FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2031037573> ?p ?o ?g. }

• W2031037573 endingPage "32007" @default.
• W2031037573 startingPage "32001" @default.
• W2031037573 abstract "The proline-rich domain of synaptojanin 1, a synaptic protein with phosphatidylinositol phosphatase activity, binds to amphiphysin and to a family of recently discovered proteins known as the SH3p4/8/13, the SH3-GL, or the endophilin family. These interactions are mediated by SH3 domains and are believed to play a regulatory role in synaptic vesicle recycling. We have precisely mapped the target peptides on human synaptojanin that are recognized by the SH3 domains of endophilins and amphiphysin and proven that they are distinct. By a combination of different approaches, selection of phage displayed peptide libraries, substitution analyses of peptides synthesized on cellulose membranes, and a peptide scan spanning a 252-residue long synaptojanin fragment, we have concluded that amphiphysin binds to two sites, PIRPSR and PTIPPR, whereas endophilin has a distinct preferred binding site, PKRPPPPR. The comparison of the results obtained by phage display and substitution analysis permitted the identification of proline and arginine at positions 4 and 6 in the PIRPSR and PTIPPR target sequence as the major determinants of the recognition specificity mediated by the SH3 domain of amphiphysin 1. More complex is the structural rationalization of the preferred endophilin ligands where SH3 binding cannot be easily interpreted in the framework of the “classical” type I or type II SH3 binding models. Our results suggest that the binding repertoire of SH3 domains may be more complex than originally predicted. The proline-rich domain of synaptojanin 1, a synaptic protein with phosphatidylinositol phosphatase activity, binds to amphiphysin and to a family of recently discovered proteins known as the SH3p4/8/13, the SH3-GL, or the endophilin family. These interactions are mediated by SH3 domains and are believed to play a regulatory role in synaptic vesicle recycling. We have precisely mapped the target peptides on human synaptojanin that are recognized by the SH3 domains of endophilins and amphiphysin and proven that they are distinct. By a combination of different approaches, selection of phage displayed peptide libraries, substitution analyses of peptides synthesized on cellulose membranes, and a peptide scan spanning a 252-residue long synaptojanin fragment, we have concluded that amphiphysin binds to two sites, PIRPSR and PTIPPR, whereas endophilin has a distinct preferred binding site, PKRPPPPR. The comparison of the results obtained by phage display and substitution analysis permitted the identification of proline and arginine at positions 4 and 6 in the PIRPSR and PTIPPR target sequence as the major determinants of the recognition specificity mediated by the SH3 domain of amphiphysin 1. More complex is the structural rationalization of the preferred endophilin ligands where SH3 binding cannot be easily interpreted in the framework of the “classical” type I or type II SH3 binding models. Our results suggest that the binding repertoire of SH3 domains may be more complex than originally predicted. SH3 domains bind to proline-rich peptides that fold into a polyproline type 2 helix. Many SH3-binding proteins contain relatively long proline-rich domains (PRD) 1The abbreviations used are:PRDproline-rich domainsGSTglutathione S-transferaseELISAenzyme-linked immunosorbent assayPBSphosphate-buffered salinePCRpolymerase chain reactionSynsynaptojanin1The abbreviations used are:PRDproline-rich domainsGSTglutathione S-transferaseELISAenzyme-linked immunosorbent assayPBSphosphate-buffered salinePCRpolymerase chain reactionSynsynaptojanin with multiple potential SH3 interaction sites (1Gout I. Dhand R. Hiles I.D. Fry M.J. Panayotou G. Das P. Truong O. Totty N.F. Hsuan J. Booker G.W. Campbell I.D. Waterfield M.D. Cell. 1993; 75: 25-36Abstract Full Text PDF PubMed Scopus (483) Google Scholar, 2McPherson P.S. Czernik A.J. Chilcote T.J. Onofri F. Benfenati F. Greengard P. Schlessinger J. De Camilli P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 6486-6490Crossref PubMed Scopus (149) Google Scholar, 3de Heuvel E. Bell A.W. Ramjaun A.R. Wong K. Sossin W.S. McPherson P.S. J. Biol. Chem. 1997; 272: 8710-8716Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar, 4Anderson B.L. Boldogh I. Evangelista M. Boone C. Greene L.A. Pon L.A. J. Cell Biol. 1998; 141: 1357-1370Crossref PubMed Scopus (103) Google Scholar). Given the relatively low specificity of peptide recognition mediated by SH3 domains, it is not clear whether all these interactions, which are identified in vitro, are of functional significance. A second question that arises is whether SH3 domains bind rather unspecifically to many sites along the PRD or rather form specific complexes by binding to unique and distinct sites. proline-rich domains glutathione S-transferase enzyme-linked immunosorbent assay phosphate-buffered saline polymerase chain reaction synaptojanin proline-rich domains glutathione S-transferase enzyme-linked immunosorbent assay phosphate-buffered saline polymerase chain reaction synaptojanin Dynamin, synaptojanin, and synapsin, three proteins that are concentrated in the pre-synaptic region of nerve terminals, bear proline-rich regions that bind to diverse SH3-containing proteins. Synapsin I is the main synaptic ligand of the SH3 domain of the adapter protein Grb2 in vitro (2McPherson P.S. Czernik A.J. Chilcote T.J. Onofri F. Benfenati F. Greengard P. Schlessinger J. De Camilli P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 6486-6490Crossref PubMed Scopus (149) Google Scholar). Recently it has been reported that the same proline-rich D region of synapsin I interacts with c-Src and stimulates its tyrosine kinase activity (5Onofri F. Giovedi S. Vaccaro P. Czernik A.J. Valtorta F. De Camilli P. Greengard P. Benfenati F. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12168-12173Crossref PubMed Scopus (58) Google Scholar). The physiological significance of these interactions is not clear yet. In contrast, strong evidence supports the notion that disruption of the interaction between amphiphysin and the PRD of dynamin impairs synaptic vesicle endocytosis (6Shupliakov O. Low P. Grabs D. Gad H. Chen H. David C. Takei K. De Camilli P. Brodin L. Science. 1997; 276: 259-263Crossref PubMed Scopus (398) Google Scholar). Dynamin is a GTPase that forms a collar at the neck of forming endocytic vesicles and participates in the fission process that results in the formation of free vesicles (7Takei K. McPherson P.S. Schmid S.L. De Camilli P. Nature. 1995; 374: 186-190Crossref PubMed Scopus (651) Google Scholar). Several other SH3-containing proteins have been shown to bind to dynamin in vitro (1Gout I. Dhand R. Hiles I.D. Fry M.J. Panayotou G. Das P. Truong O. Totty N.F. Hsuan J. Booker G.W. Campbell I.D. Waterfield M.D. Cell. 1993; 75: 25-36Abstract Full Text PDF PubMed Scopus (483) Google Scholar, 8Seedorf K. Kostka G. Lammers R. Bashkin P. Daly R. Burgess W.H. van der Bliek A.M. Schlessinger J. Ullrich A. J. Biol. Chem. 1994; 269: 16009-16014Abstract Full Text PDF PubMed Google Scholar, 9Okamoto P.M. Herskovits J.S. Vallee R.B. J. Biol. Chem. 1997; 272: 11629-11635Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar, 10Qualmann B. Roos J. DiGregorio P.J. Kelly R.B. Mol. Biol. Cell. 1999; 10: 501-513Crossref PubMed Scopus (246) Google Scholar). Synaptojanin is a third protein, concentrated in the pre-synaptic compartment, that contains a carboxyl-terminal PRD. This protein was initially discovered as it binds to the SH3 domains of Grb2 (2McPherson P.S. Czernik A.J. Chilcote T.J. Onofri F. Benfenati F. Greengard P. Schlessinger J. De Camilli P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 6486-6490Crossref PubMed Scopus (149) Google Scholar) and was subsequently characterized as an inositol 5-phosphatase that dephosphorylates inositol 1,4,5-trisphosphate, inositol 1,3,4,5-tetrakisphosphate, and phosphatidylinositol 4,5-bisphosphate at the 5 position of the inositol ring (11McPherson P.S. Garcia E.P. Slepnev V.I. David C. Zhang X. Grabs D. Sossin W.S. Bauerfeind R. Nemoto Y. De Camilli P. Nature. 1996; 379: 353-357Crossref PubMed Scopus (486) Google Scholar). A direct involvement of synaptojanin in vesicle endocytosis has not been demonstrated. However, its localization, and the recognition that phosphate metabolism is implicated in a variety of membrane trafficking events (12De Camilli P. Emr S.D. McPherson P.S. Novick P. Science. 1996; 271: 1533-1539Crossref PubMed Scopus (659) Google Scholar), has steered considerable interest in its potential role in endocytosis. Confirming this notion, the disruption of three synaptojanin orthologous yeast genes, singly and in pairs, resulted in mutant strains with abnormal vacuolar and plasma membrane morphology as well as increased sensitivity to osmotic stress and defects in endocytosis (13Srinivasan S. Seaman M. Nemoto Y. Daniell L. Suchy S.F. Emr S. De Camilli P. Nussbaum R. Eur. J. Cell Biol. 1997; 74: 350-360PubMed Google Scholar, 14Singer-Kruger B. Nemoto Y. Daniell L. Ferro-Novick S. Camilli P.D. J. Cell Sci. 1998; 111: 3347-3356PubMed Google Scholar). Finally the carboxyl terminus of synaptojanin binds to the SH3 domains of amphiphysins (isoforms 1 and 2), an eterodimeric protein with an established role in endocytosis (6Shupliakov O. Low P. Grabs D. Gad H. Chen H. David C. Takei K. De Camilli P. Brodin L. Science. 1997; 276: 259-263Crossref PubMed Scopus (398) Google Scholar, 15Munn A.L. Stevenson B.J. Geli M.I. Riezman H. Mol. Biol. Cell. 1995; 6: 1721-1742Crossref PubMed Scopus (279) Google Scholar, 16Wigge P. Vallis Y. McMahon H.T. Curr. Biol. 1997; 7: 554-560Abstract Full Text Full Text PDF PubMed Scopus (154) Google Scholar, 17Owen D.J. Wigge P. Vallis Y. Moore J.D. Evans P.R. McMahon H.T. EMBO J. 1998; 17: 5273-5285Crossref PubMed Scopus (142) Google Scholar). Recently, another SH3-containing protein of 40 kDa was found to bind to synaptojanin in overlay assays or in the yeast 2-hybrid system (3de Heuvel E. Bell A.W. Ramjaun A.R. Wong K. Sossin W.S. McPherson P.S. J. Biol. Chem. 1997; 272: 8710-8716Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar, 18Ringstad N. Nemoto Y. De Camilli P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8569-8574Crossref PubMed Scopus (326) Google Scholar). This 40-kDa protein is a member of a family of three very homologous proteins that were originally identified in a mouse expression library (19Sparks A.B. Hoffman N.G. McConnell S.J. Fowlkes D.M. Kay B.K. Nat. Biotechnol. 1996; 14: 741-744Crossref PubMed Scopus (213) Google Scholar) and independently cloned by a degenerate oligonucleotide amplification approach from human brain cDNA (20Giachino C. Lantelme E. Lanzetti L. Saccone S. Bella Valle G. Migone N. Genomics. 1997; 41: 427-434Crossref PubMed Scopus (84) Google Scholar). The members of this family were named SH3p4, SH3p8, and SH3p16 in mouse and GL2, GL1, and GL3 in man. Recently, Micheva et al. (22Micheva K.D. Kay B.K. McPherson P.S. J. Biol. Chem. 1997; 272: 27239-27245Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar) have proposed to rename SH3p4/GL2 into endophilin, based on its affinity for several endocytic proteins. Here, for sake of clarity, we will refer to all three members of this family as endophilins while maintaining the SH3-GL numbering. Thus endophilins 1, 2, and 3 correspond to SH3-GL1/SH3p3, SH3-GL2/SH3p4, and SH3-GL3/SH3p13, respectively. The three members of the endophilin family bind to synaptojanin isoform 1 but not to isoform 2 (21Nemoto Y. Arribas M. Haffner C. DeCamilli P. J. Biol. Chem. 1997; 272: 30817-30821Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Endophilin 2 has been more extensively characterized because of its prominent localization in the central nervous system (18Ringstad N. Nemoto Y. De Camilli P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8569-8574Crossref PubMed Scopus (326) Google Scholar, 20Giachino C. Lantelme E. Lanzetti L. Saccone S. Bella Valle G. Migone N. Genomics. 1997; 41: 427-434Crossref PubMed Scopus (84) Google Scholar). The suggestion that the SH3-mediated binding of amphiphysin and endophilin 2 to synaptojanin 1 is of physiological significance is reinforced by the observation that the three proteins form two distinct complexes that can be immunoprecipitated from brain extracts (22Micheva K.D. Kay B.K. McPherson P.S. J. Biol. Chem. 1997; 272: 27239-27245Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar). Amphiphysin is found in a complex with synaptojanin 1 and dynamin, whereas endophilin 2 can be immunoprecipitated with synaptojanin 1. In this work we describe the recognition specificity of the SH3 domains of amphiphysin 1 and endophilins and the mapping of their binding sites on the synaptojanin 1 PRD. Library construction and panning were performed as described (23Felici F. Castagnoli L. Musacchio A. Jappelli R. Cesareni G. J. Mol. Biol. 1991; 222: 301-310Crossref PubMed Scopus (390) Google Scholar, 24Pelicci G. Dente L. De Giuseppe A. Verducci-Galletti B. Giuli S. Mele S. Vetriani C. Giorgio M. Pandolfi P.P. Cesareni G. Pelicci P.G. Oncogene. 1996; 13: 633-641PubMed Google Scholar). Briefly, 2–20 μg of GST-SH3 fusion protein bound to glutathione-Sepharose 4B gel (Amersham Pharmacia Biotech) were incubated with 1010 infectious particles from a nonapeptide library. After washing 10 times with PBS, 0.5% Tween 20, the bound phage was eluted with 100 mmglycine HCl, pH 2.2. After three selection cycles, the binding of isolated clones was confirmed by ELISA. Microtiter wells were coated with 109 particles of a clonal phage stock and incubated with 0.2 μg of GST-SH3 fusion protein. The wells were then washed 10 times with PBS, 0.1 Tween 20, and bound protein was detected with anti-GST goat primary antibody (Amersham Pharmacia Biotech) and a secondary anti-goat monoclonal alkaline phosphatase-conjugated antibody (Sigma). Clones with strong SH3 binding activity were selected for further analysis. The sequence of the peptides displayed by positive clones were determined by manual and automatic (ABI PRISM 310 Perkin-Elmer) sequencing of phage single-stranded DNA using universal M13–40 primer. An endophilin 1 clone from a human fetal brain cDNA library (20Giachino C. Lantelme E. Lanzetti L. Saccone S. Bella Valle G. Migone N. Genomics. 1997; 41: 427-434Crossref PubMed Scopus (84) Google Scholar) was used as template in PCR to generate endophilin 1-SH3 coding fragment (residues 302–368) with the forward primer 5′-AGGGATCCATGGCGCCCCTGGACCAG-3′ (GL1-F12) and the reverse primer 5′-GGGAATTCTGCCGGCCAGTGTGGACG-3′ (GL1-R16). Similarly an endophilin 2 clone was used as template to generate an endophilin 2-SH3 coding fragment (residues 286–352) with the forward primer 5′-AGGGATCCGGTGTCCAAATGGATCAGC (GL2-F8) and with the reverse primer 5′-GGGAATTCGAGCCAGCCAGCATAACATC (GL2-R7). Finally EST 22353 clone was used as template to generate endophilin 3-SH3 fusion (residues 281–347) using the forward primer 5′-AGGGATCCAACATTCCCATGGACCAG-3′(GL3-F10) and the reverse primer 5′-GGTGTGAATTCATTTCAGTTACGA-3′ (GL3-R2). All the endophilin-SH3 coding fragments were cloned in frame into BamHI-EcoRI sites of pGEX-4T-2 (Amersham Pharmacia Biotech), and the GST fusion proteins were expressed and purified as suggested by the producers. A λgt10 cDNA expression library from human fetal brain was used as a template in PCR with Super Taq DNA polymerase (HT Biotechnology LTD) to generate the amphiphysin I-SH3 GST fusion (residues 620–695). The amphiphysin SH3 domain coding sequence was amplified with the forward primer 5′-CTCAGGGATCCCCTCCTGGCTTTCTCTAC (Af) and the reverse primer 5′-CTTGTGAATTCAATCTAAGCGTCGGGTGAAG (Ar). The synaptojanin DNA fragment encoding the proline-rich carboxyl-terminal region called F1 (residues 1058–1119) was isolated, by PCR amplification, from a human brain cDNA library. The fragment was amplified with the forward primer 5′-CTACAGGATCCGAGGGTCCTGTACCT (F1-f) and the reverse primer 5′-GTGGGGGAATTCGGCGTGTGGGAGGGGCGA (F1-r). Synaptojanin mutants of the fragment F1 called F1-a1m and F1-e2m were obtained by PCR amplification with mutagenic oligonucleotides. The oligonucleotides utilized to mutagenize the putative amphiphysin ad endophilin targets were CGAGGGTCCTGTACCTTCACTTCCCATCCCACCAAGCCCAGCACCGTCA (a1m-f) and GGCGTGTGGGAGGGGCGACAGGGCGGGGCGGCGGCGGCGGCGGGGGCTCCAAG (e2m-r) respectively. The synaptojanin DNA fragment encoding the proline-rich carboxyl-terminal region F2 (residues 1110–1222) was isolated by PCR from a human brain cDNA library. The fragment was amplified with the forward primer 5′-AAGAGAGGATCCCCACCCCGCCCGGTCGCC (F2-f) and with the reverse primer 5′-GCTTTTGAATTCAGGAGTCAGTCTTCCAGCA (F2-r). Synaptojanin mutant of the fragment F2, F2-a2m, was obtained using the U.S.E. Mutagenic Kit (Amersham Pharmacia Biotech) with the mutagenic oligonucleotide 5′-CCAGCAGGAGGAGGACTCGTCGGTCTGGC. The synaptojanin DNA fragment encoding the region F3 (residues 1212–1302) was isolated by PCR from a human brain cDNA library with the forward primer 5′-CACAGGGATCCGCGCGGGCATCTGCTGGA (F3-f) and with the reverse primer 5′-ACTTGGAATTCTGAGGAAGCTTCTGAAGG (F3-r). All synaptojanin fragment were cloned in frame intoBamHI-EcoRI sites of pGEX2TK (Amersham Pharmacia Biotech). Rat synaptosomal extracts (25Huttner W.B. Schiebler W. Greengard P. De Camilli P. J. Cell Biol. 1983; 96: 1374-1388Crossref PubMed Scopus (888) Google Scholar) were electrophoresed on 10% SDS-polyacrylamide gel electrophoresis and blotted onto Immobilon-P membranes (Millipore). Strips were blocked overnight at 4 °C in PBS, 0.05% Tween 20, 5% dry milk (blocking solution) and then incubated with 10 μg/ml of the indicated fusion domain in blocking solution for 4 h at room temperature. The Immobilon-P filters were then washed in PBS, 0.05% Tween 20, and the bound proteins were detected with anti-GST primary antibody (Amersham Pharmacia Biotech) and a secondary anti-goat monoclonal alkaline phosphatase-conjugated antibody (Sigma). In the binding assay different amounts of the indicated fusion domains were electrophoresed on 10% SDS-polyacrylamide gel electrophoresis and blotted onto Immobilon-P membranes that were incubated in blocking solution for 5 h at 4 °C. The filters were then incubated with 10 μg/ml hybrid GST proteins phosphorylated with bovine heart protein kinase (Sigma). Peptides bound to continuous cellulose membrane supports were prepared by automated spot synthesis (Abimed, Langenfeld, Germany; Software LISA, Jerini BioTools GmbH, Berlin, Germany) using Whatman 50 cellulose membrane (Whatman, Maidstone, UK) as described previously in detail (26Frank R. Tetrahedron. 1992; 48: 9217-9232Crossref Scopus (920) Google Scholar, 27Kramer A. Volkmer-Engert R. Malin R. Reineke U. Schneider- Mergener J. Pept. Res. 1993; 6: 314-319PubMed Google Scholar, 28Kramer A. Schneider-Mergener J. Methods Mol. Biol. 1998; 87: 25-39PubMed Google Scholar, 29Frank R. Overwin H. Methods Mol. Biol. 1996; 66: 149-169PubMed Google Scholar). All peptides were amino-terminally acetylated using acetanhydride and diisopropylethylamine. In order to determine the recognition specificity of the human amphiphysin and endophilins SH3 domains, we used these domains to select peptide ligands from a peptide repertoire displayed by fusion to the major capsid protein of filamentous f1 phage. The SH3 domains of amphiphysin 1 and endophilins 1, 2, and 3 were produced by cloning their coding sequence into a GST fusion expression vector, and the affinity purified domains were used to pan a nonapeptide library (23Felici F. Castagnoli L. Musacchio A. Jappelli R. Cesareni G. J. Mol. Biol. 1991; 222: 301-310Crossref PubMed Scopus (390) Google Scholar). After three selection cycles, 20 single clones, derived from each of the four panning experiments, were tested by phage ELISA, and the amino acid sequence of the peptides displayed by the positive ones (approximately 50%) were derived from the DNA sequence of the gene VIII insert. In Fig. 1 we have aligned the peptide sequences, obtained from each selection experiment, to maximize peptide homology. Endophilins 1 and 2 selected a limited number of peptides that were found repeatedly and whose amino acid sequence can be represented by the consensus P+RPPXpr, where the residues in capital letters are always found at the corresponding position in each selected peptide, + represents either Lys or Arg, andX any amino acid. The SH3 domain of endophilin 3 is more tolerant in the second position of the consensus, where other residues aside from Arg and Lys can be accepted. The P+RPPXpr motif is always preceded either by a positively charged residue or by the phenylalanine that in the PVIII phage coat protein immediately precedes the inserted peptide. The SH3 domain of amphiphysin, in contrast, selects peptides that conform to the consensus RPXR. Since the amino acid sequences of these peptides can be aligned without shifting their frame, it is possible that flanking residues in the pVIII coding sequence may be important in the binding process. To confirm their recognition specificity, we tested the four domains, plus the SH3 of the MYO3 yeast protein as a control, by phage ELISA against a panel of phage clones whose sequences were considered representative of the consensus in Fig. 1. As illustrated in Fig.2, phages displaying peptides containing the PKRPP or PRRPP motifs were recognized by the three SH3 of the endophilins but not from the ones of amphiphysin 1 or the control MYO3p. In contrast, peptides containing a single positively charged residue, PPRPP or PQRPP, only reacted with endophilin 3. Finally, peptides conforming to the consensus derived from the amphiphysin 1 panning experiment predominantly bound to the amphiphysin SH3. In order to confirm the results obtained by phage display, we performed a competition experiment in which overlay binding of endophilin 2 SH3 was carried out in the presence of 100 μm of the biotinylated peptide GSGSPKRPPLPRS. In these conditions the dynamin and synaptojanin signals (3de Heuvel E. Bell A.W. Ramjaun A.R. Wong K. Sossin W.S. McPherson P.S. J. Biol. Chem. 1997; 272: 8710-8716Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar) are reduced by approximately 70% and completely disappear when the peptide is tetramerized with streptavidin (Fig. 3, lanes 3 and4). No reduction in signal is observed when a tetramerized peptide specific for the Abl SH3 domain (GSGSAPTYPPPLPP) is used for competition (lane 5). Similar results are obtained by competing with a phage displayed peptide (lanes 6–8). Inspection of the synaptojanin sequence revealed two putative targets, in the carboxyl-terminal PRD, that match the endophilin 2 and amphiphysin recognition consensus P+RPPXpr and RPXR. To verify, with a phage independent approach, the SH3 binding ability of these sequences and to identify the residues that are essential for binding, we have synthesized peptides on a cellulose membrane representing all possible single amino acid substitution analogs (30Kramer A. Keitel T. Winkler K. Stocklein W. Hohne W. Schneider-Mergener J. Cell. 1997; 91: 799-809Abstract Full Text Full Text PDF PubMed Scopus (166) Google Scholar) of the synaptojanin-derived peptides LPIRPSRAPSR (Syn1064–1074) and LEPKRPPPPRP (Syn1103–1113) (where boldface indicates the residues that match the consensus deduced from the results of the phage display experiments). The 460 matrix-bound peptides generated by this approach were then probed with the SH3 domains of amphiphysin 1 and endophilin 2 cross-linked to horseradish peroxidase (Fig. 4). As predicted, the amphiphysin SH3 domain binds efficiently to peptide Syn1064–1074 while there is hardly any binding to peptide Syn1103–1113 (Fig. 4 A). Furthermore, the intensity of the binding signal is sensitive to substitutions in the RPXR motif, confirming the phage display analysis. The proline and the second arginine in the motif are absolutely required, whereas the first arginine tolerates substitutions with isoleucine, proline, or valine. The first proline of the canonical SH3 recognition motif PXXP can also be substituted with large hydrophobic residues (Phe, Ile, Leu, Met, and Val) with minimal variations in binding signal. Most of the single amino acid substitutions of peptide LEPKRPPPPRP do not react with the amphiphysin SH3 domain. Interestingly the most reactive spot corresponds to a peptide that, as a result of mutagenesis, contains an RPXR motif (LEPKRPPRPRP. Surprisingly, and somewhat in contrast with the phage ELISA experiment, the endophilin 2 SH3 domain binds with higher affinity to peptide Syn1064–1074 than to peptide Syn1103–1113(Fig. 4 B). The substitution analysis reveals that peptide 2 does not bind to the endophilin SH3 because of the negatively charged residue that precedes the PKRPP motif. Whenever the Glu at position 2 is changed into a residue with either a positive or a hydrophobic side chain, binding is restored. This is in accord with the results of the phage display experiment that indicated that positive residues and Phe are preferred at that position (see Fig. 1). When a 5-fold higher membrane-bound peptide concentration is used in a similar experiment, a stronger signal is obtained, and residues that are important for recognition specificity are revealed (Fig. 4 C). Cys and negatively charged residues are hardly admitted at any position. Consistent with the phage display results, the residues in the PKRPPXPR motif do not tolerate the vast majority of substitutions. The endophilin SH3 binds to peptide Syn1064–1074 only marginally less efficiently than the amphiphysin SH3. Binding, however, is less specific and displays a different sensitivity to amino acid substitutions. Substitution of the first Arg of the RPXR motif severely affects binding, whereas the second Arg tolerates hydrophobic side chains. The remaining peptide residues are rather tolerant as long as Cys, Asp, Glu, or Tyr are avoided. According to the substitution analysis, the peptide LEPKRPPPPRP is a suboptimal ligand for the endophilin SH3 domain. In order to identify alternative sequences in synaptojanin that may be involved in endophilin and amphiphysin SH3 binding, we synthesized 126 overlapping undecapeptides spanning the entire carboxyl-terminal region of human synaptojanin (Fig. 5). In agreement with the phage display experiment, the amphiphysin SH3 reacts with cellulose-bound peptides containing the sequence LPIRPSR (region A1) that exactly matches the RPXR consensus. Two more regions, containing thePTIPPRA (region A2) and PPQPPPRSR (region A3) sequences, showed significant binding in agreement with the substitution experiment that indicated that the first arginine in the motif could be substituted with isoleucine or proline. More complex is the binding pattern obtained with the endophilin SH3. We identified three main regions as putative ligands of this domain. Regions E1 and E3 overlap sequences that were already mapped as amphiphysin targets (A1 and A3), whereas region E2 probably including two binding motifs, encompasses the endophilin binding consensus PKRPP, and extends approximately 15 amino acids beyond. The likely biological significance of these SH3 target sites is supported by the observation that their sequences and binding properties are conserved in the rat synaptojanin (not shown). To confirm the mapping of SH3 targets obtained with the Pep-Scan experiment, we expressed three different fragments of the synaptojanin carboxyl terminus, as fusion to GST. Fragment 1 (F1) contains targets A1 (E1) and E2, fragment 2 (F2) E2′ and A2, and fragment 3 (F3) A3 (E3) (Fig.6 A). Fig. 6 Breports the results of an overlay experiment where the three fragments were transferred to nitrocellulose filters and probed with32P-labeled chimeric GST-SH3 proteins. Both the amphiphysin and endophilin SH3 bind to fragment F1. F2 binds to amphiphysin and to a lesser degree to endophilin. Interestingly the endophilin SH3 binds to the degradation products of the GST-F2 protein as efficiently as to the full-length protein, whereas the amphiphysin SH3 only binds to the non-degraded protein. This suggests that the first domain binds to the NH2-terminal side of the F2 fragment, whereas the latter binds to a peptide target that is close to the COOH-terminal side. Finally fragment F3 contains a target site for amphiphysin only. These results are in agreement with the Pep-Scan experiment that suggested that synaptojanin contains multiple binding sites for the amphiphysin and endophilin SH3s. At the same time, they contribute to rank the affinities of the putative peptide targets in a larger protein context: A1 ≈ A2 > A3 and E1 + E2 > E2′ ≫ E3. To map precisely the SH3 target peptides, predicted by the phage display and Pep-Scan experiments, in this larger protein context, we expressed fusion proteins containing fragments of synaptojanin mutated in the strongest putative binding sites, A1 (E1), E2, and A2 (Fig.6 C). The endophilin SH3 binds to the synaptojanin fragment carrying a mutation in the A1(E1) site as efficiently as the wild type fragment, whereas most of the affinity is lost when the two positively charged residues in the PKRPPP motif are changed into Pro (e2m). In contrast, amphiphysin recognition of the F1 fragment is almost abolished when the LPIRPSR motif in the A1 site is changed into LPIPPSP (a1m). Finally the binding of the amphiphysin SH3 to the F2 fragment is dependent on the PTIPPR peptide (A2) identified by Pep-Scan since binding is abolished when the sequence is changed into PTSPPP (a2m). In contrast to the Pep-Scan analysis, this last experiment suggests that, in a larger protein context, the peptide PKRPPXPR is the major target of the endophilin 2-SH3. To exclude artifacts due to the technical approach, we confirmed this conclusion by analyzing the binding of the endophilin SH3 (cross-linked to tos" @default.
• W2031037573 created "2016-06-24" @default.
• W2031037573 creator A5003232516 @default.
• W2031037573 creator A5013874274 @default.
• W2031037573 creator A5015492113 @default.
• W2031037573 creator A5018540028 @default.
• W2031037573 creator A5029338279 @default.
• W2031037573 creator A5037088444 @default.
• W2031037573 creator A5059226470 @default.
• W2031037573 creator A5076468111 @default.
• W2031037573 creator A5077424674 @default.
• W2031037573 date "1999-11-01" @default.
• W2031037573 modified "2023-09-29" @default.
• W2031037573 title "The SH3 Domains of Endophilin and Amphiphysin Bind to the Proline-rich Region of Synaptojanin 1 at Distinct Sites That Display an Unconventional Binding Specificity" @default.
• W2031037573 cites W1491028479 @default.
• W2031037573 cites W1522400918 @default.
• W2031037573 cites W1529429589 @default.
• W2031037573 cites W1965030023 @default.
• W2031037573 cites W1967448808 @default.
• W2031037573 cites W1969403795 @default.
• W2031037573 cites W1978627586 @default.
• W2031037573 cites W1990516841 @default.
• W2031037573 cites W1999922223 @default.
• W2031037573 cites W2001545071 @default.
• W2031037573 cites W2002038355 @default.
• W2031037573 cites W2020171884 @default.
• W2031037573 cites W2022257442 @default.
• W2031037573 cites W2024272753 @default.
• W2031037573 cites W2029500247 @default.
• W2031037573 cites W2029818294 @default.
• W2031037573 cites W2031907844 @default.
• W2031037573 cites W2037425715 @default.
• W2031037573 cites W2041396416 @default.
• W2031037573 cites W2055455533 @default.
• W2031037573 cites W2056189051 @default.
• W2031037573 cites W2071080970 @default.
• W2031037573 cites W2076364749 @default.
• W2031037573 cites W2076636373 @default.
• W2031037573 cites W2080037386 @default.
• W2031037573 cites W2082426787 @default.
• W2031037573 cites W2091067968 @default.
• W2031037573 cites W2098552577 @default.
• W2031037573 cites W2108264768 @default.
• W2031037573 cites W2131411591 @default.
• W2031037573 cites W2143369277 @default.
• W2031037573 cites W2153261854 @default.
• W2031037573 cites W2160625381 @default.
• W2031037573 cites W2168210807 @default.
• W2031037573 cites W2171059473 @default.
• W2031037573 cites W2397217808 @default.
• W2031037573 cites W62276193 @default.
• W2031037573 cites W77973074 @default.
• W2031037573 doi "https://doi.org/10.1074/jbc.274.45.32001" @default.
• W2031037573 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10542231" @default.
• W2031037573 hasPublicationYear "1999" @default.
• W2031037573 type Work @default.
• W2031037573 sameAs 2031037573 @default.
• W2031037573 citedByCount "123" @default.
• W2031037573 countsByYear W20310375732012 @default.
• W2031037573 countsByYear W20310375732013 @default.
• W2031037573 countsByYear W20310375732014 @default.
• W2031037573 countsByYear W20310375732015 @default.
• W2031037573 countsByYear W20310375732016 @default.
• W2031037573 countsByYear W20310375732017 @default.
• W2031037573 countsByYear W20310375732018 @default.
• W2031037573 countsByYear W20310375732019 @default.
• W2031037573 countsByYear W20310375732020 @default.
• W2031037573 countsByYear W20310375732021 @default.
• W2031037573 countsByYear W20310375732022 @default.
• W2031037573 countsByYear W20310375732023 @default.
• W2031037573 crossrefType "journal-article" @default.
• W2031037573 hasAuthorship W2031037573A5003232516 @default.
• W2031037573 hasAuthorship W2031037573A5013874274 @default.
• W2031037573 hasAuthorship W2031037573A5015492113 @default.
• W2031037573 hasAuthorship W2031037573A5018540028 @default.
• W2031037573 hasAuthorship W2031037573A5029338279 @default.
• W2031037573 hasAuthorship W2031037573A5037088444 @default.
• W2031037573 hasAuthorship W2031037573A5059226470 @default.
• W2031037573 hasAuthorship W2031037573A5076468111 @default.
• W2031037573 hasAuthorship W2031037573A5077424674 @default.
• W2031037573 hasBestOaLocation W20310375731 @default.
• W2031037573 hasConcept C108636557 @default.
• W2031037573 hasConcept C12554922 @default.
• W2031037573 hasConcept C156407911 @default.
• W2031037573 hasConcept C170493617 @default.
• W2031037573 hasConcept C183786373 @default.
• W2031037573 hasConcept C185592680 @default.
• W2031037573 hasConcept C196347352 @default.
• W2031037573 hasConcept C2780976139 @default.
• W2031037573 hasConcept C28005876 @default.
• W2031037573 hasConcept C55493867 @default.
• W2031037573 hasConcept C86803240 @default.
• W2031037573 hasConcept C95444343 @default.
• W2031037573 hasConceptScore W2031037573C108636557 @default.
• W2031037573 hasConceptScore W2031037573C12554922 @default.
• W2031037573 hasConceptScore W2031037573C156407911 @default.
• W2031037573 hasConceptScore W2031037573C170493617 @default.
• W2031037573 hasConceptScore W2031037573C183786373 @default.

• next