FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2030442022> ?p ?o ?g. }

• W2030442022 endingPage "31908" @default.
• W2030442022 startingPage "31900" @default.
• W2030442022 abstract "Lipid-loaded macrophage “foam cells” accumulate in the subendothelial space during the development of fatty streaks and atherosclerotic lesions. To better understand the consequences of such lipid loading, murine peritoneal macrophages were isolated and incubated with ligands for two nuclear receptors, liver X receptor (LXR) and retinoic acid receptor (RXR). Analysis of the expressed mRNAs using microarray technology led to the identification of four highly induced genes that encode apolipoproteins E, C-I, C-IV, and C-II. Northern blot analysis confirmed that the mRNA levels of these four genes were induced 2–14-fold in response to natural or synthetic ligands for LXR and/or RXR. The induction of all four mRNAs was greatly attenuated in peritoneal macrophages derived from LXRα/β null mice. The two LXR response elements located within the multienhancers ME.1 and ME.2 were shown to be essential for the induction of apoC-II promoter-reporter genes by ligands for LXR and/or RXR. Finally, immunohistochemical studies demonstrate that apoC-II protein co-localizes with macrophages within murine arterial lesions. Taken together, these studies demonstrate that activated LXR induces the expression of the apoE/C-I/C-IV/C-II gene cluster in both human and murine macrophages. These results suggest an alternative mechanism by which lipids are removed from macrophage foam cells. Lipid-loaded macrophage “foam cells” accumulate in the subendothelial space during the development of fatty streaks and atherosclerotic lesions. To better understand the consequences of such lipid loading, murine peritoneal macrophages were isolated and incubated with ligands for two nuclear receptors, liver X receptor (LXR) and retinoic acid receptor (RXR). Analysis of the expressed mRNAs using microarray technology led to the identification of four highly induced genes that encode apolipoproteins E, C-I, C-IV, and C-II. Northern blot analysis confirmed that the mRNA levels of these four genes were induced 2–14-fold in response to natural or synthetic ligands for LXR and/or RXR. The induction of all four mRNAs was greatly attenuated in peritoneal macrophages derived from LXRα/β null mice. The two LXR response elements located within the multienhancers ME.1 and ME.2 were shown to be essential for the induction of apoC-II promoter-reporter genes by ligands for LXR and/or RXR. Finally, immunohistochemical studies demonstrate that apoC-II protein co-localizes with macrophages within murine arterial lesions. Taken together, these studies demonstrate that activated LXR induces the expression of the apoE/C-I/C-IV/C-II gene cluster in both human and murine macrophages. These results suggest an alternative mechanism by which lipids are removed from macrophage foam cells. apolipoprotein ATP-binding cassette transporter fetal bovine serum farnesoid X-activated receptor 3-(2,6-dichlorophenyl)-4-(3′-carboxy-2-chloro-stilben-4-yl)-oxymethyl-5-isopropyl-isoxazole hepatic control region LG100153 (a synthetic RXR agonist) low density lipoprotein very LDL lipoprotein deficient serum lipoprotein lipase liver X receptor LXR response element multienhancer region 9-cis retinoic acid receptor α T0901317 (a synthetic LXR agonist) expressed sequence tag phosphate-buffered saline 6-carboxytetramethylrhodamine 6-carboxyfluorescein ApoE,1 apoC-I, apoC-IV, and apoC-II form a gene cluster that spans 45 kb on human chromosome 19 (1) and 30 kb on murine chromosome 7 (2Hoffer M.J. Hofker M.H. van Eck M.M. Havekes L.M. Frants R.R. Genomics. 1993; 15: 62-67Crossref PubMed Scopus (27) Google Scholar). These four secreted proteins have important roles in lipoprotein/lipid homeostasis. ApoE is a component of chylomicrons, VLDL, and intermediate density lipoprotein (3Curtiss L.K. Boisvert W.A. Curr. Opin. Lipidol. 2000; 11: 243-251Crossref PubMed Scopus (196) Google Scholar), where it functions to mediate the clearance of these lipoproteins from the circulation by a process that is dependent on the interaction of apoE with specific cell surface receptors (3Curtiss L.K. Boisvert W.A. Curr. Opin. Lipidol. 2000; 11: 243-251Crossref PubMed Scopus (196) Google Scholar). The majority of plasma apoE is derived from the liver (4Reue K.L. Quon D.H. O'Donnell K.A. Dizikes G.J. Fareed G.C. Lusis A.J. J. Biol. Chem. 1984; 259: 2100-2107Abstract Full Text PDF PubMed Google Scholar). However, other tissues, including brain glial cells and macrophages, synthesize and secrete apoE (5Basu S.K., Ho, Y.K. Brown M.S. Bilheimer D.W. Anderson R.G. Goldstein J.L. J. Biol. Chem. 1982; 257: 9788-9795Abstract Full Text PDF PubMed Google Scholar, 6Boyles J.K. Pitas R.E. Wilson E. Mahley R.W. Taylor J.M. J. Clin. Invest. 1985; 76: 1501-1513Crossref PubMed Scopus (656) Google Scholar). Data from studies that utilized either apoE null mice (7Plump A.S. Smith J.D. Hayek T. Aalto-Setala K. Walsh A. Verstuyft J.G. Rubin E.M. Breslow J.L. Cell. 1992; 71: 343-353Abstract Full Text PDF PubMed Scopus (1878) Google Scholar, 8Zhang S.H. Reddick R.L. Piedrahita J.A. Maeda N. Science. 1992; 258: 468-471Crossref PubMed Scopus (1849) Google Scholar) or bone marrow transplantation (9Fazio S. Babaev V.R. Murray A.B. Hasty A.H. Carter K.J. Gleaves L.A. Atkinson J.B. Linton M.F. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4647-4652Crossref PubMed Scopus (249) Google Scholar, 10Boisvert W.A. Curtiss L.K. J. Lipid Res. 1999; 40: 806-813Abstract Full Text Full Text PDF PubMed Google Scholar) suggest that macrophage-derived apoE is important in preventing and/or reducing cholesteryl ester accumulation in macrophages in the artery wall. It has been proposed that this anti-atherosclerotic effect of apoE is a result of the apoE-dependent efflux of cholesterol from foam cells (11Lin C.Y. Duan H. Mazzone T. J. Lipid Res. 1999; 40: 1618-1627Abstract Full Text Full Text PDF PubMed Google Scholar). However, the relative importance of this apoE-dependent cholesterol efflux, as compared with the ABCA1/apoAI-dependent lipid efflux (reviewed in Ref.12Oram J.F. Vaughan A.M. Curr. Opin. Lipidol. 2000; 11: 253-260Crossref PubMed Scopus (243) Google Scholar) is currently unknown. Nonetheless, several studies suggest that the anti-atherosclerotic effect of macrophage-derived apoE is independent of its role in increasing the clearance of lipoproteins from the plasma (reviewed in Ref. 3Curtiss L.K. Boisvert W.A. Curr. Opin. Lipidol. 2000; 11: 243-251Crossref PubMed Scopus (196) Google Scholar). ApoC-II mRNA has been identified in murine liver, intestine, and macrophages (13Hoffer M.J. van Eck M.M. Havekes L.M. Hofker M.H. Frants R.R. Genomics. 1993; 17: 45-51Crossref PubMed Scopus (24) Google Scholar). ApoC-II is the obligate cofactor for lipoprotein lipase (LPL) and is required for the LPL-dependent hydrolysis of triglycerides present in chylomicrons, VLDL, and high density lipoprotein (14Fojo S.S. Brewer H.B. J. Intern. Med. 1992; 231: 669-677Crossref PubMed Scopus (102) Google Scholar). Deficiency of either apoC-II or LPL results in hypertriglyceridemia (15Brunzell J.D. Scriver C.R. The Metabolic and Molecular Bases of Inherited Disease. 2. McGraw-Hill, Inc., New York1995: 1913-1932Google Scholar). Paradoxically, transgenic mice expressing human apoC-II are also hypertriglyceridemic, suggesting that apoC-II may have other unknown functions in addition to acting as the obligate co-factor of LPL (16Shachter N.S. Hayek T. Leff T. Smith J.D. Rosenberg D.W. Walsh A. Ramakrishnan R. Goldberg I.J. Ginsberg H.N. Breslow J.L. J. Clin. Invest. 1994; 93: 1683-1690Crossref PubMed Scopus (120) Google Scholar). ApoC-I, like apoC-II, is expressed in the liver and is associated with triglyceride-rich chylomicrons and VLDL (17Jong M.C. Gijbels M.J. Dahlmans V.E. Gorp P.J. Koopman S.J. Ponec M. Hofker M.H. Havekes L.M. J. Clin. Invest. 1998; 101: 145-152Crossref PubMed Scopus (132) Google Scholar). ApoC-I has been reported to inhibit cholesteryl ester transfer protein, to activate the enzyme lecithin-cholesterol acyltransferase, and to inhibit lipoprotein binding to the LDL receptor-related protein (Ref. 18Shachter N.S. Curr. Opin. Lipidol. 2001; 12: 297-304Crossref PubMed Scopus (249) Google Scholar and references therein). The physiological role of apoC-IV remains to be established. Compared with other members of this apolipoprotein gene cluster, apoC-IV hepatic mRNA and plasma protein levels are expressed at extremely low levels (1Allan C.M. Walker D. Segrest J.P. Taylor J.M. Genomics. 1995; 28: 291-300Crossref PubMed Scopus (69) Google Scholar, 19van Eck M.M. Hoffer M.J. Havekes L.M. Frants R.R. Hofker M.H. Genomics. 1994; 21: 110-115Crossref PubMed Scopus (11) Google Scholar). However, expression of the human apoC-IV transgene in mice led to hypertriglyceridemia, as a result of the accumulation of human apoC-IV-enriched VLDL (20Allan C.M. Taylor J.M. J. Lipid Res. 1996; 37: 1510-1518Abstract Full Text PDF PubMed Google Scholar). This latter result suggests that apoC-IV may function to inhibit the hydrolysis of triglycerides contained within VLDL particles. Despite their apparently diverse functions, the expression of some or all members of this apolipoprotein gene cluster is reported to be coordinately regulated by distal enhancer regions; Taylor and co-workers (21Simonet W.S. Bucay N. Lauer S.J. Taylor J.M. J. Biol. Chem. 1993; 268: 8221-8229Abstract Full Text PDF PubMed Google Scholar, 22Allan C.M. Walker D. Taylor J.M. J. Biol. Chem. 1995; 270: 26278-26281Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar) identified two 350-bp hepatic control regions (HCR.1 and HCR.2) that control the hepatic expression of human apoE, apoC-I, apoC-IV, and apoC-II (23Allan C.M. Taylor S. Taylor J.M. J. Biol. Chem. 1997; 272 (dotti): 29113-29119Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). HCR.1 was identified independently (52Shachter N.S. Zhu Y. Walsh A. Breslow J.L. Smith J.D. J. Lipid Res. 1993; 34: 1699-1707Abstract Full Text PDF PubMed Google Scholar). In addition, two multienhancer regions (ME.1 and ME.2, each 620 bp) control the expression of apoE in macrophage, adipose tissue (24Shih S.J. Allan C. Grehan S. Tse E. Moran C. Taylor J.M. J. Biol. Chem. 2000; 275: 31567-31572Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar), brain (25Grehan S. Tse E. Taylor J.M. J. Neurosci. 2001; 21: 812-822Crossref PubMed Google Scholar), and skin (26Grehan S. Allan C. Tse E. Walker D. Taylor J.M. J. Invest. Dermatol. 2001; 116: 77-84Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). The role of ME.1 and/or ME.2 in the regulated tissue expression of apoC-I, apoC-IV, and apoC-II has not been reported. Functional response elements for the nuclear receptors FXR and LXR have been identified in HCRs (27Kast H.R. Nguyen C.M. Sinal C.J. Jones S.A. Laffitte B.A. Reue K. Gonzalez F.J. Willson T.M. Edwards P.A. Mol. Endocrinol. 2001; 15: 1720-1728Crossref PubMed Scopus (224) Google Scholar) and MEs (28Laffitte B.A. Repa J.J. Joseph S.B. Wilpitz D.C. Kast H.R. Mangelsdorf D.J. Tontonoz P. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 507-512Crossref PubMed Scopus (576) Google Scholar), respectively. These results are consistent with the emerging theme that LXR and FXR play key roles in regulating genes involved in lipoprotein metabolism. The FXR response elements in HCR.1 and HCR.2 were shown to be bound by the FXR/RXR heterodimer and to be required for bile acid-dependent activation of the apoC-II gene (27Kast H.R. Nguyen C.M. Sinal C.J. Jones S.A. Laffitte B.A. Reue K. Gonzalez F.J. Willson T.M. Edwards P.A. Mol. Endocrinol. 2001; 15: 1720-1728Crossref PubMed Scopus (224) Google Scholar). In addition, the LXREs located in ME.1 and ME.2 were shown to be required for the induction of apoE in human macrophages, in response to ligands for LXR (28Laffitte B.A. Repa J.J. Joseph S.B. Wilpitz D.C. Kast H.R. Mangelsdorf D.J. Tontonoz P. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 507-512Crossref PubMed Scopus (576) Google Scholar). There are two LXR genes, LXRα and LXRβ, that encode two forms of LXR and that share about 78% identity at the amino acid level in both the DNA- and ligand-binding domains (29Alberti S. Steffensen K.R. Gustafsson J.A. Gene (Amst.). 2000; 243: 93-103Crossref PubMed Scopus (79) Google Scholar). Each LXR isoform complexes with RXRα to form a functional heterodimer that binds to the aforementioned LXREs (reviewed in Ref. 30Edwards P.A. Kast H.R. Anisfeld A.M. J. Lipid Res. 2002; 43: 2-12Abstract Full Text Full Text PDF PubMed Google Scholar). Among the 11 LXR-regulated genes identified to date, several are known to be expressed in macrophages; these include ABCA1 (31Langmann T. Klucken J. Reil M. Liebisch G. Luciani M.F. Chimini G. Kaminski W.E. Schmitz G. Biochem. Biophys. Res. Commun. 1999; 257: 29-33Crossref PubMed Scopus (429) Google Scholar, 32Venkateswaran A. Laffitte B.A. Joseph S.B. Mak P.A. Wilpitz D.C. Edwards P.A. Tontonoz P. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 12097-12102Crossref PubMed Scopus (848) Google Scholar, 33Repa J.J. Turley S.D. Lobaccaro J.A. Medina J., Li, L. Lustig K. Shan B. Heyman R.A. Dietschy J.M. Mangelsdorf D.J. Science. 2000; 289: 1524-1529Crossref PubMed Scopus (1151) Google Scholar), ABCG1 (34Venkateswaran A. Repa J.J. Lobaccaro J.M. Bronson A. Mangelsdorf D.J. Edwards P.A. J. Biol. Chem. 2000; 275: 14700-14707Abstract Full Text Full Text PDF PubMed Scopus (347) Google Scholar), apoE (35Mazzone T. Basheeruddin K. Poulos C. J. Lipid Res. 1989; 30: 1055-1064Abstract Full Text PDF PubMed Google Scholar), fatty acid synthase (36Joseph S.B. Laffitte B.A. Patel P.H. Watson M.A. Matsukuma K.E. Walczak R. Collins J.L. Osborne T.F. Tontonoz P. J. Biol. Chem. 2002; 277: 11019-11025Abstract Full Text Full Text PDF PubMed Scopus (626) Google Scholar), and LPL (37Zhang Y. Repa J.J. Gauthier K. Mangelsdorf D.J. J. Biol. Chem. 2001; 276: 43018-43024Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar). In the current study, we utilized mouse peritoneal macrophages treated with ligands for LXR and RXR and employed microarray technology to identify novel LXR target genes. These studies led to the identification of apoC-I, apoC-IV, apoC-II, and apoE, as target genes of LXR. All four genes were highly induced in both human and mouse primary macrophages following LXR activation. Induction was attenuated or abolished in macrophages derived from LXR α/β−/−mice. Studies with reporter genes suggest that the LXRE in the distal enhancer, ME.2, has a critical role in regulating the expression of this gene cluster. Consistent with these observations, immunohistochemical studies demonstrated that apoC-II protein co-localizes with macrophages in murine atherosclerotic lesions. Our studies support the hypothesis that induction of the apoE/C-I/C-IV/C-II gene cluster in macrophages by LXR/RXR may be a critical event in the subsequent efflux of lipids to apolipoproteins in the artery wall. Mouse apoC-II antibody was a kind gift from Dr. Karl Weisgraber (Gladstone Institute, UCSF). pCMX expression plasmids for LXRα and RXRα were a gift from Ron Evans (Salk Institute, La Jolla, CA). The LXR- and FXR-specific agonists, T0901317 (hereafter referred to as T) and GW4064, were generous gifts from Drs. Tim Willson and Patrick Maloney, respectively (GlaxoSmithKline, Research Triangle Park, NC). The RXR-specific agonist LG100153 (hereafter referred to as LG) was a gift from Dr. Richard Heyman (Ligand Pharmaceuticals, La Jolla, CA). The aforementioned agonists, the pregnane X receptor ligand pregnenolone 16α-carbonitrile, and oxysterols (Sigma) were dissolved in ethanol or Me2SO prior to addition to cells (<1 μl/ml medium). DNA modification and restriction enzymes were obtained from New England Biolabs and Invitrogen. [α-32P]dCTP was purchased from ICN Biomedicals. Lipoprotein-deficient fetal bovine serum (LPDS) was purchased from Intracel Corp. (Rockville, MD). All of the other reagents have been described previously (27Kast H.R. Nguyen C.M. Sinal C.J. Jones S.A. Laffitte B.A. Reue K. Gonzalez F.J. Willson T.M. Edwards P.A. Mol. Endocrinol. 2001; 15: 1720-1728Crossref PubMed Scopus (224) Google Scholar, 38Tabor D.E. Kim J.B. Spiegelman B.M. Edwards P.A. J. Biol. Chem. 1998; 273: 22052-22058Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar, 39Kast H.R. Goodwin B. Tarr P.T. Jones S.A. Anisfeld A.M. Stoltz C.M. Tontonoz P. Kliewer S. Willson T.M. Edwards P.A. J. Biol. Chem. 2002; 277: 2908-2915Abstract Full Text Full Text PDF PubMed Scopus (777) Google Scholar). Human monocytes were isolated from peripheral blood by elutriation and plated on 100-mm dishes at a density of 1 × 106 cells/ml in Iscove's modified Dulbecco's medium in the presence of 30% autologous serum, 0.22% insulin, antibiotics, and fungizone (40Fogelman A.M. Elahi F. Sykes K. Van Lenten B.J. Territo M.C. Berliner J.A. J. Lipid Res. 1988; 29: 1243-1247Abstract Full Text PDF PubMed Google Scholar). The medium was changed on the third and sixth days. On day 8, the medium was replaced with Iscove's modified Dulbecco's medium supplemented with either 10% fetal bovine serum (FBS), 10% LPDS, or 10% LPDS and mevalonic acid (100 μm) in the presence of either 5 μm compactin (unloaded) or ligands for LXR (1 μm T or 5 μm22(R)-hydroxycholesterol) and RXR (100 nm LG). HepG2 cells were maintained in modified Eagle's medium containing 10% FBS as described (27Kast H.R. Nguyen C.M. Sinal C.J. Jones S.A. Laffitte B.A. Reue K. Gonzalez F.J. Willson T.M. Edwards P.A. Mol. Endocrinol. 2001; 15: 1720-1728Crossref PubMed Scopus (224) Google Scholar). Eight-week-old female C57BL/6 mice were purchased from Jackson Laboratory (Bar Harbor, ME), and injected intraperitoneally with 1 ml of 4% thioglycollate solution (Difco) 4 days prior to harvesting macrophages. Briefly, the mice were sacrificed, and ice-cold high glucose Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and 20 ml penicillin/streptomycin was injected into the peritoneal cavity of each mouse. This fluid was carefully withdrawn and centrifuged, and the cell pellet was resuspended in high glucose Dulbecco's modified Eagle's medium containing 10% FBS and penicillin/streptomycin. The cells were pooled and plated at 1.2 million cells/ml, and the macrophages were allowed to adhere for 2–6 h. The medium was then replaced with Dulbecco's modified Eagle's medium supplemented with 10% LPDS, 100 μm mevalonic acid, and either 5 μmcompactin, T, and/or 0.1 μm LG, and the cells were incubated for 8–36 h, as indicated in the text and legends. Total RNA was isolated using Trizol Reagent (Invitrogen) and further purified by using an RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. The GeneChip murine genome MG-U74Av2 microarrays were purchased from Affymetrix Inc. (Santa Clarita, CA). RNA was isolated from duplicate dishes of murine peritoneal macrophages incubated in 10% LPDS and 100 μm mevalonic acid and either 5 μm compactin or 5 μm T and 100 nm LG. Four complementary RNA samples were prepared, and each was hybridized to an individual microarray. Preliminary data analysis was performed by the Microarray Core Facility at University of California at Irvine. Further analysis and data mining were performed using Affymetrix microarray suite 4.0, and GeneSpring 4.0 (Silicon Genetics, Redwood City, CA). These analyses provide a signal for each specific gene/EST that is subsequently normalized by comparing to the median signal (arbitrary value of 1.0) obtained from the whole array. Genes/ESTs were considered to be potential LXR/RXR target genes when the signal derived from RNA isolated from cells treated with ligands for LXR and RXR was (i) greater than the median signal on the array and (ii) at least 2-fold greater than the signal derived from RNA isolated from unloaded cells. Seventy genes/ESTs satisfied these criteria. Total RNA (2–10 μg/lane) was separated by 1% agarose/formaldehyde gel electrophoresis and transferred to a nylon membrane, and the latter was hybridized with [α-32P]dCTP-radiolabeled DNA probes as described previously (27Kast H.R. Nguyen C.M. Sinal C.J. Jones S.A. Laffitte B.A. Reue K. Gonzalez F.J. Willson T.M. Edwards P.A. Mol. Endocrinol. 2001; 15: 1720-1728Crossref PubMed Scopus (224) Google Scholar). Transcript abundance was determined using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA) standardized against 18 S RNA and mathematically adjusted to establish a unit of 1.0 for the unloaded control condition. The constructs of human apoC-II proximal promoter (27Kast H.R. Nguyen C.M. Sinal C.J. Jones S.A. Laffitte B.A. Reue K. Gonzalez F.J. Willson T.M. Edwards P.A. Mol. Endocrinol. 2001; 15: 1720-1728Crossref PubMed Scopus (224) Google Scholar), human ME.1, and ME.2 reporter genes (28Laffitte B.A. Repa J.J. Joseph S.B. Wilpitz D.C. Kast H.R. Mangelsdorf D.J. Tontonoz P. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 507-512Crossref PubMed Scopus (576) Google Scholar) have been described. The human ME.1 (620 bp) or ME.2 (620 bp) were cloned into the BamHI site upstream of the human apoC-II promoter in the previously described apoC-II-luciferase reporter gene (27Kast H.R. Nguyen C.M. Sinal C.J. Jones S.A. Laffitte B.A. Reue K. Gonzalez F.J. Willson T.M. Edwards P.A. Mol. Endocrinol. 2001; 15: 1720-1728Crossref PubMed Scopus (224) Google Scholar) to give ME.1-CII-luc and ME.2-CII-luc, respectively. ME.1 was also cloned into the SmaI-XmaI sites upstream of ME.2-CII-luc to give ME.1-ME.2-CII-luc. The LXRE in ME.2 was mutated by using the QuikChange site-directed mutagenesis kit (Stratagene) according to manufacturer's instructions using primers 5′-ccaccagctgccaggAAcactggcgAAcaaaggcag-3′ and 5′-ctgcctttgTTcgccagtgTTcctggcagctggtgg-3′. Transient transfections of HepG2 cells were performed in triplicate in a 48-well plate using an MBS mammalian transfection kit (Stratagene) with minor modifications. The cells were transfected with 100 ng of a reporter construct, pCMV-β-galactosidase (50 ng), and either the receptor plasmids pCMX-LXRα (50 ng) and pCMX-RXRα (5 ng) or the control pTKCIII (55 ng), using a total of 205 ng of DNA/well. After transfection, the cells were incubated for 24 h in modified Eagle's medium containing 10% LPDS supplemented with 100 mm mevalonic acid in the presence of either 5 μm compactin or ligands for LXRα (1 μm T) or RXRα (100 nm LG), before lysis. The luciferase activities were measured with the Promega luciferase assay system and normalized to β-galactosidase activity (41Laffitte B.A. Kast H.R. Nguyen C.M. Zavacki A.M. Moore D.D. Edwards P.A. J. Biol. Chem. 2000; 275: 10638-10647Abstract Full Text Full Text PDF PubMed Scopus (236) Google Scholar). Real time quantitative PCR assays were performed as described in Ref. 28Laffitte B.A. Repa J.J. Joseph S.B. Wilpitz D.C. Kast H.R. Mangelsdorf D.J. Tontonoz P. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 507-512Crossref PubMed Scopus (576) Google Scholar. The primers and probes are: mApoCII-402F, ctctttgctcgcatcaccag; mApoCII-466R, gaaggcgggagcagctg; mApoCII probe-423T, 6-FAM-ccaggatggtcctacaccaccctgtc-TAMRA; mApoCI-287F, aaggagaagttgaagaccacgttc; mApoCI-352R, gatgtccttgatgcttcgagg; mApoCI probe-312T, 6-FAM-cctgagcacctggcgggcc-TAMRA; mApoCIV-66F, cagctttgtagcatccatgtctaca; mApoCIV-130R, agcggctgctctcaggg; and mApoCIV probe-92T, 6-FAM-aaagcctgagccccacgcctg-TAMRA. The primers and probes for mApoE have been described previously (28Laffitte B.A. Repa J.J. Joseph S.B. Wilpitz D.C. Kast H.R. Mangelsdorf D.J. Tontonoz P. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 507-512Crossref PubMed Scopus (576) Google Scholar). Heart tissue cryosections were obtained from an LDL receptor-deficient mouse that had consumed a high fat diet (TD 94059, Harlan Teklab; 15.8% fat and 1.25% cholesterol) for 16 weeks. The cryosections were fixed in acetone at −20 °C for 2 min and immersed in PBS for 2 min to rehydrate the tissues. All further incubations were performed at room temperature in a humid chamber. The sections were incubated for 30 min in 10% goat serum diluted in PBS. After blot drying, the sections were incubated with rabbit anti-mouse apoC-II (1:2000 dilution of antiserum) or biotinylated F4/80 antibodies (Caltag, Burlingame, CA; at 20 μg/ml) in PBS containing 1% bovine serum albumin and 0.15% Triton X-100. After thorough washing, endogenous peroxidase was blocked for 2 min with a blocking agent (Zymed Laboratories Inc., South San Francisco, CA). For apoC-II staining, the slides were incubated with biotinylated goat anti-rabbit IgG (10 μg/ml in PBS/bovine serum albumin/Triton X-100) for 1 h. All of the sections were then exposed to Vectastain ABC Elite solution (Vector Laboratories) for 30 min and developed with 9-amino-3-ethylene carbazole (Vector Laboratories). The sections were counterstained with hematoxylin, mounted with an aqueous mounting medium (Shandon, Lipshaw, PA), and photographed. To identify novel genes that are activated by the LXR/RXR heterodimer, peritoneal macrophages were isolated from 8-week-old female C57BL/6 mice 4 days after thioglycollate injection. The cells were cultured overnight in medium containing 10% FBS and subsequently cultured for 36 h in a cholesterol-poor medium (10% LPDS) supplemented with 100 μm mevalonic acid and either compactin and vehicle (Me2SO) or the ligands for LXR (T) and RXR (LG). RNA was isolated and subsequently processed for hybridization to Affymetrix microarrays (MG-U74Av2), which contain probes representing over 12,000 murine genes and ESTs sequences. Analysis of the data using Affymetrix standard protocols and GeneSpring software (see “Experimental Procedures”) indicated that 70 genes/EST sequences met the following criteria: (i) the signal derived from cells treated with ligands for LXR and RXR was greater than the median signal on the array and (ii) the ratio of the signal from induced:control cells was ≥2-fold. Using these criteria, the identified genes include sterol regulatory element-binding protein-1, fatty acid synthase, lipoprotein lipase (LPL), ABCA1 and ABCG1 (two members of the ATP-binding cassette family of transporter proteins), and apoE (Table I). These six genes served as positive controls, because they have all been previously identified as LXR target genes (28Laffitte B.A. Repa J.J. Joseph S.B. Wilpitz D.C. Kast H.R. Mangelsdorf D.J. Tontonoz P. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 507-512Crossref PubMed Scopus (576) Google Scholar, 31Langmann T. Klucken J. Reil M. Liebisch G. Luciani M.F. Chimini G. Kaminski W.E. Schmitz G. Biochem. Biophys. Res. Commun. 1999; 257: 29-33Crossref PubMed Scopus (429) Google Scholar, 32Venkateswaran A. Laffitte B.A. Joseph S.B. Mak P.A. Wilpitz D.C. Edwards P.A. Tontonoz P. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 12097-12102Crossref PubMed Scopus (848) Google Scholar, 33Repa J.J. Turley S.D. Lobaccaro J.A. Medina J., Li, L. Lustig K. Shan B. Heyman R.A. Dietschy J.M. Mangelsdorf D.J. Science. 2000; 289: 1524-1529Crossref PubMed Scopus (1151) Google Scholar, 34Venkateswaran A. Repa J.J. Lobaccaro J.M. Bronson A. Mangelsdorf D.J. Edwards P.A. J. Biol. Chem. 2000; 275: 14700-14707Abstract Full Text Full Text PDF PubMed Scopus (347) Google Scholar, 36Joseph S.B. Laffitte B.A. Patel P.H. Watson M.A. Matsukuma K.E. Walczak R. Collins J.L. Osborne T.F. Tontonoz P. J. Biol. Chem. 2002; 277: 11019-11025Abstract Full Text Full Text PDF PubMed Scopus (626) Google Scholar, 37Zhang Y. Repa J.J. Gauthier K. Mangelsdorf D.J. J. Biol. Chem. 2001; 276: 43018-43024Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar, 42Repa J.J. Liang G., Ou, J. Bashmakov Y. Lobaccaro J.M. Shimomura I. Shan B. Brown M.S. Goldstein J.L. Mangelsdorf D.J. Genes Dev. 2000; 14: 2819-2830Crossref PubMed Scopus (1423) Google Scholar, 43Schultz J.R., Tu, H. Luk A. Repa J.J. Medina J.C., Li, L. Schwendner S. Wang S. Thoolen M. Mangelsdorf D.J. Lustig K.D. Shan B. Genes Dev. 2000; 14: 2831-2838Crossref PubMed Scopus (1404) Google Scholar). Analysis of the data indicated that apoC-II also met these criteria, suggesting that it might represent a gene that was induced by ligands for LXR and RXR (Table I). Northern blot analyses demonstrated that apoC-II and apoE mRNA levels were induced 10.55 ± 4.4 and 7.19 ± 3.9-fold (mean ± S.D., n = 4;p < 0.05 compared with unloaded cells), respectively, when cells were treated with LXR and RXR ligands. A representative Northern blot is shown in Fig.1A. Apolipoproteins E, C-I, C-IV, and C-II form a gene cluster in both humans and mice (1Allan C.M. Walker D. Segrest J.P. Taylor J.M. Genomics. 1995; 28: 291-300Crossref PubMed Scopus (69) Google Scholar, 2Hoffer M.J. Hofker M.H. van Eck M.M. Havekes L.M. Frants R.R. Genomics. 1993; 15: 62-67Crossref PubMed Scopus (27) Google Scholar). Interestingly, analysis of the Affymetrix data indicated that the mRNAs for apoC-I and apoC-IV were expressed at low levels in unloaded cells but appeared to be induced in cells treated with ligands for LXR and RXR (Table I). The induction of these latter two mRNAs was confirmed by Northern blot analysis (Fig. 1A), consistent with the coordinate regulation of the whole gene cluster in macrophages by ligands for LXR and RXR.Table IRepresentative list of genes involved in lipid metabolism that are induced following activation of macrophage LXR and RXRGeneNormalized expression from Affymetrix arraysFold changeGenBankTM accession numberUnloaded cellsT + LG-treated cellsSREBP-12.28.84.0AI843895FAS1.76.23.6X13135LPL4.725.75.5M63335ABCA11.116.414.4X75926ABCG13.412.73.7Z48745ApoE83.4158.82.0D00466ApoC-IND4.4∞Z22661ApoC-II4.440.99.3Z22216ApoC-IVND0.5∞Z24722 Open table in a new tab RXR is a ubiquitously expressed nuclear receptor that heterodimerizes with several other nuclear receptors (44Willy P.J. Umesono K. Ong E.S. Evans R.M. Heyman R.A. Mangelsdorf D.J. Genes Dev." @default.
• W2030442022 created "2016-06-24" @default.
• W2030442022 creator A5010352902 @default.
• W2030442022 creator A5010662099 @default.
• W2030442022 creator A5013807783 @default.
• W2030442022 creator A5029940065 @default.
• W2030442022 creator A5036730904 @default.
• W2030442022 creator A5046988176 @default.
• W2030442022 creator A5048810295 @default.
• W2030442022 creator A5082866305 @default.
• W2030442022 date "2002-08-01" @default.
• W2030442022 modified "2023-10-16" @default.
• W2030442022 title "Regulated Expression of the Apolipoprotein E/C-I/C-IV/C-II Gene Cluster in Murine and Human Macrophages" @default.
• W2030442022 cites W1522648964 @default.
• W2030442022 cites W1552597422 @default.
• W2030442022 cites W1554323039 @default.
• W2030442022 cites W1607230014 @default.
• W2030442022 cites W1650965741 @default.
• W2030442022 cites W170055736 @default.
• W2030442022 cites W1962935964 @default.
• W2030442022 cites W1967286688 @default.
• W2030442022 cites W1973195548 @default.
• W2030442022 cites W1973924691 @default.
• W2030442022 cites W1983430442 @default.
• W2030442022 cites W1992980650 @default.
• W2030442022 cites W2003798182 @default.
• W2030442022 cites W2003840075 @default.
• W2030442022 cites W2014699804 @default.
• W2030442022 cites W2022332493 @default.
• W2030442022 cites W2024851295 @default.
• W2030442022 cites W2025913917 @default.
• W2030442022 cites W2035252462 @default.
• W2030442022 cites W2041197131 @default.
• W2030442022 cites W2044357450 @default.
• W2030442022 cites W2048890665 @default.
• W2030442022 cites W2051024633 @default.
• W2030442022 cites W2054099490 @default.
• W2030442022 cites W2056452930 @default.
• W2030442022 cites W2060115626 @default.
• W2030442022 cites W2068044409 @default.
• W2030442022 cites W2074545460 @default.
• W2030442022 cites W2080690412 @default.
• W2030442022 cites W2085909854 @default.
• W2030442022 cites W2093296161 @default.
• W2030442022 cites W2107828904 @default.
• W2030442022 cites W2110944832 @default.
• W2030442022 cites W2112193336 @default.
• W2030442022 cites W2112632255 @default.
• W2030442022 cites W2125457175 @default.
• W2030442022 cites W2129745115 @default.
• W2030442022 cites W2141923301 @default.
• W2030442022 cites W2147413218 @default.
• W2030442022 cites W2153673003 @default.
• W2030442022 cites W2154804960 @default.
• W2030442022 cites W2169359444 @default.
• W2030442022 cites W2170564808 @default.
• W2030442022 cites W2185058201 @default.
• W2030442022 cites W2279858885 @default.
• W2030442022 cites W2319467927 @default.
• W2030442022 cites W2332525086 @default.
• W2030442022 cites W2334791394 @default.
• W2030442022 cites W2397723481 @default.
• W2030442022 cites W2406670564 @default.
• W2030442022 cites W4256475235 @default.
• W2030442022 doi "https://doi.org/10.1074/jbc.m202993200" @default.
• W2030442022 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12032151" @default.
• W2030442022 hasPublicationYear "2002" @default.
• W2030442022 type Work @default.
• W2030442022 sameAs 2030442022 @default.
• W2030442022 citedByCount "217" @default.
• W2030442022 countsByYear W20304420222012 @default.
• W2030442022 countsByYear W20304420222013 @default.
• W2030442022 countsByYear W20304420222014 @default.
• W2030442022 countsByYear W20304420222015 @default.
• W2030442022 countsByYear W20304420222016 @default.
• W2030442022 countsByYear W20304420222017 @default.
• W2030442022 countsByYear W20304420222018 @default.
• W2030442022 countsByYear W20304420222019 @default.
• W2030442022 countsByYear W20304420222020 @default.
• W2030442022 countsByYear W20304420222021 @default.
• W2030442022 countsByYear W20304420222022 @default.
• W2030442022 countsByYear W20304420222023 @default.
• W2030442022 crossrefType "journal-article" @default.
• W2030442022 hasAuthorship W2030442022A5010352902 @default.
• W2030442022 hasAuthorship W2030442022A5010662099 @default.
• W2030442022 hasAuthorship W2030442022A5013807783 @default.
• W2030442022 hasAuthorship W2030442022A5029940065 @default.
• W2030442022 hasAuthorship W2030442022A5036730904 @default.
• W2030442022 hasAuthorship W2030442022A5046988176 @default.
• W2030442022 hasAuthorship W2030442022A5048810295 @default.
• W2030442022 hasAuthorship W2030442022A5082866305 @default.
• W2030442022 hasBestOaLocation W20304420221 @default.
• W2030442022 hasConcept C104317684 @default.
• W2030442022 hasConcept C150194340 @default.
• W2030442022 hasConcept C153911025 @default.
• W2030442022 hasConcept C164866538 @default.
• W2030442022 hasConcept C185592680 @default.
• W2030442022 hasConcept C199360897 @default.

• next