-237Crossref PubMed Scopus (28) Google Scholar, 17Cameron A. Appel J. Houghten R.A. Lindberg I. J. Biol. Chem. 2000; 275: 36741-36749Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar), plant derivatives (18Basak A. Cooper S. Roberge A.G. Banik U.K. Chretien M. Seidah N.G. Biochem. J. 1999; 338: 107-113Crossref PubMed Scopus (113) Google Scholar), and several engineered variants of protein-based inhibitors that possess a furin-like motif. These include α2-macroglobulin (α2-MF) (19Van Rompaey L. Ayoubi T. Van D.V. Marynen P. Biochem. J. 1997; 326: 507-514Crossref PubMed Scopus (41) Google Scholar), α1-antitrypsin (α1-AT) Portland (α1-PDX) (20Anderson E.D. Thomas L. Hayflick J.S. Thomas G. J. Biol. Chem. 1993; 268: 24887-24891Abstract Full Text PDF PubMed Google Scholar, 21Benjannet S. Savaria D. Laslop A. Munzer J.S. Chretien M. Marcinkiewicz M. Seidah N.G. J. Biol. Chem. 1997; 272: 26210-26218Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 22Jean F. Stella K. Thomas L. Liu G. Xiang Y. Reason A.J. Thomas G. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 7293-7298Crossref PubMed Scopus (242) Google Scholar), proteinase inhibitor 8 (PI8) (23Dahlen J.R. Jean F. Thomas G. Foster D.C. Kisiel W. J. Biol. Chem. 1998; 273: 1851-1854Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar), the turkey ovomucoid third domain (24Lu W. Zhang W. Molloy S.S. Thomas G. Ryan K. Chiang Y. Anderson S. Laskowski Jr., M. J. Biol. Chem. 1993; 268: 14583-14585Abstract Full Text PDF PubMed Google Scholar), and eglin C (25Komiyama T. Fuller R.S. Biochemistry. 2000; 39: 15156-15165Crossref PubMed Scopus (51) Google Scholar, 26Komiyama T. VanderLugt B. Fugere M. Day R. Kaufman R.J. Fuller R.S. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 8205-8210Crossref PubMed Scopus (37) Google Scholar). However, these effective inhibitors directed against the basic amino acid-specific members lack selectivity. Furthermore, α1-PDX was shown to inhibit all the basic amino acid-specific PCs within the constitutive secretory pathway (21Benjannet S. Savaria D. Laslop A. Munzer J.S. Chretien M. Marcinkiewicz M. Seidah N.G. J. Biol. Chem. 1997; 272: 26210-26218Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 27Tsuji A. Ikoma T. Hashimoto E. Matsuda Y. Protein Eng. 2002; 15: 123-130Crossref PubMed Scopus (25) Google Scholar), whereas PI8 and α2-MF can inhibit many other proteases in addition to the PCs. Subtilisin-, kexin-, and furin-based studies established that the prosegment of these enzymes could act both as an intramolecular chaperone and a potent inhibitor (28Fu X. Inouye M. Shinde U. J. Biol. Chem. 2000; 275: 16871-16878Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar, 29Lesage G. Tremblay M. Guimond J. Boileau G. FEBS Lett. 2001; 508: 332-336Crossref PubMed Scopus (17) Google Scholar, 30Anderson E.D. Van Slyke J.K. Thulin C.D. Jean F. Thomas G. EMBO J. 1997; 16: 1508-1518Crossref PubMed Scopus (202) Google Scholar, 31Zhong M. Munzer J.S. Basak A. Benjannet S. Mowla S.J. Decroly E. Chretien M. Seidah N.G. J. Biol. Chem. 1999; 274: 33913-33920Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar). The prodomain of PCs acts as a competitive inhibitor (31Zhong M. Munzer J.S. Basak A. Benjannet S. Mowla S.J. Decroly E. Chretien M. Seidah N.G. J. Biol. Chem. 1999; 274: 33913-33920Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 32Boudreault A. Gauthier D. Lazure C. J. Biol. Chem. 1998; 273: 31574-31580Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 33Nour N. Basak A. Chretien M. Seidah N.G. J. Biol. Chem. 2003; 278: 2886-2895Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 34Fugere M. Limperis P.C. Beaulieu-Audy V. Gagnon F. Lavigne P. Klarskov K. Leduc R. Day R. J. Biol. Chem. 2002; 277: 7648-7656Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar), whereas the prodomain of the yeast kexin behaves as a mixed inhibitor with an IC50 of ∼160 nm (29Lesage G. Tremblay M. Guimond J. Boileau G. FEBS Lett. 2001; 508: 332-336Crossref PubMed Scopus (17) Google Scholar). The wild-type prosegment of SKI-1 was also shown to inhibit this enzyme in vitro, albeit at micromolar concentrations (35Toure B.B. Munzer J.S. Basak A. Benjannet S. Rochemont J. Lazure C. Chretien M. Seidah N.G. J. Biol. Chem. 2000; 275: 2349-2358Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). Finally, it was shown that ex vivo overexpression of the preproregions of furin (ppfurin), PC7 (ppPC7), and PC5 (ppPC5) resulted in potent but moderately selective cellular inhibition of their parent enzyme (31Zhong M. Munzer J.S. Basak A. Benjannet S. Mowla S.J. Decroly E. Chretien M. Seidah N.G. J. Biol. Chem. 1999; 274: 33913-33920Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 33Nour N. Basak A. Chretien M. Seidah N.G. J. Biol. Chem. 2003; 278: 2886-2895Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 36Benjannet S. Elagoz A. Wickham L. Mamarbachi M. Munzer J.S. Basak A. Lazure C. Cromlish J.A. Sisodia S. Checler F. Chretien M. Seidah N.G. J. Biol. Chem. 2001; 276: 10879-10887Abstract Full Text Full Text PDF PubMed Scopus (279) Google Scholar). Subtilisin kexin isozyme-1 (SKI-1) (5Seidah N.G. Mowla S.J. Hamelin J. Mamarbachi A.M. Benjannet S. Toure B.B. Basak A. Munzer J.S. Marcinkiewicz J. Zhong M. Barale J.C. Lazure C. Murphy R.A. Chretien M. Marcinkiewicz M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1321-1326Crossref PubMed Scopus (249) Google Scholar, 7Elagoz A. Benjannet S. Mammarbassi A. Wickham L. Seidah N.G. J. Biol. Chem. 2002; 277: 11265-11275Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar) also known as Site 1 protease (6Sakai J. Rawson R.B. Espenshade P.J. Cheng D. Seegmiller A.C. Goldstein J.L. Brown M.S. Mol. Cell. 1998; 2: 505-514Abstract Full Text Full Text PDF PubMed Scopus (328) Google Scholar) represents the first mammalian member of secretory subtilisin-like processing enzymes that cleaves after hydrophobic residues. It is synthesized as an inactive precursor (1,052 amino acids) that undergoes three sequential autocatalytic processing events of its prosegment (amino acids 17–186). The signal peptidase cleavage generates an A form (amino acids 17–1052) that is subsequently autocatalytically cleaved in the endoplasmic reticulum (ER) at two alternate B′ and B sites: RKVF133↓ (SKI-1-(134–1052)) and RKVFRSLK137↓ (SKI-1-(138–1052)), respectively. The latter products are then transported to the cis/medial Golgi whereupon they are further autocatalytically processed into a C-form at RRLL186↓, generating SKI-1-(187–1052) (5Seidah N.G. Mowla S.J. Hamelin J. Mamarbachi A.M. Benjannet S. Toure B.B. Basak A. Munzer J.S. Marcinkiewicz J. Zhong M. Barale J.C. Lazure C. Murphy R.A. Chretien M. Marcinkiewicz M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1321-1326Crossref PubMed Scopus (249) Google Scholar, 7Elagoz A. Benjannet S. Mammarbassi A. Wickham L. Seidah N.G. J. Biol. Chem. 2002; 277: 11265-11275Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 35Toure B.B. Munzer J.S. Basak A. Benjannet S. Rochemont J. Lazure C. Chretien M. Seidah N.G. J. Biol. Chem. 2000; 275: 2349-2358Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, 37Espenshade P.J. Cheng D. Goldstein J.L. Brown M.S. J. Biol. Chem. 1999; 274: 22795-22804Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar). SKI-1 plays a crucial role in the regulation of lipid metabolism and cholesterol homeostasis through the processing of the sterol regulatory element-binding proteins, SREBP-1 and SREBP-2, which occurs in the cis/medial Golgi (38Rawson R.B. Zelenski N.G. Nijhawan D. Ye J. Sakai J. Hasan M.T. Chang T.Y. Brown M.S. Goldstein J.L. Mol. Cell. 1997; 1: 47-57Abstract Full Text Full Text PDF PubMed Scopus (395) Google Scholar, 39Brown M.S. Goldstein J.L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11041-11048Crossref PubMed Scopus (1110) Google Scholar). Other type-II membrane-bound substrates include ATF6 that plays a major role in the unfolded protein response (UPR) to enhance the protein folding or refolding capacity of the secretory pathway (40Kaufman R.J. J. Clin. Investig. 2002; 110: 1389-1398Crossref PubMed Scopus (1105) Google Scholar, 41Ye J. Rawson R.B. Komuro R. Chen X. Dave U.P. Prywes R. Brown M.S. Goldstein J.L. Mol. Cell. 2000; 6: 1355-1364Abstract Full Text Full Text PDF PubMed Scopus (1378) Google Scholar), and the basic leucine zipper transcription factor Luman, the cellular counterpart of herpes simplex virus VP16 (42Raggo C. Rapin N. Stirling J. Gobeil P. Smith-Windsor E. O'Hare P. Misra V. Mol. Cell. Biol. 2002; 22: 5639-5649Crossref PubMed Scopus (115) Google Scholar). Brain-derived neurotrophic factor (BDNF) is a soluble substrate and the study of its processing led to the initial cloning of SKI-1 (5Seidah N.G. Mowla S.J. Hamelin J. Mamarbachi A.M. Benjannet S. Toure B.B. Basak A. Munzer J.S. Marcinkiewicz J. Zhong M. Barale J.C. Lazure C. Murphy R.A. Chretien M. Marcinkiewicz M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1321-1326Crossref PubMed Scopus (249) Google Scholar). Mutation of proplatelet-derived growth factor A (pro-PDGF-A) at its furin-cleavage site (RRKR86) into RRLL86 (pro-PDGF-A*) resulted in a SKI-1 artificial substrate (43Siegfried G. Khatib A.M. Benjannet S. Chretien M. Seidah N.G. Cancer Res. 2003; 63: 1458-1463PubMed Google Scholar). Finally, SKI-1 was shown to play a major role in the processing of surface glycoproteins of infectious viruses such as Lassa (44Lenz O. ter Meulen J. Klenk H.D. Seidah N.G. Garten W. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 12701-12705Crossref PubMed Scopus (277) Google Scholar, 45Basak A. Chretien M. Seidah N.G. FEBS Lett. 2002; 514: 333-339Crossref PubMed Scopus (35) Google Scholar), lymphocytic choriomeningitis (LCMV) (46Beyer W.R. Popplau D. Garten W. Von Laer D. Lenz O. J. Virol. 2003; 77: 2866-2872Crossref PubMed Scopus (183) Google Scholar, 47Kunz S. Edelmann K.H. de la Torre J.C. Gorney R. Oldstone M.B. Virology. 2003; 314: 168-178Crossref PubMed Scopus (125) Google Scholar) and Crimean Congo hemorrhagic fever (CCHF) (48Vincent M.J. Sanchez A.J. Erickson B.R. Basak A. Chretien M. Seidah N.G. Nichol S.T. J. Virol. 2003; 77: 8640-8649Crossref PubMed Scopus (117) Google Scholar) viruses. CCHF is a tick-borne member of the genus Nairovirus, family Bunyaviridae. The mature virus glycoprotein Gn is generated by proteolytic cleavage from Pre-Gn at the RRLL site by SKI-1 in the ER-cis Golgi compartments (48Vincent M.J. Sanchez A.J. Erickson B.R. Basak A. Chretien M. Seidah N.G. Nichol S.T. J. Virol. 2003; 77: 8640-8649Crossref PubMed Scopus (117) Google Scholar). The three SREBP isoforms in mammals that belong to the basic helix-loop-helix leucine zipper (bHLH-Zip) family of transcription factors are designated SREBP-1a, SREBP-1c, and SREBP-2 (39Brown M.S. Goldstein J.L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11041-11048Crossref PubMed Scopus (1110) Google Scholar). Synthesized as membrane-bound precursors, they are cleaved in an SREBP-cleavage-activating protein (SCAP)- and insulin-induced gene (Insig)-dependent fashion. When cellular cholesterol levels are high, Insig proteins bind and retain the SCAP-SREBP complex in the ER. When cells are deprived of sterols, Insig separates, allowing the transport of the SREBP-SCAP complex to the Golgi. Therein, a two-step proteolytic process (SKI-1/S1P and S2P) (49Yang T. Espenshade P.J. Wright M.E. Yabe D. Gong Y. Aebersold R. Goldstein J.L. Brown M.S. Cell. 2002; 110: 489-500Abstract Full Text Full Text PDF PubMed Scopus (795) Google Scholar), releases the SREBPs from cell membranes, allowing their active N-terminal segments (nSREBP) to translocate to the nucleus, where they activate transcription of more than 25 mRNAs coding for proteins required for the biosynthesis and uptake of cholesterol and unsaturated fatty acids (50Rawson R.B. Biochem. Soc. Symp. 2003; : 221-231PubMed Google Scholar). ATF6 is an ER type II leucine zipper transmembrane transcription factor held in the ER by Bip under normal conditions, with its N-terminal DNA binding domain facing the cytosol and its C terminus in the ER lumen (51Haze K. Yoshida H. Yanagi H. Yura T. Mori K. Mol. Biol. Cell. 1999; 10: 3787-3799Crossref PubMed Scopus (1562) Google Scholar). Accumulation of improperly folded proteins in the ER, calcium depletion by thapsigargin or inhibition of glycosylation by tunicamycin leads to an ER-stress response resulting in Bip dissociation from ATF6. The latter is then translocated in a SCAP-independent fashion to the Golgi where it is first cleaved by SKI-1/S1P and then by S2P. This releases the cytosolic N-terminal domain of ATF6 (nATF6), which subsequently reaches the nucleus to activate ER stress target genes (41Ye J. Rawson R.B. Komuro R. Chen X. Dave U.P. Prywes R. Brown M.S. Goldstein J.L. Mol. Cell. 2000; 6: 1355-1364Abstract Full Text Full Text PDF PubMed Scopus (1378) Google Scholar, 52Shen J. Chen X. Hendershot L. Prywes R. Dev. Cell. 2002; 3: 99-111Abstract Full Text Full Text PDF PubMed Scopus (1081) Google Scholar). SREBPs and their processing enzymes, SKI-1/S1P and S2P are certainly important targets for drug development. A sensitive SKI-1-specific fluorogenic assay has been developed based on the processing of a quenched fluorogenic peptide mimicking the glycoprotein processing site of Lassa (45Basak A. Chretien M. Seidah N.G. FEBS Lett. 2002; 514: 333-339Crossref PubMed Scopus (35) Google Scholar) and CCHF (48Vincent M.J. Sanchez A.J. Erickson B.R. Basak A. Chretien M. Seidah N.G. Nichol S.T. J. Virol. 2003; 77: 8640-8649Crossref PubMed Scopus (117) Google Scholar) viruses. It was shown in vivo that SKI-1/S1P plays a crucial role in the processing of SREBPs in liver and is necessary for normal rates of triglyceride and sterol synthesis. Thus, whereas homozygote SKI-1/S1P (-/-) results in a lethal phenotype, conditional knockout in mouse liver results in 64–83% decrease in the rates of cholesterol and fatty acid biosynthesis in hepatocytes (53Yang J. Goldstein J.L. Hammer R.E. Moon Y.A. Brown M.S. Horton J.D. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 13607-13612Crossref PubMed Scopus (192) Google Scholar). However, analysis of SKI-1 mRNA distribution revealed a widespread expression that suggests that this convertase plays other roles, as in neurons, bone and cartilage development (5Seidah N.G. Mowla S.J. Hamelin J. Mamarbachi A.M. Benjannet S. Toure B.B. Basak A. Munzer J.S. Marcinkiewicz J. Zhong M. Barale J.C. Lazure C. Murphy R.A. Chretien M. Marcinkiewicz M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1321-1326Crossref PubMed Scopus (249) Google Scholar). Indeed, it was recently shown that SKI-1 plays a critical role in cartilage development in zebrafish (54Schlombs K. Wagner T. Scheel J. Proc. Natl. Acad. Sci. U. S. A. 2003; PubMed Google Scholar). The critical implication of SKI-1 in various cellular functions and in certain pathologies emphasizes the importance of understanding the function of this convertase and of developing specific inhibitors that could modulate its activity in disease states. Whereas SKI-1 inhibition was recently achieved with 300 μm of the general serine protease inhibitor AEBSF (55Okada T. Haze K. Nadanaka S. Yoshida H. Seidah N.G. Hirano Y. Sato R. Negishi M. Mori K. J. Biol. Chem. 2003; 278: 31024-31032Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar), it was not a specific SKI-1 inhibitor. In the present study, we introduced SKI-1 recognition motifs into the reactive site loop (RSL) of α1-AT (P1-P4 positions) as one approach to the development of protein-based inhibitors. We also optimized the prosegment-based inhibition of SKI-1 and identified a unique R134E mutant exhibiting a potent inhibitory activity. These inhibitors represent protein-based inhibitors designed to specifically block intracellular SKI-1 activity. Construction of Human α1-AT Variants by Site-directed Mutagenesis—The pIRES2-EGFP vector (Clontech) with the human α1-AT cDNA containing the wild-type sequence (AIPM358) in the reactive site loop (RSL) was used as template to introduce mutations. The various P1-P4 reactive site loop variants were generated by a two-step PCR using Elongase (Invitrogen, Life Technologies) using sense (S) and antisense (AS) oligonucleotides. The oligonucleotides used for introducing mutants were S1/AS1, S2/AS2, S3/AS3, S4/AS4, S5/AS5, and S6/AS6, S7/AS7, S8/AS8, S9/AS9, S10/AS10, S11/AS11, and S12/AS12, respectively (Table I). The various α1-AT variants were subsequently amplified using S22/AS22, and the PCR products were cloned into the pCRII-TOPO TA-cloning vector (Invitrogen) and sequenced. The PstI/SacII cDNA fragments replaced that of the wild-type α1-AT sequence in the pIRES2-EGFP, resulting in the mutant α1-AT recombinants RRLL, RSLK, RRLI, RRLV, RKVF, RRLE, RRIL, RRVL, RRFL, RRYL, KRLL, and KKLL.Table IOligonucleotides Sense (S) and Antisense (AS) used in the construction of various α1-AT and ppSKI-1 mutantsPrimersSense (S)Antisense (AS)S1/AS1CGCAGACTCCTCTCGATCCCCCCCGAGGTCAAGGAGGAGTCTGCGCTCTAAAAACATGGCCCCTGCS2/AS2CGCAGTCTCAAATCGATCCCCCCCGAGGTCAAGTTTGAGACTGCGCTCTAAAAACATGGCCCCTGCS3/AS3CGCAGACTCATCTCGATCCCCCCCGAGGTCAAGGATGAGTCTGCGCTCTAAAAACATGGCCCCTGCS4/AS4CGCAGACTCGTCTCGATCCCCCCCGAGGTCAAGGACGAGTCTGCGCTCTAAAAACATGGCCCCTGCS5/AS5CGCAAAGTCTTCTCGATCCCCCCCGAGGTCAAGGAAGACTTTGCGCTCTAAAAACATGGCCCCTGCS6/AS6CGCAGACTCGAGTCGATCCCGGGATCGACTCGAGTCTGCGS7/AS7GAGCGCAGAATCCTCTCGATCCGGATCGAGAGGATTCTGCGCTCS8/AS8GAGCGCAGAGTCCTCTCGATCCGGATCGAGAGGACTCTGCGCTCS9/AS9GAGCGCAGATTCCTCTCGATCCGGATCGAGAGGAATCTGCGCTCS10/AS10GAGCGCAGATACCTCTCGATCCGGATCGAGAGGTATCTGCGCTCS11/AS11GTTTTTAGAGAAGAGACTCCTCTCGCGAGAGGAGTCTCTTCTCTAAAAACS12/AS12GTTTTAGAGAAGAAACTCCTCTCGCGAGAGGAGTTTCTTCTCTAAAAACS13/AS13GGATCCGAAGAAACATCTGGGCGACAGACTCGAGTGTCTGGGCAACCTGGCGCGGGS13/AS14GGATCCGAAGAAACATCTGGGCGACAGAATGGATCCCTATTCAGCATACTTGAGGGAACGS15/AS15GAAAAGTCTTTGAATCCCTCAAGCTTGAGGGATTCAAAGACTTTTCS16/AS16GAAAAGTCTTTGCTTCCCTCAAGCTTGAGGGAAGCAAAGACTTTTCS17AS17GTTCCCTCGTGTATGCTGAATCTGCAGATTCAGCATACACGAGGGAACS18/AS18CCCCAACGTGCAGTCTTCCGTTCCGGAACGGAAGACTGCACGTTGGGGS19/AS19CCCCAAGCGAAAGTCTTCCGTTCCGGAACGGAAGACTTTCGCTTGGGGS13/AS20GGATCCGAAGAAACATCTGGGCGACAGAGGATCCTCACAGTTCATCTTTCTGCAGTGTCTGGGCAACCTGS21/AS21CCCCAAGCAGCTGTCTTTCGTTCCGGAACGAAAGACAGCTGCTTGGGGS22/AS22CTCACCCACGATATCATCACCCTTCGGCCAGTAACGTTAGGGG Open table in a new tab Human Prepro-SKI-1 and Its Mutants—The N-terminal fragment of hSKI-1 (wild type) (1–198 amino acids) was amplified by PCR using S13/AS13 and cloned into pCRII-TOPO TA-cloning vector. Subsequently, the amplified cDNA was digested by XhoI/BamHI and subcloned into pIRES2-EGFP. Site-directed mutagenesis was carried out using the wild-type construct as the template using the pairs of oligonucleotides (Table I): S13/AS14, S15/AS15, S16/AS16, S17/AS17, S18/AS18, S19/AS19, S13/AS20, S21/AS21. This generated the preproSKI-1 (ppSKI-1) cleavage B′/B site mutants RKVFRSLK137-stop, R134E, R134A, K137V, K131A, R130A (amino acids 1–198)-KDEL, and the double mutant K130A/R131A. All mutant cDNAs were sequenced and subcloned into pIRES2-EGFP. Inhibition of Pro-PDGF-A and Pro-PDGF-A* Processing ex Vivo— Chinese hamster ovary CHO-K1 (4 × 105) cells (in a 60-mm plate) were transfected using LipofectAMINE 2000 (Invitrogen). A total of 6 μg of DNA was used for each transfection in a ratio of 1:4 (substrate:inhibitor) expressing either pIRES2-EGFP-V5 alone, pIRES2-EGFP-pro-PDGF-A-V5 (WT), or pIRES2-EGFP-pro-PDGF-A*-V5 (mutant). Cotransfection with various mutants constructs such as α1-PDX (RIPR358), α1-AT (AIPM358) WT, various α1-AT, and ppSKI-1 variants were used to inhibit the processing of wild-type pro-PDGF-A or its RRLL86 mutant (pro-PDGF-A*). After 24 h of incubation at 37 °C in DMEM/10% fetal calf serum (Invitrogen, Life Technologies), the cells were rinsed with PBS and incubated in serum-free DMEM for another 24 h. 48-h post-transfection, the medium was resolved on a 12% SDS-PAGE gel. Detection by Western blotting was done with monoclonal antibody directed against the V5 epitope fused to the C-terminal end of pro-PDGF-A (1:5000 dilution) (Invitrogen). Transient Transfection and Immunoblot Analysis of Endogenous Hamster SREBP-2—Chinese hamster ovary cells (CHO-K1) were set up at a density of 4 × 105 cells per 60-mm plate for transfection. On day 1, cells were transiently transfected with 6 μg of cDNA using LipofectAMINE 2000, and cultured overnight in medium B (1:1 mixture of Ham's F-12 medium and Dulbecco's modified Eagle's medium containing 100 μg/ml streptomycin sulfate) supplemented with 5% fetal calf serum. On day 2, cells were washed with PBS and then switched to medium with 5% lipoprotein deficient serum (LPDS) with 50 μm compactin and 50 μm sodium mevalonate in the absence or the presence of sterols for 18 h. Thereafter, the cells received N-acetyl-leucinal-leucinal-norleucinal (ALLN; Sigma) at a final concentration of 25 μg/ml, a calpain and proteasome inhibitor that blocks the degradation of the mature form of SREBP-2, and the cells harvested 1-h later. Cells were then washed twice with PBS, lysed in 200 μl of SDS buffer (10 mm Tris, pH 7.5, 100 mm NaCl, 1% SDS, and 25 μg/ml ALLN), passed repeatedly through a 25-gauge needle, and centrifuged. Cell lysates were separated by electrophoresis on 6% SDS-polyacrylamide gel and the separated proteins were transferred to Hybond-C nitrocellulose membranes (Amersham Biosciences). These were then incubated with a mouse monoclonal antibody IgG-7D4 (dilution 1:200) directed against the N-terminal domain of hamster SREBP-2 (amino acids 32–250). The membranes were washed, and the immunoreactive proteins detected with horseradish peroxidase-conjugated anti-mouse IgG using an enhanced chemiluminescence (ECL) Western blotting detection system kit (Amersham Biosciences) according to the manufacturer's instructions. Inhibitory Effect of Various Mutants on the Processing of ATF6— Mon" @default.
• W2029753295 created "2016-06-24" @default.
• W2029753295 creator A5010392941 @default.
• W2029753295 creator A5014946505 @default.
• W2029753295 creator A5030091007 @default.
• W2029753295 creator A5090995081 @default.
• W2029753295 date "2004-04-01" @default.
• W2029753295 modified "2023-10-14" @default.
• W2029753295 title "Development of Protein-based Inhibitors of the Proprotein of Convertase SKI-1/S1P" @default.
• W2029753295 cites W121339944 @default.
• W2029753295 cites W1493993231 @default.
• W2029753295 cites W1569326224 @default.
• W2029753295 cites W1635573697 @default.
• W2029753295 cites W1759884410 @default.
• W2029753295 cites W1885047062 @default.
• W2029753295 cites W1968953041 @default.
• W2029753295 cites W1970761589 @default.
• W2029753295 cites W1975794635 @default.
• W2029753295 cites W1980284138 @default.
• W2029753295 cites W1981726862 @default.
• W2029753295 cites W1983469573 @default.
• W2029753295 cites W1988482079 @default.
• W2029753295 cites W1989937183 @default.
• W2029753295 cites W1991263759 @default.
• W2029753295 cites W1992775066 @default.
• W2029753295 cites W1994987941 @default.
• W2029753295 cites W1996387922 @default.
• W2029753295 cites W2004593684 @default.
• W2029753295 cites W2007334178 @default.
• W2029753295 cites W2008169313 @default.
• W2029753295 cites W2013754831 @default.
• W2029753295 cites W2014452833 @default.
• W2029753295 cites W2029881607 @default.
• W2029753295 cites W2032113284 @default.
• W2029753295 cites W2034844930 @default.
• W2029753295 cites W2037254183 @default.
• W2029753295 cites W2040252771 @default.
• W2029753295 cites W2045242604 @default.
• W2029753295 cites W2045342348 @default.
• W2029753295 cites W2046820814 @default.
• W2029753295 cites W2049479971 @default.
• W2029753295 cites W2054015058 @default.
• W2029753295 cites W2054484042 @default.
• W2029753295 cites W2055059015 @default.
• W2029753295 cites W2057784382 @default.
• W2029753295 cites W2058341758 @default.
• W2029753295 cites W2062808764 @default.
• W2029753295 cites W2078669364 @default.
• W2029753295 cites W2080960170 @default.
• W2029753295 cites W2090004322 @default.
• W2029753295 cites W2093102332 @default.
• W2029753295 cites W2097632838 @default.
• W2029753295 cites W2100475845 @default.
• W2029753295 cites W2103498840 @default.
• W2029753295 cites W2106728536 @default.
• W2029753295 cites W2116160028 @default.
• W2029753295 cites W2120500292 @default.
• W2029753295 cites W2122391469 @default.
• W2029753295 cites W2127639686 @default.
• W2029753295 cites W2133498598 @default.
• W2029753295 cites W2138612489 @default.
• W2029753295 cites W2142137533 @default.
• W2029753295 cites W2144065739 @default.
• W2029753295 cites W2162764803 @default.
• W2029753295 cites W2164576092 @default.
• W2029753295 cites W2171240084 @default.
• W2029753295 cites W26067972 @default.
• W2029753295 cites W307954097 @default.
• W2029753295 cites W4250374989 @default.
• W2029753295 doi "https://doi.org/10.1074/jbc.m313764200" @default.
• W2029753295 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14970232" @default.
• W2029753295 hasPublicationYear "2004" @default.
• W2029753295 type Work @default.
• W2029753295 sameAs 2029753295 @default.
• W2029753295 citedByCount "54" @default.
• W2029753295 countsByYear W20297532952012 @default.
• W2029753295 countsByYear W20297532952013 @default.
• W2029753295 countsByYear W20297532952014 @default.
• W2029753295 countsByYear W20297532952016 @default.
• W2029753295 countsByYear W20297532952017 @default.
• W2029753295 countsByYear W20297532952018 @default.
• W2029753295 countsByYear W20297532952020 @default.
• W2029753295 countsByYear W20297532952021 @default.
• W2029753295 countsByYear W20297532952022 @default.
• W2029753295 countsByYear W20297532952023 @default.
• W2029753295 crossrefType "journal-article" @default.
• W2029753295 hasAuthorship W2029753295A5010392941 @default.
• W2029753295 hasAuthorship W2029753295A5014946505 @default.
• W2029753295 hasAuthorship W2029753295A5030091007 @default.
• W2029753295 hasAuthorship W2029753295A5090995081 @default.
• W2029753295 hasBestOaLocation W20297532951 @default.
• W2029753295 hasConcept C185592680 @default.
• W2029753295 hasConcept C2778163477 @default.
• W2029753295 hasConcept C2778824825 @default.
• W2029753295 hasConcept C2780072125 @default.
• W2029753295 hasConcept C2908627167 @default.
• W2029753295 hasConcept C43554185 @default.
• W2029753295 hasConcept C55493867 @default.

• next