FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2031900580> ?p ?o ?g. }

• W2031900580 endingPage "6859" @default.
• W2031900580 startingPage "6850" @default.
• W2031900580 abstract "In Escherichia coli K-12, the RecA- and transposase-independent precise excision of transposons is thought to be mediated by the slippage of the DNA polymerase between the two short direct repeats that flank the transposon. Inactivation of the uup gene, encoding an ATP-binding cassette (ABC) ATPase, led to an important increase in the frequency of precise excision of transposons Tn10 and Tn5 and a defective growth of bacteriophage Mu. To provide insight into the mechanism of Uup in transposon excision, we purified this protein, and we demonstrated that it is a cytosolic ABC protein. Purified recombinant Uup binds and hydrolyzes ATP and undergoes a large conformational change in the presence of this nucleotide. This change affects a carboxyl-terminal domain of the protein that displays predicted structural homology with the socalled little finger domain of Y family DNA polymerases. In these enzymes, this domain is involved in DNA binding and in the processivity of replication. We show that Uup binds to DNA and that this binding is in part dependent on its carboxyl-terminal domain. Analysis of Walker motif B mutants suggests that ATP hydrolysis at the two ABC domains is strictly coordinated and is essential for the function of Uup in vivo. In Escherichia coli K-12, the RecA- and transposase-independent precise excision of transposons is thought to be mediated by the slippage of the DNA polymerase between the two short direct repeats that flank the transposon. Inactivation of the uup gene, encoding an ATP-binding cassette (ABC) ATPase, led to an important increase in the frequency of precise excision of transposons Tn10 and Tn5 and a defective growth of bacteriophage Mu. To provide insight into the mechanism of Uup in transposon excision, we purified this protein, and we demonstrated that it is a cytosolic ABC protein. Purified recombinant Uup binds and hydrolyzes ATP and undergoes a large conformational change in the presence of this nucleotide. This change affects a carboxyl-terminal domain of the protein that displays predicted structural homology with the socalled little finger domain of Y family DNA polymerases. In these enzymes, this domain is involved in DNA binding and in the processivity of replication. We show that Uup binds to DNA and that this binding is in part dependent on its carboxyl-terminal domain. Analysis of Walker motif B mutants suggests that ATP hydrolysis at the two ABC domains is strictly coordinated and is essential for the function of Uup in vivo. Mutations and genetic rearrangements are frequently associated with repetitive DNA sequences (1Lovett S.T. Mol. Microbiol. 2004; 52: 1243-1253Crossref PubMed Scopus (194) Google Scholar). Genetic rearrangements are the deletion or expansion of repeated DNA sequences, leading to genomic changes that are important for bacterial survival or evolution (2van Belkum A. Cell. Mol. Life Sci. 1999; 56: 729-734Crossref PubMed Scopus (64) Google Scholar). Transposon precise excision is a special case of deletion at short direct repeats created by the transposition mechanism and facilitated by the large inverted repeats constituting the insertion sequences of these elements (3Foster T.J. Lundblad V. Hanley-Way S. Halling S.M. Kleckner N. Cell. 1981; 23: 215-227Abstract Full Text PDF PubMed Scopus (109) Google Scholar). Precise and nearly precise excision are host-mediated processes that occur in the absence of recA function or any transposon-encoded functions (3Foster T.J. Lundblad V. Hanley-Way S. Halling S.M. Kleckner N. Cell. 1981; 23: 215-227Abstract Full Text PDF PubMed Scopus (109) Google Scholar). tex (for transposon excision) mutations have been identified that elevate the frequency of these rearrangements (4Lundblad V. Kleckner N. Basic Life Sci. 1982; 20: 245-258PubMed Google Scholar). The mutations include unusual recBC alleles that alter but do not abolish the functions of RecBC (5Lundblad V. Taylor A.F. Smith G.R. Kleckner N. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 824-828Crossref PubMed Scopus (52) Google Scholar) and alleles of genes involved in the methylation-directed pathway for repair of base pair mismatches such as mutS, mutH, mutL, dam, and uvrD (6Lundblad V. Kleckner N. Genetics. 1984; 109: 3-19Crossref Google Scholar). Conditional mutations in ssb, the essential gene encoding the Escherichia coli single-stranded DNA-binding protein SSB, also confer a tex phenotype (6Lundblad V. Kleckner N. Genetics. 1984; 109: 3-19Crossref Google Scholar, 7Reddy M. Gowrishankar J. J. Bacteriol. 1997; 179: 2892-2899Crossref PubMed Google Scholar). Recently it was reported that mutations in topA (toposimerase I), dnaA (DNA polymerase I), and dnaBE (helicase and α-subunits of DNA polymerase III) also lead to the same phenotype (8Nagel R. Chan A. Mutat. Res. 2000; 459: 275-284Crossref PubMed Scopus (8) Google Scholar, 9Reddy M. Gowrishankar J. J. Bacteriol. 2000; 182: 1978-1986Crossref PubMed Scopus (21) Google Scholar). All of these mutations affect genes encoding proteins involved in DNA replication or repair, supporting the notion that deletions are the result of errors during replication (1Lovett S.T. Mol. Microbiol. 2004; 52: 1243-1253Crossref PubMed Scopus (194) Google Scholar).Other tex mutations affect the uup gene and cause an increase in the frequency of precise excision of transposons Tn10, mini-Tn10, and Tn5 and a defective growth of bacteriophage Mu (10Hopkins J.D. Clements M. Syvanen M. J. Bacteriol. 1983; 153: 384-389Crossref PubMed Google Scholar). Molecular cloning and nucleotide sequence determination of the uup gene suggested that the Uup protein is cytosolic and belongs to the superfamily of ATP-binding cassette (ABC) 3The abbreviations used are: ABC, ATP-binding cassette; IPTG, isopropyl thio-β-d-galactoside; NBD, nucleotide-binding domain; Ni-NTA, nickel-nitriloacetic acid; LF, little finger; CTD, carboxyl-terminal domain; HCA, hydrophobic cluster analysis; LD, linker domain.3The abbreviations used are: ABC, ATP-binding cassette; IPTG, isopropyl thio-β-d-galactoside; NBD, nucleotide-binding domain; Ni-NTA, nickel-nitriloacetic acid; LF, little finger; CTD, carboxyl-terminal domain; HCA, hydrophobic cluster analysis; LD, linker domain. proteins (7Reddy M. Gowrishankar J. J. Bacteriol. 1997; 179: 2892-2899Crossref PubMed Google Scholar, 9Reddy M. Gowrishankar J. J. Bacteriol. 2000; 182: 1978-1986Crossref PubMed Scopus (21) Google Scholar). tex mutations affecting transposon precise excision fall into two categories: the first, such as uup, ssb, topA, and polA, increase precise excision of both Tn10 and mini-Tn10; and the second, such as mutHLS, dam, and uvrD, increase precise excision of Tn10 but not of mini-Tn10. The role of Uup in DNA metabolism was never investigated.ABC proteins constitute one of the largest families of paralogues in sequenced genomes (11Higgins C.F. Res. Microbiol. 2001; 152: 205-210Crossref PubMed Scopus (469) Google Scholar). They couple ATP hydrolysis to a wide variety of cellular processes, including transmembrane transport, gene regulation, and DNA repair. All ABC proteins are characterized by the presence of a conserved domain, known as the nucleotide-binding domain (NBD), which contains at least five characteristic sequence motifs (12Davidson A.L. Chen J. Annu. Rev. Biochem. 2004; 73: 241-268Crossref PubMed Scopus (484) Google Scholar). In addition to the Walker motifs A and B identified in many ATPase families, NBDs contain the ABC signature motif (motif S), a conserved glutamine loop (Q-loop or Lid), and a conserved histidine loop (H-loop or Switch). In ABC proteins associated with membrane transport, the NBDs bind and hydrolyze ATP and transmit conformational changes to membrane-spanning domains, which typically form a pathway for the transported substrate (12Davidson A.L. Chen J. Annu. Rev. Biochem. 2004; 73: 241-268Crossref PubMed Scopus (484) Google Scholar). Genome and phylogenetic analyses have identified three classes of ABC proteins that correlate well to functional categories (13Dassa E. Bouige P. Res. Microbiol. 2001; 152: 211-229Crossref PubMed Scopus (366) Google Scholar). Classes 1 and 3 are comprised of exporters and importers, respectively. In contrast, class 2 consists of ABC proteins devoid of transmembrane domains or known transmembrane protein partners and composed of two tandemly repeated ABC domains fused together. Within class 2, phylogenetic analyses identified four subfamilies of proteins in which some members have been involved in antibiotic resistance (ARE), transcription or translation regulation (REG and RLI), and DNA repair (UVR) (13Dassa E. Bouige P. Res. Microbiol. 2001; 152: 211-229Crossref PubMed Scopus (366) Google Scholar, 14Kerr I.D. Biochem. Biophys. Res. Commun. 2004; 315: 166-173Crossref PubMed Scopus (111) Google Scholar). Uup belongs to the REG subfamily, which is comprised mainly of eukaryote and prokaryote proteins with unknown function. However, a few are known to participate in gene expression regulation, although their exact mechanism of action and the role of ATP hydrolysis in their function are unknown. Among the five ATPases of this family that have been studied, the best characterized is the yeast protein GCN20. It associates with another protein, GCN1, to stimulate the activity of GCN2, a kinase that phosphorylates the eukaryotic translation initiation factor eIF2, ultimately leading to increased translation of the transcriptional activator GCN4 in amino acid-starved cells (15Marton M.J. Vazquez de Aldana C.R. Qiu H. Chakraburtty K. Hinnebusch A.G. Mol. Cell. Biol. 1997; 17: 4474-4489Crossref PubMed Google Scholar). In prokaryotes, none of the four proteins have been characterized at the molecular level. The Agrobacterium tumefaciens ChvD protein was found to be inactivated in a mutant selected for the reduced transcription of the virA and virG genes (16Winans S.C. Kerstetter R.A. Nester E.W. J. Bacteriol. 1988; 170: 4047-4054Crossref PubMed Google Scholar). The Caulobacter crescentus HfaC protein was found to be important for the attachment of the holdfast adhesive organelle to the cell (17Kurtz Jr., H.D. Smit J. Smith J. FEMS Microbiol. Lett. 1994; 116: 175-182Crossref PubMed Scopus (22) Google Scholar). In E. coli, inactivation of yheS causes an increase in the periplasmic production of a recombinant Sc-Fv antibody fragment by an unknown mechanism (18Belin P. Dassa J. Drevet P. Lajeunesse E. Savatier A. Boulain J.C. Menez A. Protein Eng. Des. Sel. 2004; 17: 491-500Crossref PubMed Scopus (12) Google Scholar). To date, the sole phenotype reported for uup null mutants is an increase in the frequency of precise excision of transposons and of sequences located between two tandemly repeated sequences (7Reddy M. Gowrishankar J. J. Bacteriol. 1997; 179: 2892-2899Crossref PubMed Google Scholar, 9Reddy M. Gowrishankar J. J. Bacteriol. 2000; 182: 1978-1986Crossref PubMed Scopus (21) Google Scholar, 10Hopkins J.D. Clements M. Syvanen M. J. Bacteriol. 1983; 153: 384-389Crossref PubMed Google Scholar).To provide insight into the mechanism of Uup in transposon excision, we undertook a biochemical and genetic analysis of this protein. In this report, we provide evidence that purified recombinant Uup undergoes a conformational change upon ATP binding. We also demonstrate that recombinant Uup has intrinsic ATPase activity and interacts with DNA in vitro. This binding is in part dependent on the 90-amino acid carboxyl-terminal domain of Uup that shares similarities with little finger domains found in the Y family of DNA polymerases. Analysis of Walker motif B mutants led to the conclusion that ATP hydrolysis at the two ABC domains of the protein is essential for the function of Uup in vivo.EXPERIMENTAL PROCEDURESBacterial Strains and Strain Constructions—Strains are listed in Table 1. All cloning steps were performed with E. coli K-12 strain Top10F′ (Invitrogen). Strain MG1655 was used for construction of mutant DM1. In strain DM1, the uup gene was replaced by an aphA cassette, encoding a kanamycin resistance determinant, by a PCR-based procedure (19Chaveroche M.K. Ghigo J.M. d'Enfert C. Nucleic Acids Res. 2000; 28: E97Crossref PubMed Scopus (336) Google Scholar). Complementation studies were achieved in strains GJ1885 and GJ1886 (7Reddy M. Gowrishankar J. J. Bacteriol. 1997; 179: 2892-2899Crossref PubMed Google Scholar) and in derivatives of the latter. Transductions were performed as described previously (20Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1972: 439Google Scholar). Overexpression of uup alleles placed under the control of the T7 promoter was achieved in E. coli strain BL21(DE3)(pLysS).TABLE 1List of strainsStrainGenotypeSource or Ref.TOP10F′InvitrogenMG1655F− rph-1Laboratory collectionDM1MG1655 uup::aphAIIIThis workGJ1885ara zbh-900::Tn10dKan(Ts)1 lacZ4525::Tn10dKan9GJ1886GJ1885 uup-351::Tn10dTet19MG1655▵araBAD▵lacIZaraBAD::aphAIII ▵lacIZ::apha360DM1987GJ1886 araBAD::aadA7 attB::pBADuupThis workDM1988GJ1886 araBAD::aadA7 attB::pBADuup1This workDM1989GJ1886 araBAD::aadA7 attB::pBADuup2This workDM1990GJ1886 araBAD::aadA7 attB::pBADuup3This workBL21(DE3)(pLysS)F− ompT hsdSB (rB - mB -) gal dcm (λ cIts857 ind1 Sam7 nin5 lacUV(T7 gene1)/pLysS (CmR)Laboratory collection Open table in a new tab Plasmid Constructions—The plasmids used in this study are listed in Table 2. Oligonucleotides used for uup cloning and mutagenesis are listed in Table 3. Standard DNA methods were performed as described previously (21Mourez M. Jehanno M. Schneider E. Dassa E. Mol. Microbiol. 1998; 30: 353-363Crossref PubMed Scopus (33) Google Scholar). PCR amplification was achieved by using the Expand High Fidelity PCR kit (Roche Applied Science) according to the supplier's recommendations. The mutations of the uup gene affecting codons 181 and 465 and the replacement of lysine 551 by a stop codon to construct the carboxyl-terminal domain (CTD) deletion were carried out by site-directed mutagenesis of plasmid pETuup as described in Stratagene's QuikChange protocol. The resulting fusion proteins, His6-UupD181N, His6-UupD465N, His6-UupD181N/D465N, and His6-UupΔCTD called hereafter Uup1, Uup2, Uup3, and UupΔCTD, respectively, contained a 20-amino acid amino-terminal extension (MGSSHHHHHHSSGLVPRGSH). The same point mutations were constructed on a uup gene cloned under the control of araBAD promoter in plasmid pBAD18. Cloned DNA sequences of wild-type and mutants alleles of uup were checked by DNA sequencing (Genome Express, Meylan, France).TABLE 2List of plasmidsNameDescriptionOrigin or Ref.pET15bExpression vector, phage T7 gene 1 promoter (AmpR)NovagenpETuupWild-type uup cloned into pET15b (Ndel and XhoI)This workpETuup1Mutagenized uup on pETuup (D181N)This workpETuup2Mutagenized uup on pETuup (D465N)This workpETuup3Mutagenized uup on pETuup (D181N), (D465N)This workpBAD18Arabinose-inducible expression vector (Ampr)24pBADuupuup wild-type gene cloned into pBAD18 (EcoRI and NdeI)This workpBADuup1Mutagenized uup on pBADuup (D181N)This workpBADuup2Mutagenized uup on pBADuup (D465N)This workpBADuup3Mutagenized uup on pBADuup (D181N/D465N)This work Open table in a new tab TABLE 3List of oligonucleotidesOligonucleotide nameUsed forSequence5DM1Cloning of uup into pET15b and pBAD18CGGAATTCATATGTCATTAATCAGTATGCATGGCGCAT3DM1Cloning of uup into pET15bCCGCTCGAGTCAGCCACCATTTTTTAACGCTTCA5DM2Cloning of uup into pBAD18GGAATTCCGCAGCCTGAAAGGAATAGTAATG5MUT1Site-directed mutagenesis: T541ACCGCGCGTGCTGTTGCTTAATGAACCGAC3MUT1Site-directed mutagenesis: A541TGTCGGTTCATTAAGCAACAGCACGCGCGG5MUT2Site-directed mutagenesis: T1393ACCAAGCAACTTATTGATTCTTAACGAACCGACCAACG3MUT2Site-directed mutagenesis: A1393TCGTTGGTCGGTTCGTTAAGAATCAATAAGTTGCTTGG5CTDSite-directed mutagenesis A1651TGCCGCCGCGGCATAAGCAGAAACTGTAAAAC3CTDSite-directed mutagenesis T1651AGTTTTACAGTTTCTGCTTATGCCGCGGCGGC Open table in a new tab Media, Chemicals, and Growth Conditions—Bacteria were usually grown at 37 °C in Luria-Bertani (LB) medium (20Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1972: 439Google Scholar). Antibiotics were added when required; ampicillin (100 or 50 μg·ml-1 for plasmid and chromosomal constructions, respectively), chloramphenicol (25 μg·ml-1), kanamycin (50 μg·ml-1), spectinomycin (50 μg·ml-1), and tetracycline (12 μg·ml-1). Cells of strain BL21(DE3)(pLysS) carrying pETuup (the wild-type uup gene cloned into pET15b) and pETuupΔCTD were grown in LB medium at 30 °C. Gene expression was induced by the addition of 0.25 mm isopropyl thio-β-d-galactoside (IPTG) at A600 = 0.2 for 3 h. Cells of strain BL21(DE3)(pLysS) harboring pETuup1, pETuup2, and pETuup3, respectively, were grown as described for wild-type pETuup, but gene expression was induced by 0.1 mm IPTG.Purification of His6-Uup and Its Variants—All purification protocols were carried out at 4 °C. Wild-type and mutant His6-Uup proteins were purified from cells of strain BL21(DE3)(pLysS) carrying the respective alleles on plasmid vector pET15b. After growth, cells were suspended in 20 ml of buffer TNA (10 mm Tris-HCl, pH 8.0, 150 mm NaCl) supplemented with one tablet of Roche Applied Science Complete EDTA-free protease inhibitor mixture. Cell suspension was disrupted in an SLM Aminco French® pressure cell press (SLM Instruments, Urbana, IL) at 14,000 p.s.i., and the cell lysates were centrifuged for 5 min at 5,000 × g. After removal of cell debris, cell extracts were centrifuged at 100,000 × g for 1 h at 4°C, and His6-Uup and its variants were purified from the supernatants, supplemented with 5 mm imidazole on an Ni-NTA-agarose column (Qiagen), as described in the supplier's handbook. The column was washed with 20 ml of TNA containing 40 mm imidazole, and proteins were eluted in 10 ml of TNA containing 250 mm imidazole, except for UupΔCTD, which was eluted at 1 m imidazole. 1-ml fractions were analyzed by SDS-PAGE, and those containing recombinant proteins were pooled and extensively dialyzed against TNA in SlideALyser cassettes (Pierce, 30,000 Da). After concentration with a centrifugal filter (Amicon, 30,000-Da cutoff) to a final volume of 5 ml, proteins were applied onto a Superose 6 10/300 GL column, equilibrated in the same buffer, and fitted on an ΔKTA device (Amersham Biosciences). The purity of the protein samples was assessed by SDS-PAGE followed by Coomassie Blue staining. Finally the fractions containing pure proteins were combined and concentrated. Protein concentration was colorimetrically determined by using the Bradford protein assay kit (Bio-Rad).ATPase Assay—Hydrolysis of ATP was monitored by assaying the amount of inorganic phosphate liberated from ATP using NaH2PO4 as a standard as described previously (21Mourez M. Jehanno M. Schneider E. Dassa E. Mol. Microbiol. 1998; 30: 353-363Crossref PubMed Scopus (33) Google Scholar) with slight modifications. Standard reaction mixtures (250 μl) contained 50 mm Tris-HCl, pH 7.5, 200 mm NaCl, 10 mm MgCl2, 20% (v/v) glycerol, 0.1 mm EDTA, 2 mm dithiothreitol, and purified protein (5-100 μg). The reaction was started by adding ATP (0.25-2 mm) and terminated after various times by the addition of the Malachite Green reagent. Absorbance was measured at 630 nm. Vanadate inhibition was achieved by adding 0.01-10 mm orthovanadate prepared as described previously (22Goodno C.C. Methods Enzymol. 1982; 85: 116-123Crossref PubMed Scopus (179) Google Scholar). N-Ethylmaleimide inhibition was achieved by adding 0.01-4 mm N-ethylmaleimide prepared in 100% ethanol.Limited Proteolysis by Trypsin—Digestion with trypsin was carried out as described previously (21Mourez M. Jehanno M. Schneider E. Dassa E. Mol. Microbiol. 1998; 30: 353-363Crossref PubMed Scopus (33) Google Scholar) with slight modifications. 20 μg of purified His6-Uup were incubated at 0 °C in TNA buffer containing 10 mm MgCl2 with and without 2 mm ATP. The reaction was initiated by the addition of trypsin (Uup:trypsin, 1:1, w/w). After 10-60 min of incubation, 15-μl samples were withdrawn and mixed immediately with concentrated gel loading buffer. Digestion products were separated by SDS-PAGE (15% acrylamide) and visualized by staining with Coomassie Blue.Gel Mobility Shift DNA Binding Assay—DNA probes were generated by PCR, purified, and 3′-end-labeled with phage T4 polynucleotide kinase and [γ-32P]ATP (370 MBq·ml-1). DNA binding experiments were performed in a buffer as described previously (23Bellier A. Mazodier P. J. Bacteriol. 2004; 186: 3238-3248Crossref PubMed Scopus (44) Google Scholar). 5-20 μg of protein were incubated for 20 min at room temperature with [γ-32P]ATP-labeled DNA (20,000 cpm) and 1 μg of poly(dI-dC) (nonspecific competitor) in a final volume of 10 μl. Samples were loaded onto polyacrylamide gels, which were then dried, analyzed by autoradiography, and quantitated with a PhosphorImager (Amersham Biosciences).Complementation Studies—Detection of precise excision of a mini-Tn10 inserted within the lacZ gene was done by a colony papillation assay on MacConkey lactose medium as described previously (9Reddy M. Gowrishankar J. J. Bacteriol. 2000; 182: 1978-1986Crossref PubMed Scopus (21) Google Scholar). To study the ability of uup and its Walker motif B variants to complement a null mutant of uup, these genes were placed under the control of the araBAD promoter into vector pBAD18 (24Guzman L.M. Belin D. Carson M.J. Beckwith J. J. Bacteriol. 1995; 177: 4121-4130Crossref PubMed Scopus (3906) Google Scholar), and these constructs were introduced into the λ prophage attB site of MG1655 by using the λ InCh system (25Boyd D. Weiss D.S. Chen J.C. Beckwith J. J. Bacteriol. 2000; 182: 842-847Crossref PubMed Scopus (150) Google Scholar). The attB-inserted genes, whose expression was inducible by l-arabinose at a final concentration of 0.2%, were transduced in strain GJ1886, which carried a uup gene inactivated by the insertion of a defective Tn10 transposon (7Reddy M. Gowrishankar J. J. Bacteriol. 1997; 179: 2892-2899Crossref PubMed Google Scholar). Then the araBAD::aadA7 mutation was transduced from MG1655ΔaraBADΔlacIZ into these strains to avoid the effects of arabinose utilization on the phenotype of mutants on MacConkey lactose plates.Sequence Analysis—Sequence similarity searches were performed using PSI-BLAST (26Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (59182) Google Scholar) on a non-redundant version of Swiss-Prot (178,545 sequences) using as query amino acids 511-635 of the E. coli uup sequence. The search was limited to iteration 3 due to the inclusion of nonspecific sequences in subsequent iterations. Results of iteration 3 only gathered ABC proteins and DNA polymerase Y little fingers. Hydrophobic cluster analysis (HCA) was used to predict and compare secondary structures (27Gaboriaud C. Bissery V. Benchetrit T. Mornon J.P. FEBS Lett. 1987; 224: 149-155Crossref PubMed Scopus (541) Google Scholar, 28Callebaut I. Labesse G. Durand P. Poupon A. Canard L. Chomilier J. Henrissat B. Mornon J.P. Cell. Mol. Life Sci. 1997; 53: 621-645Crossref PubMed Scopus (430) Google Scholar). In the HCA plots, the sequence is written on a duplicated α-helical net in which hydrophobic amino acids (Val, Ile, Leu, Phe, Met, Tyr, and Trp) are contoured. These form clusters, which mainly correspond to regular secondary structures (α-helices and β-strands). Clusters often constitute robust signatures allowing an efficient comparison of related but divergent sequences.Miscellaneous Methods—Subcellular fractionation, protein solubility tests, SDS-PAGE, and immunoblotting were performed as described previously (21Mourez M. Jehanno M. Schneider E. Dassa E. Mol. Microbiol. 1998; 30: 353-363Crossref PubMed Scopus (33) Google Scholar). For raising antibodies directed against His6-Uup, two New Zealand White rabbits were immunized by intradermic injection of purified protein according to standard protocols. Antibodies were absorbed on total cellular extracts of strain DM1. Protein identification by matrix-assisted laser desorption ionization time-of-flight mass spectrometry was performed by the Institut Pasteur Proteomic Facility. Protein identification by amino-terminal partial sequencing was performed by the Institut Pasteur Protein Analysis Facility on Applied Biosystems model 473 and 494 sequencers.RESULTSOverproduction and Purification of Recombinant His6-Uup—To optimize expression and solubility of recombinant Uup, 5-ml cultures of E. coli strain BL21(DE3)(pLysS) cells harboring plasmid pETuup were grown at different temperature and induction conditions. As can be seen in Fig. 1 lane 5, 0.25 mm IPTG-induced cells synthesized a major protein with an apparent molecular mass of 72 kDa, that was absent in non-induced cells (lane 1) or in control cells harboring pET15b (data not shown). When induced cells were disrupted by sonication, 70% of the 72-kDa protein was found in the supernatant of the cell extract centrifuged at 20,000 × g (Fig. 1, lanes 6 and 7). The apparent molecular mass corresponds well with the data deduced from the nucleotide sequence of His6-Uup. Purification of His6-Uup was performed as described under “Experimental Procedures.” The soluble fraction of broken cells was purified on a nickel-chelating resin. Because few bands were visible on the Coomassie Blue-stained gel after the first purification step (Fig. 2A), a second purification step on a Superose 6 10/300 GL column was undertaken to improve purification and to estimate the native apparent molecular mass of the His6-Uup protein. The protein eluted at an apparent molecular mass of 110 kDa (Fig. 2B). The same molecular mass was deduced from the migration of the protein on a Sephacryl S300 column (data not shown), indicating that the anomalous mass was not due to interactions with the matrix. Treatment of the protein sample with 50 units of DNase I prior to chromatography does not lead to a change in apparent molecular mass.FIGURE 2Purification of His6-Uup. A, SDS-PAGE of Ni-NTA-purified His6-Uup. Lane 1, molecular mass markers; lane 2, 5 μl of dialyzed, concentrated Ni-NTA-purified His6-Uup (5 mg·ml-1). B, elution profile of size exclusion chromatography of Ni-NTA-purified His6-Uup. 500 μg of Ni-NTA-purified His6-Uup diluted in 1 ml of TNA were loaded on a calibrated Superose 6 column (Amersham Biosciences). The flow rate was 0.3 ml·min-1, and 0.5-ml fractions were collected. The arrows show the position of size markers (1, 158,000 Da; 2, 68,000 Da; 3, 45,000 Da). C, Coomassie Blue-stained SDS-PAGE of His6-Uup-containing fractions eluted from the Superose 6 column: lanes 26-29, 7.5 μl of fractions 26-29 corresponding to the Uup-rich fractions. The asterisk indicates a minor band shown to correspond to a degradation product of His6-Uup. mAU, milliabsorbance units.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Peak fractions analyzed by SDS-PAGE revealed that His6-Uup was pure to near homogeneity (Fig. 2C). A minor band (highlighted by an asterisk) was shown to correspond to a degradation product of His6-Uup as determined by mass spectrometry analysis (data not shown). The purification yield was 60 mg·liter-1. The protein was used to raise specific antibodies and for biochemical characterization.Uup Is a Cytosolic Protein—The antibodies raised against purified recombinant Uup protein were used to detect a protein that is present in total extracts of MG1655 and absent in those of the uup deletion strain DM1 by Western blotting. As shown in Fig. 3A, lane 1, a band of 69 kDa molecular mass is present only in total cell extracts of MG1655. We showed that Uup is detected from early exponential phase to stationary phase in similar amounts (data not shown). To determine the cellular location of Uup, equivalent volumes of membrane, ribosomal, and soluble fractions, prepared as described previously (21Mourez M. Jehanno M. Schneider E. Dassa E. Mol. Microbiol. 1998; 30: 353-363Crossref PubMed Scopus (33) Google Scholar), were probed by immunoblotting. No band was detected in membrane and ribosomal fractions; however, a strong signal corresponding to the Uup protein was detected in unbroken cells and debris and in soluble fractions (Fig. 3B, lanes 1 and 4), suggesting that Uup is a cytosolic protein. In the soluble fraction, two other bands were immunodetected, and their migration is similar to that of material detected in the uup deletion strain.FIGURE 3Subcellular localization of Uup by cell fractionation. A, immunoblot of crude extracts probed with the polyclonal antibody directed against Uup protein (1:5,000). Lane 1, wild-type strain MG1655; lane 2, uup deletion mutant DM1. B, fractionation of MG1655 cells. Cells of a 50-ml culture in LB were fractionated as described previously (21Mourez M. Jehanno M. Schneider E. Dassa E. Mol. Microbiol. 1998; 30: 353-363Crossref PubMed Scopus (33) Google Scholar). Particulate fractions were resuspended in the same volume as soluble extracts. Equivalent volumes of unbroken cells and debris (lane 1), membrane (lane 2), ribosomal (lane 3), and cytoplasmic (lane 4) fractions were separated by SDS-PAGE and probed by immunoblotting as described in A. The position of Uup is shown by an arrow, and nonspecific cross-reacting material is indicated by asterisks.View Large Image Figure ViewerDownload Hi-res image" @default.
• W2031900580 created "2016-06-24" @default.
• W2031900580 creator A5045752196 @default.
• W2031900580 creator A5078028093 @default.
• W2031900580 creator A5078193068 @default.
• W2031900580 creator A5083064307 @default.
• W2031900580 date "2006-03-01" @default.
• W2031900580 modified "2023-10-15" @default.
• W2031900580 title "ATP Hydrolysis Is Essential for the Function of the Uup ATP-binding Cassette ATPase in Precise Excision of Transposons" @default.
• W2031900580 cites W1503817775 @default.
• W2031900580 cites W1510205875 @default.
• W2031900580 cites W1515069540 @default.
• W2031900580 cites W1536266674 @default.
• W2031900580 cites W1579211638 @default.
• W2031900580 cites W1841521301 @default.
• W2031900580 cites W1849328177 @default.
• W2031900580 cites W1938522541 @default.
• W2031900580 cites W1967105053 @default.
• W2031900580 cites W1969008019 @default.
• W2031900580 cites W1971003485 @default.
• W2031900580 cites W1972961211 @default.
• W2031900580 cites W1978526316 @default.
• W2031900580 cites W1978876322 @default.
• W2031900580 cites W1983379128 @default.
• W2031900580 cites W1986663500 @default.
• W2031900580 cites W1987641460 @default.
• W2031900580 cites W1994772523 @default.
• W2031900580 cites W1997394341 @default.
• W2031900580 cites W2000264313 @default.
• W2031900580 cites W2014746315 @default.
• W2031900580 cites W2021843169 @default.
• W2031900580 cites W2026984793 @default.
• W2031900580 cites W2033234643 @default.
• W2031900580 cites W2033432987 @default.
• W2031900580 cites W2035354696 @default.
• W2031900580 cites W2044495644 @default.
• W2031900580 cites W2045042938 @default.
• W2031900580 cites W2072828263 @default.
• W2031900580 cites W2073159328 @default.
• W2031900580 cites W2079955502 @default.
• W2031900580 cites W2090428984 @default.
• W2031900580 cites W2091044266 @default.
• W2031900580 cites W2095374620 @default.
• W2031900580 cites W2095594479 @default.
• W2031900580 cites W2098273707 @default.
• W2031900580 cites W2102253648 @default.
• W2031900580 cites W2102712804 @default.
• W2031900580 cites W2102971074 @default.
• W2031900580 cites W2104019741 @default.
• W2031900580 cites W2108800696 @default.
• W2031900580 cites W2110629185 @default.
• W2031900580 cites W2111198831 @default.
• W2031900580 cites W2120965701 @default.
• W2031900580 cites W2130460588 @default.
• W2031900580 cites W2135941888 @default.
• W2031900580 cites W2142785321 @default.
• W2031900580 cites W2145757131 @default.
• W2031900580 cites W2147018428 @default.
• W2031900580 cites W2147655656 @default.
• W2031900580 cites W2148348812 @default.
• W2031900580 cites W2154205324 @default.
• W2031900580 cites W2158031669 @default.
• W2031900580 cites W2158714788 @default.
• W2031900580 cites W2160084442 @default.
• W2031900580 cites W2160450267 @default.
• W2031900580 cites W2168826725 @default.
• W2031900580 cites W4324004225 @default.
• W2031900580 doi "https://doi.org/10.1074/jbc.m509926200" @default.
• W2031900580 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16407313" @default.
• W2031900580 hasPublicationYear "2006" @default.
• W2031900580 type Work @default.
• W2031900580 sameAs 2031900580 @default.
• W2031900580 citedByCount "26" @default.
• W2031900580 countsByYear W20319005802012 @default.
• W2031900580 countsByYear W20319005802014 @default.
• W2031900580 countsByYear W20319005802017 @default.
• W2031900580 countsByYear W20319005802018 @default.
• W2031900580 countsByYear W20319005802019 @default.
• W2031900580 countsByYear W20319005802020 @default.
• W2031900580 countsByYear W20319005802022 @default.
• W2031900580 countsByYear W20319005802023 @default.
• W2031900580 crossrefType "journal-article" @default.
• W2031900580 hasAuthorship W2031900580A5045752196 @default.
• W2031900580 hasAuthorship W2031900580A5078028093 @default.
• W2031900580 hasAuthorship W2031900580A5078193068 @default.
• W2031900580 hasAuthorship W2031900580A5083064307 @default.
• W2031900580 hasBestOaLocation W20319005801 @default.
• W2031900580 hasConcept C104317684 @default.
• W2031900580 hasConcept C14036430 @default.
• W2031900580 hasConcept C141315368 @default.
• W2031900580 hasConcept C143065580 @default.
• W2031900580 hasConcept C181199279 @default.
• W2031900580 hasConcept C185592680 @default.
• W2031900580 hasConcept C191678065 @default.
• W2031900580 hasConcept C23265538 @default.
• W2031900580 hasConcept C2779564974 @default.
• W2031900580 hasConcept C4918238 @default.
• W2031900580 hasConcept C55493867 @default.

• next